diff options
Diffstat (limited to '.venv/lib/python3.12/site-packages/regex')
-rw-r--r-- | .venv/lib/python3.12/site-packages/regex/__init__.py | 3 | ||||
-rwxr-xr-x | .venv/lib/python3.12/site-packages/regex/_regex.cpython-312-x86_64-linux-gnu.so | bin | 0 -> 2605512 bytes | |||
-rw-r--r-- | .venv/lib/python3.12/site-packages/regex/_regex_core.py | 4495 | ||||
-rw-r--r-- | .venv/lib/python3.12/site-packages/regex/regex.py | 746 | ||||
-rw-r--r-- | .venv/lib/python3.12/site-packages/regex/test_regex.py | 4488 |
5 files changed, 9732 insertions, 0 deletions
diff --git a/.venv/lib/python3.12/site-packages/regex/__init__.py b/.venv/lib/python3.12/site-packages/regex/__init__.py new file mode 100644 index 00000000..eb06564a --- /dev/null +++ b/.venv/lib/python3.12/site-packages/regex/__init__.py @@ -0,0 +1,3 @@ +from .regex import * +from . import regex +__all__ = regex.__all__ diff --git a/.venv/lib/python3.12/site-packages/regex/_regex.cpython-312-x86_64-linux-gnu.so b/.venv/lib/python3.12/site-packages/regex/_regex.cpython-312-x86_64-linux-gnu.so Binary files differnew file mode 100755 index 00000000..63eb3ae3 --- /dev/null +++ b/.venv/lib/python3.12/site-packages/regex/_regex.cpython-312-x86_64-linux-gnu.so diff --git a/.venv/lib/python3.12/site-packages/regex/_regex_core.py b/.venv/lib/python3.12/site-packages/regex/_regex_core.py new file mode 100644 index 00000000..b2ffeaea --- /dev/null +++ b/.venv/lib/python3.12/site-packages/regex/_regex_core.py @@ -0,0 +1,4495 @@ +# +# Secret Labs' Regular Expression Engine core module +# +# Copyright (c) 1998-2001 by Secret Labs AB. All rights reserved. +# +# This version of the SRE library can be redistributed under CNRI's +# Python 1.6 license. For any other use, please contact Secret Labs +# AB (info@pythonware.com). +# +# Portions of this engine have been developed in cooperation with +# CNRI. Hewlett-Packard provided funding for 1.6 integration and +# other compatibility work. +# +# 2010-01-16 mrab Python front-end re-written and extended + +import enum +import string +import unicodedata +from collections import defaultdict + +import regex._regex as _regex + +__all__ = ["A", "ASCII", "B", "BESTMATCH", "D", "DEBUG", "E", "ENHANCEMATCH", + "F", "FULLCASE", "I", "IGNORECASE", "L", "LOCALE", "M", "MULTILINE", "P", + "POSIX", "R", "REVERSE", "S", "DOTALL", "T", "TEMPLATE", "U", "UNICODE", + "V0", "VERSION0", "V1", "VERSION1", "W", "WORD", "X", "VERBOSE", "error", + "Scanner", "RegexFlag"] + +# The regex exception. +class error(Exception): + """Exception raised for invalid regular expressions. + + Attributes: + + msg: The unformatted error message + pattern: The regular expression pattern + pos: The position in the pattern where compilation failed, or None + lineno: The line number where compilation failed, unless pos is None + colno: The column number where compilation failed, unless pos is None + """ + + def __init__(self, message, pattern=None, pos=None): + newline = '\n' if isinstance(pattern, str) else b'\n' + self.msg = message + self.pattern = pattern + self.pos = pos + if pattern is not None and pos is not None: + self.lineno = pattern.count(newline, 0, pos) + 1 + self.colno = pos - pattern.rfind(newline, 0, pos) + + message = "{} at position {}".format(message, pos) + + if newline in pattern: + message += " (line {}, column {})".format(self.lineno, + self.colno) + + Exception.__init__(self, message) + +# The exception for when a positional flag has been turned on in the old +# behaviour. +class _UnscopedFlagSet(Exception): + pass + +# The exception for when parsing fails and we want to try something else. +class ParseError(Exception): + pass + +# The exception for when there isn't a valid first set. +class _FirstSetError(Exception): + pass + +# Flags. +class RegexFlag(enum.IntFlag): + A = ASCII = 0x80 # Assume ASCII locale. + B = BESTMATCH = 0x1000 # Best fuzzy match. + D = DEBUG = 0x200 # Print parsed pattern. + E = ENHANCEMATCH = 0x8000 # Attempt to improve the fit after finding the first + # fuzzy match. + F = FULLCASE = 0x4000 # Unicode full case-folding. + I = IGNORECASE = 0x2 # Ignore case. + L = LOCALE = 0x4 # Assume current 8-bit locale. + M = MULTILINE = 0x8 # Make anchors look for newline. + P = POSIX = 0x10000 # POSIX-style matching (leftmost longest). + R = REVERSE = 0x400 # Search backwards. + S = DOTALL = 0x10 # Make dot match newline. + U = UNICODE = 0x20 # Assume Unicode locale. + V0 = VERSION0 = 0x2000 # Old legacy behaviour. + V1 = VERSION1 = 0x100 # New enhanced behaviour. + W = WORD = 0x800 # Default Unicode word breaks. + X = VERBOSE = 0x40 # Ignore whitespace and comments. + T = TEMPLATE = 0x1 # Template (present because re module has it). + + def __repr__(self): + if self._name_ is not None: + return 'regex.%s' % self._name_ + + value = self._value_ + members = [] + negative = value < 0 + + if negative: + value = ~value + + for m in self.__class__: + if value & m._value_: + value &= ~m._value_ + members.append('regex.%s' % m._name_) + + if value: + members.append(hex(value)) + + res = '|'.join(members) + + if negative: + if len(members) > 1: + res = '~(%s)' % res + else: + res = '~%s' % res + + return res + + __str__ = object.__str__ + +globals().update(RegexFlag.__members__) + +DEFAULT_VERSION = VERSION1 + +_ALL_VERSIONS = VERSION0 | VERSION1 +_ALL_ENCODINGS = ASCII | LOCALE | UNICODE + +# The default flags for the various versions. +DEFAULT_FLAGS = {VERSION0: 0, VERSION1: FULLCASE} + +# The mask for the flags. +GLOBAL_FLAGS = (_ALL_VERSIONS | BESTMATCH | DEBUG | ENHANCEMATCH | POSIX | + REVERSE) +SCOPED_FLAGS = (FULLCASE | IGNORECASE | MULTILINE | DOTALL | WORD | VERBOSE | + _ALL_ENCODINGS) + +ALPHA = frozenset(string.ascii_letters) +DIGITS = frozenset(string.digits) +ALNUM = ALPHA | DIGITS +OCT_DIGITS = frozenset(string.octdigits) +HEX_DIGITS = frozenset(string.hexdigits) +SPECIAL_CHARS = frozenset("()|?*+{^$.[\\#") | frozenset([""]) +NAMED_CHAR_PART = ALNUM | frozenset(" -") +PROPERTY_NAME_PART = ALNUM | frozenset(" &_-.") +SET_OPS = ("||", "~~", "&&", "--") + +# The width of the code words inside the regex engine. +BYTES_PER_CODE = _regex.get_code_size() +BITS_PER_CODE = BYTES_PER_CODE * 8 + +# The repeat count which represents infinity. +UNLIMITED = (1 << BITS_PER_CODE) - 1 + +# The regular expression flags. +REGEX_FLAGS = {"a": ASCII, "b": BESTMATCH, "e": ENHANCEMATCH, "f": FULLCASE, + "i": IGNORECASE, "L": LOCALE, "m": MULTILINE, "p": POSIX, "r": REVERSE, + "s": DOTALL, "u": UNICODE, "V0": VERSION0, "V1": VERSION1, "w": WORD, "x": + VERBOSE} + +# The case flags. +CASE_FLAGS = FULLCASE | IGNORECASE +NOCASE = 0 +FULLIGNORECASE = FULLCASE | IGNORECASE + +FULL_CASE_FOLDING = UNICODE | FULLIGNORECASE + +CASE_FLAGS_COMBINATIONS = {0: 0, FULLCASE: 0, IGNORECASE: IGNORECASE, + FULLIGNORECASE: FULLIGNORECASE} + +# The number of digits in hexadecimal escapes. +HEX_ESCAPES = {"x": 2, "u": 4, "U": 8} + +# The names of the opcodes. +OPCODES = """ +FAILURE +SUCCESS +ANY +ANY_ALL +ANY_ALL_REV +ANY_REV +ANY_U +ANY_U_REV +ATOMIC +BOUNDARY +BRANCH +CALL_REF +CHARACTER +CHARACTER_IGN +CHARACTER_IGN_REV +CHARACTER_REV +CONDITIONAL +DEFAULT_BOUNDARY +DEFAULT_END_OF_WORD +DEFAULT_START_OF_WORD +END +END_OF_LINE +END_OF_LINE_U +END_OF_STRING +END_OF_STRING_LINE +END_OF_STRING_LINE_U +END_OF_WORD +FUZZY +GRAPHEME_BOUNDARY +GREEDY_REPEAT +GROUP +GROUP_CALL +GROUP_EXISTS +KEEP +LAZY_REPEAT +LOOKAROUND +NEXT +PROPERTY +PROPERTY_IGN +PROPERTY_IGN_REV +PROPERTY_REV +PRUNE +RANGE +RANGE_IGN +RANGE_IGN_REV +RANGE_REV +REF_GROUP +REF_GROUP_FLD +REF_GROUP_FLD_REV +REF_GROUP_IGN +REF_GROUP_IGN_REV +REF_GROUP_REV +SEARCH_ANCHOR +SET_DIFF +SET_DIFF_IGN +SET_DIFF_IGN_REV +SET_DIFF_REV +SET_INTER +SET_INTER_IGN +SET_INTER_IGN_REV +SET_INTER_REV +SET_SYM_DIFF +SET_SYM_DIFF_IGN +SET_SYM_DIFF_IGN_REV +SET_SYM_DIFF_REV +SET_UNION +SET_UNION_IGN +SET_UNION_IGN_REV +SET_UNION_REV +SKIP +START_OF_LINE +START_OF_LINE_U +START_OF_STRING +START_OF_WORD +STRING +STRING_FLD +STRING_FLD_REV +STRING_IGN +STRING_IGN_REV +STRING_REV +FUZZY_EXT +""" + +# Define the opcodes in a namespace. +class Namespace: + pass + +OP = Namespace() +for i, op in enumerate(OPCODES.split()): + setattr(OP, op, i) + +def _shrink_cache(cache_dict, args_dict, locale_sensitive, max_length, divisor=5): + """Make room in the given cache. + + Args: + cache_dict: The cache dictionary to modify. + args_dict: The dictionary of named list args used by patterns. + max_length: Maximum # of entries in cache_dict before it is shrunk. + divisor: Cache will shrink to max_length - 1/divisor*max_length items. + """ + # Toss out a fraction of the entries at random to make room for new ones. + # A random algorithm was chosen as opposed to simply cache_dict.popitem() + # as popitem could penalize the same regular expression repeatedly based + # on its internal hash value. Being random should spread the cache miss + # love around. + cache_keys = tuple(cache_dict.keys()) + overage = len(cache_keys) - max_length + if overage < 0: + # Cache is already within limits. Normally this should not happen + # but it could due to multithreading. + return + + number_to_toss = max_length // divisor + overage + + # The import is done here to avoid a circular dependency. + import random + if not hasattr(random, 'sample'): + # Do nothing while resolving the circular dependency: + # re->random->warnings->tokenize->string->re + return + + for doomed_key in random.sample(cache_keys, number_to_toss): + try: + del cache_dict[doomed_key] + except KeyError: + # Ignore problems if the cache changed from another thread. + pass + + # Rebuild the arguments and locale-sensitivity dictionaries. + args_dict.clear() + sensitivity_dict = {} + for pattern, pattern_type, flags, args, default_version, locale in tuple(cache_dict): + args_dict[pattern, pattern_type, flags, default_version, locale] = args + try: + sensitivity_dict[pattern_type, pattern] = locale_sensitive[pattern_type, pattern] + except KeyError: + pass + + locale_sensitive.clear() + locale_sensitive.update(sensitivity_dict) + +def _fold_case(info, string): + "Folds the case of a string." + flags = info.flags + if (flags & _ALL_ENCODINGS) == 0: + flags |= info.guess_encoding + + return _regex.fold_case(flags, string) + +def is_cased_i(info, char): + "Checks whether a character is cased." + return len(_regex.get_all_cases(info.flags, char)) > 1 + +def is_cased_f(flags, char): + "Checks whether a character is cased." + return len(_regex.get_all_cases(flags, char)) > 1 + +def _compile_firstset(info, fs): + "Compiles the firstset for the pattern." + reverse = bool(info.flags & REVERSE) + fs = _check_firstset(info, reverse, fs) + if not fs: + return [] + + # Compile the firstset. + return fs.compile(reverse) + +def _check_firstset(info, reverse, fs): + "Checks the firstset for the pattern." + if not fs or None in fs: + return None + + # If we ignore the case, for simplicity we won't build a firstset. + members = set() + case_flags = NOCASE + for i in fs: + if isinstance(i, Character) and not i.positive: + return None + +# if i.case_flags: +# if isinstance(i, Character): +# if is_cased_i(info, i.value): +# return [] +# elif isinstance(i, SetBase): +# return [] + case_flags |= i.case_flags + members.add(i.with_flags(case_flags=NOCASE)) + + if case_flags == (FULLCASE | IGNORECASE): + return None + + # Build the firstset. + fs = SetUnion(info, list(members), case_flags=case_flags & ~FULLCASE, + zerowidth=True) + fs = fs.optimise(info, reverse, in_set=True) + + return fs + +def _flatten_code(code): + "Flattens the code from a list of tuples." + flat_code = [] + for c in code: + flat_code.extend(c) + + return flat_code + +def make_case_flags(info): + "Makes the case flags." + flags = info.flags & CASE_FLAGS + + # Turn off FULLCASE if ASCII is turned on. + if info.flags & ASCII: + flags &= ~FULLCASE + + return flags + +def make_character(info, value, in_set=False): + "Makes a character literal." + if in_set: + # A character set is built case-sensitively. + return Character(value) + + return Character(value, case_flags=make_case_flags(info)) + +def make_ref_group(info, name, position): + "Makes a group reference." + return RefGroup(info, name, position, case_flags=make_case_flags(info)) + +def make_string_set(info, name): + "Makes a string set." + return StringSet(info, name, case_flags=make_case_flags(info)) + +def make_property(info, prop, in_set): + "Makes a property." + if in_set: + return prop + + return prop.with_flags(case_flags=make_case_flags(info)) + +def _parse_pattern(source, info): + "Parses a pattern, eg. 'a|b|c'." + branches = [parse_sequence(source, info)] + while source.match("|"): + branches.append(parse_sequence(source, info)) + + if len(branches) == 1: + return branches[0] + return Branch(branches) + +def parse_sequence(source, info): + "Parses a sequence, eg. 'abc'." + sequence = [None] + case_flags = make_case_flags(info) + while True: + saved_pos = source.pos + ch = source.get() + if ch in SPECIAL_CHARS: + if ch in ")|": + # The end of a sequence. At the end of the pattern ch is "". + source.pos = saved_pos + break + elif ch == "\\": + # An escape sequence outside a set. + sequence.append(parse_escape(source, info, False)) + elif ch == "(": + # A parenthesised subpattern or a flag. + element = parse_paren(source, info) + if element is None: + case_flags = make_case_flags(info) + else: + sequence.append(element) + elif ch == ".": + # Any character. + if info.flags & DOTALL: + sequence.append(AnyAll()) + elif info.flags & WORD: + sequence.append(AnyU()) + else: + sequence.append(Any()) + elif ch == "[": + # A character set. + sequence.append(parse_set(source, info)) + elif ch == "^": + # The start of a line or the string. + if info.flags & MULTILINE: + if info.flags & WORD: + sequence.append(StartOfLineU()) + else: + sequence.append(StartOfLine()) + else: + sequence.append(StartOfString()) + elif ch == "$": + # The end of a line or the string. + if info.flags & MULTILINE: + if info.flags & WORD: + sequence.append(EndOfLineU()) + else: + sequence.append(EndOfLine()) + else: + if info.flags & WORD: + sequence.append(EndOfStringLineU()) + else: + sequence.append(EndOfStringLine()) + elif ch in "?*+{": + # Looks like a quantifier. + counts = parse_quantifier(source, info, ch) + if counts: + # It _is_ a quantifier. + apply_quantifier(source, info, counts, case_flags, ch, + saved_pos, sequence) + sequence.append(None) + else: + # It's not a quantifier. Maybe it's a fuzzy constraint. + constraints = parse_fuzzy(source, info, ch, case_flags) + if constraints: + # It _is_ a fuzzy constraint. + apply_constraint(source, info, constraints, case_flags, + saved_pos, sequence) + sequence.append(None) + else: + # The element was just a literal. + sequence.append(Character(ord(ch), + case_flags=case_flags)) + else: + # A literal. + sequence.append(Character(ord(ch), case_flags=case_flags)) + else: + # A literal. + sequence.append(Character(ord(ch), case_flags=case_flags)) + + sequence = [item for item in sequence if item is not None] + return Sequence(sequence) + +def apply_quantifier(source, info, counts, case_flags, ch, saved_pos, + sequence): + element = sequence.pop() + if element is None: + if sequence: + raise error("multiple repeat", source.string, saved_pos) + raise error("nothing to repeat", source.string, saved_pos) + + if isinstance(element, (GreedyRepeat, LazyRepeat, PossessiveRepeat)): + raise error("multiple repeat", source.string, saved_pos) + + min_count, max_count = counts + saved_pos = source.pos + ch = source.get() + if ch == "?": + # The "?" suffix that means it's a lazy repeat. + repeated = LazyRepeat + elif ch == "+": + # The "+" suffix that means it's a possessive repeat. + repeated = PossessiveRepeat + else: + # No suffix means that it's a greedy repeat. + source.pos = saved_pos + repeated = GreedyRepeat + + # Ignore the quantifier if it applies to a zero-width item or the number of + # repeats is fixed at 1. + if not element.is_empty() and (min_count != 1 or max_count != 1): + element = repeated(element, min_count, max_count) + + sequence.append(element) + +def apply_constraint(source, info, constraints, case_flags, saved_pos, + sequence): + element = sequence.pop() + if element is None: + raise error("nothing for fuzzy constraint", source.string, saved_pos) + + # If a group is marked as fuzzy then put all of the fuzzy part in the + # group. + if isinstance(element, Group): + element.subpattern = Fuzzy(element.subpattern, constraints) + sequence.append(element) + else: + sequence.append(Fuzzy(element, constraints)) + +_QUANTIFIERS = {"?": (0, 1), "*": (0, None), "+": (1, None)} + +def parse_quantifier(source, info, ch): + "Parses a quantifier." + q = _QUANTIFIERS.get(ch) + if q: + # It's a quantifier. + return q + + if ch == "{": + # Looks like a limited repeated element, eg. 'a{2,3}'. + counts = parse_limited_quantifier(source) + if counts: + return counts + + return None + +def is_above_limit(count): + "Checks whether a count is above the maximum." + return count is not None and count >= UNLIMITED + +def parse_limited_quantifier(source): + "Parses a limited quantifier." + saved_pos = source.pos + min_count = parse_count(source) + if source.match(","): + max_count = parse_count(source) + + # No minimum means 0 and no maximum means unlimited. + min_count = int(min_count or 0) + max_count = int(max_count) if max_count else None + else: + if not min_count: + source.pos = saved_pos + return None + + min_count = max_count = int(min_count) + + if not source.match ("}"): + source.pos = saved_pos + return None + + if is_above_limit(min_count) or is_above_limit(max_count): + raise error("repeat count too big", source.string, saved_pos) + + if max_count is not None and min_count > max_count: + raise error("min repeat greater than max repeat", source.string, + saved_pos) + + return min_count, max_count + +def parse_fuzzy(source, info, ch, case_flags): + "Parses a fuzzy setting, if present." + saved_pos = source.pos + + if ch != "{": + return None + + constraints = {} + try: + parse_fuzzy_item(source, constraints) + while source.match(","): + parse_fuzzy_item(source, constraints) + except ParseError: + source.pos = saved_pos + return None + + if source.match(":"): + constraints["test"] = parse_fuzzy_test(source, info, case_flags) + + if not source.match("}"): + raise error("expected }", source.string, source.pos) + + return constraints + +def parse_fuzzy_item(source, constraints): + "Parses a fuzzy setting item." + saved_pos = source.pos + try: + parse_cost_constraint(source, constraints) + except ParseError: + source.pos = saved_pos + + parse_cost_equation(source, constraints) + +def parse_cost_constraint(source, constraints): + "Parses a cost constraint." + saved_pos = source.pos + ch = source.get() + if ch in ALPHA: + # Syntax: constraint [("<=" | "<") cost] + constraint = parse_constraint(source, constraints, ch) + + max_inc = parse_fuzzy_compare(source) + + if max_inc is None: + # No maximum cost. + constraints[constraint] = 0, None + else: + # There's a maximum cost. + cost_pos = source.pos + max_cost = parse_cost_limit(source) + + # Inclusive or exclusive limit? + if not max_inc: + max_cost -= 1 + + if max_cost < 0: + raise error("bad fuzzy cost limit", source.string, cost_pos) + + constraints[constraint] = 0, max_cost + elif ch in DIGITS: + # Syntax: cost ("<=" | "<") constraint ("<=" | "<") cost + source.pos = saved_pos + + # Minimum cost. + cost_pos = source.pos + min_cost = parse_cost_limit(source) + + min_inc = parse_fuzzy_compare(source) + if min_inc is None: + raise ParseError() + + constraint = parse_constraint(source, constraints, source.get()) + + max_inc = parse_fuzzy_compare(source) + if max_inc is None: + raise ParseError() + + # Maximum cost. + cost_pos = source.pos + max_cost = parse_cost_limit(source) + + # Inclusive or exclusive limits? + if not min_inc: + min_cost += 1 + if not max_inc: + max_cost -= 1 + + if not 0 <= min_cost <= max_cost: + raise error("bad fuzzy cost limit", source.string, cost_pos) + + constraints[constraint] = min_cost, max_cost + else: + raise ParseError() + +def parse_cost_limit(source): + "Parses a cost limit." + cost_pos = source.pos + digits = parse_count(source) + + try: + return int(digits) + except ValueError: + pass + + raise error("bad fuzzy cost limit", source.string, cost_pos) + +def parse_constraint(source, constraints, ch): + "Parses a constraint." + if ch not in "deis": + raise ParseError() + + if ch in constraints: + raise ParseError() + + return ch + +def parse_fuzzy_compare(source): + "Parses a cost comparator." + if source.match("<="): + return True + elif source.match("<"): + return False + else: + return None + +def parse_cost_equation(source, constraints): + "Parses a cost equation." + if "cost" in constraints: + raise error("more than one cost equation", source.string, source.pos) + + cost = {} + + parse_cost_term(source, cost) + while source.match("+"): + parse_cost_term(source, cost) + + max_inc = parse_fuzzy_compare(source) + if max_inc is None: + raise ParseError() + + max_cost = int(parse_count(source)) + + if not max_inc: + max_cost -= 1 + + if max_cost < 0: + raise error("bad fuzzy cost limit", source.string, source.pos) + + cost["max"] = max_cost + + constraints["cost"] = cost + +def parse_cost_term(source, cost): + "Parses a cost equation term." + coeff = parse_count(source) + ch = source.get() + if ch not in "dis": + raise ParseError() + + if ch in cost: + raise error("repeated fuzzy cost", source.string, source.pos) + + cost[ch] = int(coeff or 1) + +def parse_fuzzy_test(source, info, case_flags): + saved_pos = source.pos + ch = source.get() + if ch in SPECIAL_CHARS: + if ch == "\\": + # An escape sequence outside a set. + return parse_escape(source, info, False) + elif ch == ".": + # Any character. + if info.flags & DOTALL: + return AnyAll() + elif info.flags & WORD: + return AnyU() + else: + return Any() + elif ch == "[": + # A character set. + return parse_set(source, info) + else: + raise error("expected character set", source.string, saved_pos) + elif ch: + # A literal. + return Character(ord(ch), case_flags=case_flags) + else: + raise error("expected character set", source.string, saved_pos) + +def parse_count(source): + "Parses a quantifier's count, which can be empty." + return source.get_while(DIGITS) + +def parse_paren(source, info): + """Parses a parenthesised subpattern or a flag. Returns FLAGS if it's an + inline flag. + """ + saved_pos = source.pos + ch = source.get(True) + if ch == "?": + # (?... + saved_pos_2 = source.pos + ch = source.get(True) + if ch == "<": + # (?<... + saved_pos_3 = source.pos + ch = source.get() + if ch in ("=", "!"): + # (?<=... or (?<!...: lookbehind. + return parse_lookaround(source, info, True, ch == "=") + + # (?<...: a named capture group. + source.pos = saved_pos_3 + name = parse_name(source) + group = info.open_group(name) + source.expect(">") + saved_flags = info.flags + try: + subpattern = _parse_pattern(source, info) + source.expect(")") + finally: + info.flags = saved_flags + source.ignore_space = bool(info.flags & VERBOSE) + + info.close_group() + return Group(info, group, subpattern) + if ch in ("=", "!"): + # (?=... or (?!...: lookahead. + return parse_lookaround(source, info, False, ch == "=") + if ch == "P": + # (?P...: a Python extension. + return parse_extension(source, info) + if ch == "#": + # (?#...: a comment. + return parse_comment(source) + if ch == "(": + # (?(...: a conditional subpattern. + return parse_conditional(source, info) + if ch == ">": + # (?>...: an atomic subpattern. + return parse_atomic(source, info) + if ch == "|": + # (?|...: a common/reset groups branch. + return parse_common(source, info) + if ch == "R" or "0" <= ch <= "9": + # (?R...: probably a call to a group. + return parse_call_group(source, info, ch, saved_pos_2) + if ch == "&": + # (?&...: a call to a named group. + return parse_call_named_group(source, info, saved_pos_2) + + # (?...: probably a flags subpattern. + source.pos = saved_pos_2 + return parse_flags_subpattern(source, info) + + if ch == "*": + # (*... + saved_pos_2 = source.pos + word = source.get_while(set(")>"), include=False) + if word[ : 1].isalpha(): + verb = VERBS.get(word) + if not verb: + raise error("unknown verb", source.string, saved_pos_2) + + source.expect(")") + + return verb + + # (...: an unnamed capture group. + source.pos = saved_pos + group = info.open_group() + saved_flags = info.flags + try: + subpattern = _parse_pattern(source, info) + source.expect(")") + finally: + info.flags = saved_flags + source.ignore_space = bool(info.flags & VERBOSE) + + info.close_group() + + return Group(info, group, subpattern) + +def parse_extension(source, info): + "Parses a Python extension." + saved_pos = source.pos + ch = source.get() + if ch == "<": + # (?P<...: a named capture group. + name = parse_name(source) + group = info.open_group(name) + source.expect(">") + saved_flags = info.flags + try: + subpattern = _parse_pattern(source, info) + source.expect(")") + finally: + info.flags = saved_flags + source.ignore_space = bool(info.flags & VERBOSE) + + info.close_group() + + return Group(info, group, subpattern) + if ch == "=": + # (?P=...: a named group reference. + name = parse_name(source, allow_numeric=True) + source.expect(")") + if info.is_open_group(name): + raise error("cannot refer to an open group", source.string, + saved_pos) + + return make_ref_group(info, name, saved_pos) + if ch == ">" or ch == "&": + # (?P>...: a call to a group. + return parse_call_named_group(source, info, saved_pos) + + source.pos = saved_pos + raise error("unknown extension", source.string, saved_pos) + +def parse_comment(source): + "Parses a comment." + while True: + saved_pos = source.pos + c = source.get(True) + + if not c or c == ")": + break + + if c == "\\": + c = source.get(True) + + source.pos = saved_pos + source.expect(")") + + return None + +def parse_lookaround(source, info, behind, positive): + "Parses a lookaround." + saved_flags = info.flags + try: + subpattern = _parse_pattern(source, info) + source.expect(")") + finally: + info.flags = saved_flags + source.ignore_space = bool(info.flags & VERBOSE) + + return LookAround(behind, positive, subpattern) + +def parse_conditional(source, info): + "Parses a conditional subpattern." + saved_flags = info.flags + saved_pos = source.pos + ch = source.get() + if ch == "?": + # (?(?... + ch = source.get() + if ch in ("=", "!"): + # (?(?=... or (?(?!...: lookahead conditional. + return parse_lookaround_conditional(source, info, False, ch == "=") + if ch == "<": + # (?(?<... + ch = source.get() + if ch in ("=", "!"): + # (?(?<=... or (?(?<!...: lookbehind conditional. + return parse_lookaround_conditional(source, info, True, ch == + "=") + + source.pos = saved_pos + raise error("expected lookaround conditional", source.string, + source.pos) + + source.pos = saved_pos + try: + group = parse_name(source, True) + source.expect(")") + yes_branch = parse_sequence(source, info) + if source.match("|"): + no_branch = parse_sequence(source, info) + else: + no_branch = Sequence() + + source.expect(")") + finally: + info.flags = saved_flags + source.ignore_space = bool(info.flags & VERBOSE) + + if yes_branch.is_empty() and no_branch.is_empty(): + return Sequence() + + return Conditional(info, group, yes_branch, no_branch, saved_pos) + +def parse_lookaround_conditional(source, info, behind, positive): + saved_flags = info.flags + try: + subpattern = _parse_pattern(source, info) + source.expect(")") + finally: + info.flags = saved_flags + source.ignore_space = bool(info.flags & VERBOSE) + + yes_branch = parse_sequence(source, info) + if source.match("|"): + no_branch = parse_sequence(source, info) + else: + no_branch = Sequence() + + source.expect(")") + + return LookAroundConditional(behind, positive, subpattern, yes_branch, + no_branch) + +def parse_atomic(source, info): + "Parses an atomic subpattern." + saved_flags = info.flags + try: + subpattern = _parse_pattern(source, info) + source.expect(")") + finally: + info.flags = saved_flags + source.ignore_space = bool(info.flags & VERBOSE) + + return Atomic(subpattern) + +def parse_common(source, info): + "Parses a common groups branch." + # Capture group numbers in different branches can reuse the group numbers. + initial_group_count = info.group_count + branches = [parse_sequence(source, info)] + final_group_count = info.group_count + while source.match("|"): + info.group_count = initial_group_count + branches.append(parse_sequence(source, info)) + final_group_count = max(final_group_count, info.group_count) + + info.group_count = final_group_count + source.expect(")") + + if len(branches) == 1: + return branches[0] + return Branch(branches) + +def parse_call_group(source, info, ch, pos): + "Parses a call to a group." + if ch == "R": + group = "0" + else: + group = ch + source.get_while(DIGITS) + + source.expect(")") + + return CallGroup(info, group, pos) + +def parse_call_named_group(source, info, pos): + "Parses a call to a named group." + group = parse_name(source) + source.expect(")") + + return CallGroup(info, group, pos) + +def parse_flag_set(source): + "Parses a set of inline flags." + flags = 0 + + try: + while True: + saved_pos = source.pos + ch = source.get() + if ch == "V": + ch += source.get() + flags |= REGEX_FLAGS[ch] + except KeyError: + source.pos = saved_pos + + return flags + +def parse_flags(source, info): + "Parses flags being turned on/off." + flags_on = parse_flag_set(source) + if source.match("-"): + flags_off = parse_flag_set(source) + if not flags_off: + raise error("bad inline flags: no flags after '-'", source.string, + source.pos) + else: + flags_off = 0 + + if flags_on & LOCALE: + # Remember that this pattern as an inline locale flag. + info.inline_locale = True + + return flags_on, flags_off + +def parse_subpattern(source, info, flags_on, flags_off): + "Parses a subpattern with scoped flags." + saved_flags = info.flags + info.flags = (info.flags | flags_on) & ~flags_off + source.ignore_space = bool(info.flags & VERBOSE) + try: + subpattern = _parse_pattern(source, info) + source.expect(")") + finally: + info.flags = saved_flags + source.ignore_space = bool(info.flags & VERBOSE) + + return subpattern + +def parse_flags_subpattern(source, info): + """Parses a flags subpattern. It could be inline flags or a subpattern + possibly with local flags. If it's a subpattern, then that's returned; + if it's a inline flags, then None is returned. + """ + flags_on, flags_off = parse_flags(source, info) + + if flags_off & GLOBAL_FLAGS: + raise error("bad inline flags: cannot turn off global flag", + source.string, source.pos) + + if flags_on & flags_off: + raise error("bad inline flags: flag turned on and off", source.string, + source.pos) + + # Handle flags which are global in all regex behaviours. + new_global_flags = (flags_on & ~info.global_flags) & GLOBAL_FLAGS + if new_global_flags: + info.global_flags |= new_global_flags + + # A global has been turned on, so reparse the pattern. + raise _UnscopedFlagSet(info.global_flags) + + # Ensure that from now on we have only scoped flags. + flags_on &= ~GLOBAL_FLAGS + + if source.match(":"): + return parse_subpattern(source, info, flags_on, flags_off) + + if source.match(")"): + parse_positional_flags(source, info, flags_on, flags_off) + return None + + raise error("unknown extension", source.string, source.pos) + +def parse_positional_flags(source, info, flags_on, flags_off): + "Parses positional flags." + info.flags = (info.flags | flags_on) & ~flags_off + source.ignore_space = bool(info.flags & VERBOSE) + +def parse_name(source, allow_numeric=False, allow_group_0=False): + "Parses a name." + name = source.get_while(set(")>"), include=False) + + if not name: + raise error("missing group name", source.string, source.pos) + + if name.isdigit(): + min_group = 0 if allow_group_0 else 1 + if not allow_numeric or int(name) < min_group: + raise error("bad character in group name", source.string, + source.pos) + else: + if not name.isidentifier(): + raise error("bad character in group name", source.string, + source.pos) + + return name + +def is_octal(string): + "Checks whether a string is octal." + return all(ch in OCT_DIGITS for ch in string) + +def is_decimal(string): + "Checks whether a string is decimal." + return all(ch in DIGITS for ch in string) + +def is_hexadecimal(string): + "Checks whether a string is hexadecimal." + return all(ch in HEX_DIGITS for ch in string) + +def parse_escape(source, info, in_set): + "Parses an escape sequence." + saved_ignore = source.ignore_space + source.ignore_space = False + ch = source.get() + source.ignore_space = saved_ignore + if not ch: + # A backslash at the end of the pattern. + raise error("bad escape (end of pattern)", source.string, source.pos) + if ch in HEX_ESCAPES: + # A hexadecimal escape sequence. + return parse_hex_escape(source, info, ch, HEX_ESCAPES[ch], in_set, ch) + elif ch == "g" and not in_set: + # A group reference. + saved_pos = source.pos + try: + return parse_group_ref(source, info) + except error: + # Invalid as a group reference, so assume it's a literal. + source.pos = saved_pos + + return make_character(info, ord(ch), in_set) + elif ch == "G" and not in_set: + # A search anchor. + return SearchAnchor() + elif ch == "L" and not in_set: + # A string set. + return parse_string_set(source, info) + elif ch == "N": + # A named codepoint. + return parse_named_char(source, info, in_set) + elif ch in "pP": + # A Unicode property, positive or negative. + return parse_property(source, info, ch == "p", in_set) + elif ch == "R" and not in_set: + # A line ending. + charset = [0x0A, 0x0B, 0x0C, 0x0D] + if info.guess_encoding == UNICODE: + charset.extend([0x85, 0x2028, 0x2029]) + + return Atomic(Branch([String([0x0D, 0x0A]), SetUnion(info, [Character(c) + for c in charset])])) + elif ch == "X" and not in_set: + # A grapheme cluster. + return Grapheme() + elif ch in ALPHA: + # An alphabetic escape sequence. + # Positional escapes aren't allowed inside a character set. + if not in_set: + if info.flags & WORD: + value = WORD_POSITION_ESCAPES.get(ch) + else: + value = POSITION_ESCAPES.get(ch) + + if value: + return value + + value = CHARSET_ESCAPES.get(ch) + if value: + return value + + value = CHARACTER_ESCAPES.get(ch) + if value: + return Character(ord(value)) + + raise error("bad escape \\%s" % ch, source.string, source.pos) + elif ch in DIGITS: + # A numeric escape sequence. + return parse_numeric_escape(source, info, ch, in_set) + else: + # A literal. + return make_character(info, ord(ch), in_set) + +def parse_numeric_escape(source, info, ch, in_set): + "Parses a numeric escape sequence." + if in_set or ch == "0": + # Octal escape sequence, max 3 digits. + return parse_octal_escape(source, info, [ch], in_set) + + # At least 1 digit, so either octal escape or group. + digits = ch + saved_pos = source.pos + ch = source.get() + if ch in DIGITS: + # At least 2 digits, so either octal escape or group. + digits += ch + saved_pos = source.pos + ch = source.get() + if is_octal(digits) and ch in OCT_DIGITS: + # 3 octal digits, so octal escape sequence. + encoding = info.flags & _ALL_ENCODINGS + if encoding == ASCII or encoding == LOCALE: + octal_mask = 0xFF + else: + octal_mask = 0x1FF + + value = int(digits + ch, 8) & octal_mask + return make_character(info, value) + + # Group reference. + source.pos = saved_pos + if info.is_open_group(digits): + raise error("cannot refer to an open group", source.string, source.pos) + + return make_ref_group(info, digits, source.pos) + +def parse_octal_escape(source, info, digits, in_set): + "Parses an octal escape sequence." + saved_pos = source.pos + ch = source.get() + while len(digits) < 3 and ch in OCT_DIGITS: + digits.append(ch) + saved_pos = source.pos + ch = source.get() + + source.pos = saved_pos + try: + value = int("".join(digits), 8) + return make_character(info, value, in_set) + except ValueError: + if digits[0] in OCT_DIGITS: + raise error("incomplete escape \\%s" % ''.join(digits), + source.string, source.pos) + else: + raise error("bad escape \\%s" % digits[0], source.string, + source.pos) + +def parse_hex_escape(source, info, esc, expected_len, in_set, type): + "Parses a hex escape sequence." + saved_pos = source.pos + digits = [] + for i in range(expected_len): + ch = source.get() + if ch not in HEX_DIGITS: + raise error("incomplete escape \\%s%s" % (type, ''.join(digits)), + source.string, saved_pos) + digits.append(ch) + + try: + value = int("".join(digits), 16) + except ValueError: + pass + else: + if value < 0x110000: + return make_character(info, value, in_set) + + # Bad hex escape. + raise error("bad hex escape \\%s%s" % (esc, ''.join(digits)), + source.string, saved_pos) + +def parse_group_ref(source, info): + "Parses a group reference." + source.expect("<") + saved_pos = source.pos + name = parse_name(source, True) + source.expect(">") + if info.is_open_group(name): + raise error("cannot refer to an open group", source.string, source.pos) + + return make_ref_group(info, name, saved_pos) + +def parse_string_set(source, info): + "Parses a string set reference." + source.expect("<") + name = parse_name(source, True) + source.expect(">") + if name is None or name not in info.kwargs: + raise error("undefined named list", source.string, source.pos) + + return make_string_set(info, name) + +def parse_named_char(source, info, in_set): + "Parses a named character." + saved_pos = source.pos + if source.match("{"): + name = source.get_while(NAMED_CHAR_PART, keep_spaces=True) + if source.match("}"): + try: + value = unicodedata.lookup(name) + return make_character(info, ord(value), in_set) + except KeyError: + raise error("undefined character name", source.string, + source.pos) + + source.pos = saved_pos + return make_character(info, ord("N"), in_set) + +def parse_property(source, info, positive, in_set): + "Parses a Unicode property." + saved_pos = source.pos + ch = source.get() + if ch == "{": + negate = source.match("^") + prop_name, name = parse_property_name(source) + if source.match("}"): + # It's correctly delimited. + prop = lookup_property(prop_name, name, positive != negate, source) + return make_property(info, prop, in_set) + elif ch and ch in "CLMNPSZ": + # An abbreviated property, eg \pL. + prop = lookup_property(None, ch, positive, source) + return make_property(info, prop, in_set) + + # Not a property, so treat as a literal "p" or "P". + source.pos = saved_pos + ch = "p" if positive else "P" + return make_character(info, ord(ch), in_set) + +def parse_property_name(source): + "Parses a property name, which may be qualified." + name = source.get_while(PROPERTY_NAME_PART) + saved_pos = source.pos + + ch = source.get() + if ch and ch in ":=": + prop_name = name + name = source.get_while(ALNUM | set(" &_-./")).strip() + + if name: + # Name after the ":" or "=", so it's a qualified name. + saved_pos = source.pos + else: + # No name after the ":" or "=", so assume it's an unqualified name. + prop_name, name = None, prop_name + else: + prop_name = None + + source.pos = saved_pos + return prop_name, name + +def parse_set(source, info): + "Parses a character set." + version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION + + saved_ignore = source.ignore_space + source.ignore_space = False + # Negative set? + negate = source.match("^") + try: + if version == VERSION0: + item = parse_set_imp_union(source, info) + else: + item = parse_set_union(source, info) + + if not source.match("]"): + raise error("missing ]", source.string, source.pos) + finally: + source.ignore_space = saved_ignore + + if negate: + item = item.with_flags(positive=not item.positive) + + item = item.with_flags(case_flags=make_case_flags(info)) + + return item + +def parse_set_union(source, info): + "Parses a set union ([x||y])." + items = [parse_set_symm_diff(source, info)] + while source.match("||"): + items.append(parse_set_symm_diff(source, info)) + + if len(items) == 1: + return items[0] + return SetUnion(info, items) + +def parse_set_symm_diff(source, info): + "Parses a set symmetric difference ([x~~y])." + items = [parse_set_inter(source, info)] + while source.match("~~"): + items.append(parse_set_inter(source, info)) + + if len(items) == 1: + return items[0] + return SetSymDiff(info, items) + +def parse_set_inter(source, info): + "Parses a set intersection ([x&&y])." + items = [parse_set_diff(source, info)] + while source.match("&&"): + items.append(parse_set_diff(source, info)) + + if len(items) == 1: + return items[0] + return SetInter(info, items) + +def parse_set_diff(source, info): + "Parses a set difference ([x--y])." + items = [parse_set_imp_union(source, info)] + while source.match("--"): + items.append(parse_set_imp_union(source, info)) + + if len(items) == 1: + return items[0] + return SetDiff(info, items) + +def parse_set_imp_union(source, info): + "Parses a set implicit union ([xy])." + version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION + + items = [parse_set_member(source, info)] + while True: + saved_pos = source.pos + if source.match("]"): + # End of the set. + source.pos = saved_pos + break + + if version == VERSION1 and any(source.match(op) for op in SET_OPS): + # The new behaviour has set operators. + source.pos = saved_pos + break + + items.append(parse_set_member(source, info)) + + if len(items) == 1: + return items[0] + return SetUnion(info, items) + +def parse_set_member(source, info): + "Parses a member in a character set." + # Parse a set item. + start = parse_set_item(source, info) + saved_pos1 = source.pos + if (not isinstance(start, Character) or not start.positive or not + source.match("-")): + # It's not the start of a range. + return start + + version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION + + # It looks like the start of a range of characters. + saved_pos2 = source.pos + if version == VERSION1 and source.match("-"): + # It's actually the set difference operator '--', so return the + # character. + source.pos = saved_pos1 + return start + + if source.match("]"): + # We've reached the end of the set, so return both the character and + # hyphen. + source.pos = saved_pos2 + return SetUnion(info, [start, Character(ord("-"))]) + + # Parse a set item. + end = parse_set_item(source, info) + if not isinstance(end, Character) or not end.positive: + # It's not a range, so return the character, hyphen and property. + return SetUnion(info, [start, Character(ord("-")), end]) + + # It _is_ a range. + if start.value > end.value: + raise error("bad character range", source.string, source.pos) + + if start.value == end.value: + return start + + return Range(start.value, end.value) + +def parse_set_item(source, info): + "Parses an item in a character set." + version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION + + if source.match("\\"): + # An escape sequence in a set. + return parse_escape(source, info, True) + + saved_pos = source.pos + if source.match("[:"): + # Looks like a POSIX character class. + try: + return parse_posix_class(source, info) + except ParseError: + # Not a POSIX character class. + source.pos = saved_pos + + if version == VERSION1 and source.match("["): + # It's the start of a nested set. + + # Negative set? + negate = source.match("^") + item = parse_set_union(source, info) + + if not source.match("]"): + raise error("missing ]", source.string, source.pos) + + if negate: + item = item.with_flags(positive=not item.positive) + + return item + + ch = source.get() + if not ch: + raise error("unterminated character set", source.string, source.pos) + + return Character(ord(ch)) + +def parse_posix_class(source, info): + "Parses a POSIX character class." + negate = source.match("^") + prop_name, name = parse_property_name(source) + if not source.match(":]"): + raise ParseError() + + return lookup_property(prop_name, name, not negate, source, posix=True) + +def float_to_rational(flt): + "Converts a float to a rational pair." + int_part = int(flt) + error = flt - int_part + if abs(error) < 0.0001: + return int_part, 1 + + den, num = float_to_rational(1.0 / error) + + return int_part * den + num, den + +def numeric_to_rational(numeric): + "Converts a numeric string to a rational string, if possible." + if numeric[ : 1] == "-": + sign, numeric = numeric[0], numeric[1 : ] + else: + sign = "" + + parts = numeric.split("/") + if len(parts) == 2: + num, den = float_to_rational(float(parts[0]) / float(parts[1])) + elif len(parts) == 1: + num, den = float_to_rational(float(parts[0])) + else: + raise ValueError() + + result = "{}{}/{}".format(sign, num, den) + if result.endswith("/1"): + return result[ : -2] + + return result + +def standardise_name(name): + "Standardises a property or value name." + try: + return numeric_to_rational("".join(name)) + except (ValueError, ZeroDivisionError): + return "".join(ch for ch in name if ch not in "_- ").upper() + +_POSIX_CLASSES = set('ALNUM DIGIT PUNCT XDIGIT'.split()) + +_BINARY_VALUES = set('YES Y NO N TRUE T FALSE F'.split()) + +def lookup_property(property, value, positive, source=None, posix=False): + "Looks up a property." + # Normalise the names (which may still be lists). + property = standardise_name(property) if property else None + value = standardise_name(value) + + if (property, value) == ("GENERALCATEGORY", "ASSIGNED"): + property, value, positive = "GENERALCATEGORY", "UNASSIGNED", not positive + + if posix and not property and value.upper() in _POSIX_CLASSES: + value = 'POSIX' + value + + if property: + # Both the property and the value are provided. + prop = PROPERTIES.get(property) + if not prop: + if not source: + raise error("unknown property") + + raise error("unknown property", source.string, source.pos) + + prop_id, value_dict = prop + val_id = value_dict.get(value) + if val_id is None: + if not source: + raise error("unknown property value") + + raise error("unknown property value", source.string, source.pos) + + return Property((prop_id << 16) | val_id, positive) + + # Only the value is provided. + # It might be the name of a GC, script or block value. + for property in ("GC", "SCRIPT", "BLOCK"): + prop_id, value_dict = PROPERTIES.get(property) + val_id = value_dict.get(value) + if val_id is not None: + return Property((prop_id << 16) | val_id, positive) + + # It might be the name of a binary property. + prop = PROPERTIES.get(value) + if prop: + prop_id, value_dict = prop + if set(value_dict) == _BINARY_VALUES: + return Property((prop_id << 16) | 1, positive) + + return Property(prop_id << 16, not positive) + + # It might be the name of a binary property starting with a prefix. + if value.startswith("IS"): + prop = PROPERTIES.get(value[2 : ]) + if prop: + prop_id, value_dict = prop + if "YES" in value_dict: + return Property((prop_id << 16) | 1, positive) + + # It might be the name of a script or block starting with a prefix. + for prefix, property in (("IS", "SCRIPT"), ("IN", "BLOCK")): + if value.startswith(prefix): + prop_id, value_dict = PROPERTIES.get(property) + val_id = value_dict.get(value[2 : ]) + if val_id is not None: + return Property((prop_id << 16) | val_id, positive) + + # Unknown property. + if not source: + raise error("unknown property") + + raise error("unknown property", source.string, source.pos) + +def _compile_replacement(source, pattern, is_unicode): + "Compiles a replacement template escape sequence." + ch = source.get() + if ch in ALPHA: + # An alphabetic escape sequence. + value = CHARACTER_ESCAPES.get(ch) + if value: + return False, [ord(value)] + + if ch in HEX_ESCAPES and (ch == "x" or is_unicode): + # A hexadecimal escape sequence. + return False, [parse_repl_hex_escape(source, HEX_ESCAPES[ch], ch)] + + if ch == "g": + # A group preference. + return True, [compile_repl_group(source, pattern)] + + if ch == "N" and is_unicode: + # A named character. + value = parse_repl_named_char(source) + if value is not None: + return False, [value] + + raise error("bad escape \\%s" % ch, source.string, source.pos) + + if isinstance(source.sep, bytes): + octal_mask = 0xFF + else: + octal_mask = 0x1FF + + if ch == "0": + # An octal escape sequence. + digits = ch + while len(digits) < 3: + saved_pos = source.pos + ch = source.get() + if ch not in OCT_DIGITS: + source.pos = saved_pos + break + digits += ch + + return False, [int(digits, 8) & octal_mask] + + if ch in DIGITS: + # Either an octal escape sequence (3 digits) or a group reference (max + # 2 digits). + digits = ch + saved_pos = source.pos + ch = source.get() + if ch in DIGITS: + digits += ch + saved_pos = source.pos + ch = source.get() + if ch and is_octal(digits + ch): + # An octal escape sequence. + return False, [int(digits + ch, 8) & octal_mask] + + # A group reference. + source.pos = saved_pos + return True, [int(digits)] + + if ch == "\\": + # An escaped backslash is a backslash. + return False, [ord("\\")] + + if not ch: + # A trailing backslash. + raise error("bad escape (end of pattern)", source.string, source.pos) + + # An escaped non-backslash is a backslash followed by the literal. + return False, [ord("\\"), ord(ch)] + +def parse_repl_hex_escape(source, expected_len, type): + "Parses a hex escape sequence in a replacement string." + digits = [] + for i in range(expected_len): + ch = source.get() + if ch not in HEX_DIGITS: + raise error("incomplete escape \\%s%s" % (type, ''.join(digits)), + source.string, source.pos) + digits.append(ch) + + return int("".join(digits), 16) + +def parse_repl_named_char(source): + "Parses a named character in a replacement string." + saved_pos = source.pos + if source.match("{"): + name = source.get_while(ALPHA | set(" ")) + + if source.match("}"): + try: + value = unicodedata.lookup(name) + return ord(value) + except KeyError: + raise error("undefined character name", source.string, + source.pos) + + source.pos = saved_pos + return None + +def compile_repl_group(source, pattern): + "Compiles a replacement template group reference." + source.expect("<") + name = parse_name(source, True, True) + + source.expect(">") + if name.isdigit(): + index = int(name) + if not 0 <= index <= pattern.groups: + raise error("invalid group reference", source.string, source.pos) + + return index + + try: + return pattern.groupindex[name] + except KeyError: + raise IndexError("unknown group") + +# The regular expression is parsed into a syntax tree. The different types of +# node are defined below. + +INDENT = " " +POSITIVE_OP = 0x1 +ZEROWIDTH_OP = 0x2 +FUZZY_OP = 0x4 +REVERSE_OP = 0x8 +REQUIRED_OP = 0x10 + +POS_TEXT = {False: "NON-MATCH", True: "MATCH"} +CASE_TEXT = {NOCASE: "", IGNORECASE: " SIMPLE_IGNORE_CASE", FULLCASE: "", + FULLIGNORECASE: " FULL_IGNORE_CASE"} + +def make_sequence(items): + if len(items) == 1: + return items[0] + return Sequence(items) + +# Common base class for all nodes. +class RegexBase: + def __init__(self): + self._key = self.__class__ + + def with_flags(self, positive=None, case_flags=None, zerowidth=None): + if positive is None: + positive = self.positive + else: + positive = bool(positive) + if case_flags is None: + case_flags = self.case_flags + else: + case_flags = CASE_FLAGS_COMBINATIONS[case_flags & CASE_FLAGS] + if zerowidth is None: + zerowidth = self.zerowidth + else: + zerowidth = bool(zerowidth) + + if (positive == self.positive and case_flags == self.case_flags and + zerowidth == self.zerowidth): + return self + + return self.rebuild(positive, case_flags, zerowidth) + + def fix_groups(self, pattern, reverse, fuzzy): + pass + + def optimise(self, info, reverse): + return self + + def pack_characters(self, info): + return self + + def remove_captures(self): + return self + + def is_atomic(self): + return True + + def can_be_affix(self): + return True + + def contains_group(self): + return False + + def get_firstset(self, reverse): + raise _FirstSetError() + + def has_simple_start(self): + return False + + def compile(self, reverse=False, fuzzy=False): + return self._compile(reverse, fuzzy) + + def is_empty(self): + return False + + def __hash__(self): + return hash(self._key) + + def __eq__(self, other): + return type(self) is type(other) and self._key == other._key + + def __ne__(self, other): + return not self.__eq__(other) + + def get_required_string(self, reverse): + return self.max_width(), None + +# Base class for zero-width nodes. +class ZeroWidthBase(RegexBase): + def __init__(self, positive=True): + RegexBase.__init__(self) + self.positive = bool(positive) + + self._key = self.__class__, self.positive + + def get_firstset(self, reverse): + return set([None]) + + def _compile(self, reverse, fuzzy): + flags = 0 + if self.positive: + flags |= POSITIVE_OP + if fuzzy: + flags |= FUZZY_OP + if reverse: + flags |= REVERSE_OP + return [(self._opcode, flags)] + + def dump(self, indent, reverse): + print("{}{} {}".format(INDENT * indent, self._op_name, + POS_TEXT[self.positive])) + + def max_width(self): + return 0 + +class Any(RegexBase): + _opcode = {False: OP.ANY, True: OP.ANY_REV} + _op_name = "ANY" + + def has_simple_start(self): + return True + + def _compile(self, reverse, fuzzy): + flags = 0 + if fuzzy: + flags |= FUZZY_OP + return [(self._opcode[reverse], flags)] + + def dump(self, indent, reverse): + print("{}{}".format(INDENT * indent, self._op_name)) + + def max_width(self): + return 1 + +class AnyAll(Any): + _opcode = {False: OP.ANY_ALL, True: OP.ANY_ALL_REV} + _op_name = "ANY_ALL" + +class AnyU(Any): + _opcode = {False: OP.ANY_U, True: OP.ANY_U_REV} + _op_name = "ANY_U" + +class Atomic(RegexBase): + def __init__(self, subpattern): + RegexBase.__init__(self) + self.subpattern = subpattern + + def fix_groups(self, pattern, reverse, fuzzy): + self.subpattern.fix_groups(pattern, reverse, fuzzy) + + def optimise(self, info, reverse): + self.subpattern = self.subpattern.optimise(info, reverse) + + if self.subpattern.is_empty(): + return self.subpattern + return self + + def pack_characters(self, info): + self.subpattern = self.subpattern.pack_characters(info) + return self + + def remove_captures(self): + self.subpattern = self.subpattern.remove_captures() + return self + + def can_be_affix(self): + return self.subpattern.can_be_affix() + + def contains_group(self): + return self.subpattern.contains_group() + + def get_firstset(self, reverse): + return self.subpattern.get_firstset(reverse) + + def has_simple_start(self): + return self.subpattern.has_simple_start() + + def _compile(self, reverse, fuzzy): + return ([(OP.ATOMIC, )] + self.subpattern.compile(reverse, fuzzy) + + [(OP.END, )]) + + def dump(self, indent, reverse): + print("{}ATOMIC".format(INDENT * indent)) + self.subpattern.dump(indent + 1, reverse) + + def is_empty(self): + return self.subpattern.is_empty() + + def __eq__(self, other): + return (type(self) is type(other) and self.subpattern == + other.subpattern) + + def max_width(self): + return self.subpattern.max_width() + + def get_required_string(self, reverse): + return self.subpattern.get_required_string(reverse) + +class Boundary(ZeroWidthBase): + _opcode = OP.BOUNDARY + _op_name = "BOUNDARY" + +class Branch(RegexBase): + def __init__(self, branches): + RegexBase.__init__(self) + self.branches = branches + + def fix_groups(self, pattern, reverse, fuzzy): + for b in self.branches: + b.fix_groups(pattern, reverse, fuzzy) + + def optimise(self, info, reverse): + if not self.branches: + return Sequence([]) + + # Flatten branches within branches. + branches = Branch._flatten_branches(info, reverse, self.branches) + + # Move any common prefix or suffix out of the branches. + if reverse: + suffix, branches = Branch._split_common_suffix(info, branches) + prefix = [] + else: + prefix, branches = Branch._split_common_prefix(info, branches) + suffix = [] + + # Try to reduce adjacent single-character branches to sets. + branches = Branch._reduce_to_set(info, reverse, branches) + + if len(branches) > 1: + sequence = [Branch(branches)] + + if not prefix or not suffix: + # We might be able to add a quick precheck before the branches. + firstset = self._add_precheck(info, reverse, branches) + + if firstset: + if reverse: + sequence.append(firstset) + else: + sequence.insert(0, firstset) + else: + sequence = branches + + return make_sequence(prefix + sequence + suffix) + + def _add_precheck(self, info, reverse, branches): + charset = set() + pos = -1 if reverse else 0 + + for branch in branches: + if type(branch) is Literal and branch.case_flags == NOCASE: + charset.add(branch.characters[pos]) + else: + return + + if not charset: + return None + + return _check_firstset(info, reverse, [Character(c) for c in charset]) + + def pack_characters(self, info): + self.branches = [b.pack_characters(info) for b in self.branches] + return self + + def remove_captures(self): + self.branches = [b.remove_captures() for b in self.branches] + return self + + def is_atomic(self): + return all(b.is_atomic() for b in self.branches) + + def can_be_affix(self): + return all(b.can_be_affix() for b in self.branches) + + def contains_group(self): + return any(b.contains_group() for b in self.branches) + + def get_firstset(self, reverse): + fs = set() + for b in self.branches: + fs |= b.get_firstset(reverse) + + return fs or set([None]) + + def _compile(self, reverse, fuzzy): + if not self.branches: + return [] + + code = [(OP.BRANCH, )] + for b in self.branches: + code.extend(b.compile(reverse, fuzzy)) + code.append((OP.NEXT, )) + + code[-1] = (OP.END, ) + + return code + + def dump(self, indent, reverse): + print("{}BRANCH".format(INDENT * indent)) + self.branches[0].dump(indent + 1, reverse) + for b in self.branches[1 : ]: + print("{}OR".format(INDENT * indent)) + b.dump(indent + 1, reverse) + + @staticmethod + def _flatten_branches(info, reverse, branches): + # Flatten the branches so that there aren't branches of branches. + new_branches = [] + for b in branches: + b = b.optimise(info, reverse) + if isinstance(b, Branch): + new_branches.extend(b.branches) + else: + new_branches.append(b) + + return new_branches + + @staticmethod + def _split_common_prefix(info, branches): + # Common leading items can be moved out of the branches. + # Get the items in the branches. + alternatives = [] + for b in branches: + if isinstance(b, Sequence): + alternatives.append(b.items) + else: + alternatives.append([b]) + + # What is the maximum possible length of the prefix? + max_count = min(len(a) for a in alternatives) + + # What is the longest common prefix? + prefix = alternatives[0] + pos = 0 + end_pos = max_count + while pos < end_pos and prefix[pos].can_be_affix() and all(a[pos] == + prefix[pos] for a in alternatives): + pos += 1 + count = pos + + if info.flags & UNICODE: + # We need to check that we're not splitting a sequence of + # characters which could form part of full case-folding. + count = pos + while count > 0 and not all(Branch._can_split(a, count) for a in + alternatives): + count -= 1 + + # No common prefix is possible. + if count == 0: + return [], branches + + # Rebuild the branches. + new_branches = [] + for a in alternatives: + new_branches.append(make_sequence(a[count : ])) + + return prefix[ : count], new_branches + + @staticmethod + def _split_common_suffix(info, branches): + # Common trailing items can be moved out of the branches. + # Get the items in the branches. + alternatives = [] + for b in branches: + if isinstance(b, Sequence): + alternatives.append(b.items) + else: + alternatives.append([b]) + + # What is the maximum possible length of the suffix? + max_count = min(len(a) for a in alternatives) + + # What is the longest common suffix? + suffix = alternatives[0] + pos = -1 + end_pos = -1 - max_count + while pos > end_pos and suffix[pos].can_be_affix() and all(a[pos] == + suffix[pos] for a in alternatives): + pos -= 1 + count = -1 - pos + + if info.flags & UNICODE: + # We need to check that we're not splitting a sequence of + # characters which could form part of full case-folding. + while count > 0 and not all(Branch._can_split_rev(a, count) for a + in alternatives): + count -= 1 + + # No common suffix is possible. + if count == 0: + return [], branches + + # Rebuild the branches. + new_branches = [] + for a in alternatives: + new_branches.append(make_sequence(a[ : -count])) + + return suffix[-count : ], new_branches + + @staticmethod + def _can_split(items, count): + # Check the characters either side of the proposed split. + if not Branch._is_full_case(items, count - 1): + return True + + if not Branch._is_full_case(items, count): + return True + + # Check whether a 1-1 split would be OK. + if Branch._is_folded(items[count - 1 : count + 1]): + return False + + # Check whether a 1-2 split would be OK. + if (Branch._is_full_case(items, count + 2) and + Branch._is_folded(items[count - 1 : count + 2])): + return False + + # Check whether a 2-1 split would be OK. + if (Branch._is_full_case(items, count - 2) and + Branch._is_folded(items[count - 2 : count + 1])): + return False + + return True + + @staticmethod + def _can_split_rev(items, count): + end = len(items) + + # Check the characters either side of the proposed split. + if not Branch._is_full_case(items, end - count): + return True + + if not Branch._is_full_case(items, end - count - 1): + return True + + # Check whether a 1-1 split would be OK. + if Branch._is_folded(items[end - count - 1 : end - count + 1]): + return False + + # Check whether a 1-2 split would be OK. + if (Branch._is_full_case(items, end - count + 2) and + Branch._is_folded(items[end - count - 1 : end - count + 2])): + return False + + # Check whether a 2-1 split would be OK. + if (Branch._is_full_case(items, end - count - 2) and + Branch._is_folded(items[end - count - 2 : end - count + 1])): + return False + + return True + + @staticmethod + def _merge_common_prefixes(info, reverse, branches): + # Branches with the same case-sensitive character prefix can be grouped + # together if they are separated only by other branches with a + # character prefix. + prefixed = defaultdict(list) + order = {} + new_branches = [] + for b in branches: + if Branch._is_simple_character(b): + # Branch starts with a simple character. + prefixed[b.value].append([b]) + order.setdefault(b.value, len(order)) + elif (isinstance(b, Sequence) and b.items and + Branch._is_simple_character(b.items[0])): + # Branch starts with a simple character. + prefixed[b.items[0].value].append(b.items) + order.setdefault(b.items[0].value, len(order)) + else: + Branch._flush_char_prefix(info, reverse, prefixed, order, + new_branches) + + new_branches.append(b) + + Branch._flush_char_prefix(info, prefixed, order, new_branches) + + return new_branches + + @staticmethod + def _is_simple_character(c): + return isinstance(c, Character) and c.positive and not c.case_flags + + @staticmethod + def _reduce_to_set(info, reverse, branches): + # Can the branches be reduced to a set? + new_branches = [] + items = set() + case_flags = NOCASE + for b in branches: + if isinstance(b, (Character, Property, SetBase)): + # Branch starts with a single character. + if b.case_flags != case_flags: + # Different case sensitivity, so flush. + Branch._flush_set_members(info, reverse, items, case_flags, + new_branches) + + case_flags = b.case_flags + + items.add(b.with_flags(case_flags=NOCASE)) + else: + Branch._flush_set_members(info, reverse, items, case_flags, + new_branches) + + new_branches.append(b) + + Branch._flush_set_members(info, reverse, items, case_flags, + new_branches) + + return new_branches + + @staticmethod + def _flush_char_prefix(info, reverse, prefixed, order, new_branches): + # Flush the prefixed branches. + if not prefixed: + return + + for value, branches in sorted(prefixed.items(), key=lambda pair: + order[pair[0]]): + if len(branches) == 1: + new_branches.append(make_sequence(branches[0])) + else: + subbranches = [] + optional = False + for b in branches: + if len(b) > 1: + subbranches.append(make_sequence(b[1 : ])) + elif not optional: + subbranches.append(Sequence()) + optional = True + + sequence = Sequence([Character(value), Branch(subbranches)]) + new_branches.append(sequence.optimise(info, reverse)) + + prefixed.clear() + order.clear() + + @staticmethod + def _flush_set_members(info, reverse, items, case_flags, new_branches): + # Flush the set members. + if not items: + return + + if len(items) == 1: + item = list(items)[0] + else: + item = SetUnion(info, list(items)).optimise(info, reverse) + + new_branches.append(item.with_flags(case_flags=case_flags)) + + items.clear() + + @staticmethod + def _is_full_case(items, i): + if not 0 <= i < len(items): + return False + + item = items[i] + return (isinstance(item, Character) and item.positive and + (item.case_flags & FULLIGNORECASE) == FULLIGNORECASE) + + @staticmethod + def _is_folded(items): + if len(items) < 2: + return False + + for i in items: + if (not isinstance(i, Character) or not i.positive or not + i.case_flags): + return False + + folded = "".join(chr(i.value) for i in items) + folded = _regex.fold_case(FULL_CASE_FOLDING, folded) + + # Get the characters which expand to multiple codepoints on folding. + expanding_chars = _regex.get_expand_on_folding() + + for c in expanding_chars: + if folded == _regex.fold_case(FULL_CASE_FOLDING, c): + return True + + return False + + def is_empty(self): + return all(b.is_empty() for b in self.branches) + + def __eq__(self, other): + return type(self) is type(other) and self.branches == other.branches + + def max_width(self): + return max(b.max_width() for b in self.branches) + +class CallGroup(RegexBase): + def __init__(self, info, group, position): + RegexBase.__init__(self) + self.info = info + self.group = group + self.position = position + + self._key = self.__class__, self.group + + def fix_groups(self, pattern, reverse, fuzzy): + try: + self.group = int(self.group) + except ValueError: + try: + self.group = self.info.group_index[self.group] + except KeyError: + raise error("invalid group reference", pattern, self.position) + + if not 0 <= self.group <= self.info.group_count: + raise error("unknown group", pattern, self.position) + + if self.group > 0 and self.info.open_group_count[self.group] > 1: + raise error("ambiguous group reference", pattern, self.position) + + self.info.group_calls.append((self, reverse, fuzzy)) + + self._key = self.__class__, self.group + + def remove_captures(self): + raise error("group reference not allowed", pattern, self.position) + + def _compile(self, reverse, fuzzy): + return [(OP.GROUP_CALL, self.call_ref)] + + def dump(self, indent, reverse): + print("{}GROUP_CALL {}".format(INDENT * indent, self.group)) + + def __eq__(self, other): + return type(self) is type(other) and self.group == other.group + + def max_width(self): + return UNLIMITED + + def __del__(self): + self.info = None + +class CallRef(RegexBase): + def __init__(self, ref, parsed): + self.ref = ref + self.parsed = parsed + + def _compile(self, reverse, fuzzy): + return ([(OP.CALL_REF, self.ref)] + self.parsed._compile(reverse, + fuzzy) + [(OP.END, )]) + +class Character(RegexBase): + _opcode = {(NOCASE, False): OP.CHARACTER, (IGNORECASE, False): + OP.CHARACTER_IGN, (FULLCASE, False): OP.CHARACTER, (FULLIGNORECASE, + False): OP.CHARACTER_IGN, (NOCASE, True): OP.CHARACTER_REV, (IGNORECASE, + True): OP.CHARACTER_IGN_REV, (FULLCASE, True): OP.CHARACTER_REV, + (FULLIGNORECASE, True): OP.CHARACTER_IGN_REV} + + def __init__(self, value, positive=True, case_flags=NOCASE, + zerowidth=False): + RegexBase.__init__(self) + self.value = value + self.positive = bool(positive) + self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags] + self.zerowidth = bool(zerowidth) + + if (self.positive and (self.case_flags & FULLIGNORECASE) == + FULLIGNORECASE): + self.folded = _regex.fold_case(FULL_CASE_FOLDING, chr(self.value)) + else: + self.folded = chr(self.value) + + self._key = (self.__class__, self.value, self.positive, + self.case_flags, self.zerowidth) + + def rebuild(self, positive, case_flags, zerowidth): + return Character(self.value, positive, case_flags, zerowidth) + + def optimise(self, info, reverse, in_set=False): + return self + + def get_firstset(self, reverse): + return set([self]) + + def has_simple_start(self): + return True + + def _compile(self, reverse, fuzzy): + flags = 0 + if self.positive: + flags |= POSITIVE_OP + if self.zerowidth: + flags |= ZEROWIDTH_OP + if fuzzy: + flags |= FUZZY_OP + + code = PrecompiledCode([self._opcode[self.case_flags, reverse], flags, + self.value]) + + if len(self.folded) > 1: + # The character expands on full case-folding. + code = Branch([code, String([ord(c) for c in self.folded], + case_flags=self.case_flags)]) + + return code.compile(reverse, fuzzy) + + def dump(self, indent, reverse): + display = ascii(chr(self.value)).lstrip("bu") + print("{}CHARACTER {} {}{}".format(INDENT * indent, + POS_TEXT[self.positive], display, CASE_TEXT[self.case_flags])) + + def matches(self, ch): + return (ch == self.value) == self.positive + + def max_width(self): + return len(self.folded) + + def get_required_string(self, reverse): + if not self.positive: + return 1, None + + self.folded_characters = tuple(ord(c) for c in self.folded) + + return 0, self + +class Conditional(RegexBase): + def __init__(self, info, group, yes_item, no_item, position): + RegexBase.__init__(self) + self.info = info + self.group = group + self.yes_item = yes_item + self.no_item = no_item + self.position = position + + def fix_groups(self, pattern, reverse, fuzzy): + try: + self.group = int(self.group) + except ValueError: + try: + self.group = self.info.group_index[self.group] + except KeyError: + if self.group == 'DEFINE': + # 'DEFINE' is a special name unless there's a group with + # that name. + self.group = 0 + else: + raise error("unknown group", pattern, self.position) + + if not 0 <= self.group <= self.info.group_count: + raise error("invalid group reference", pattern, self.position) + + self.yes_item.fix_groups(pattern, reverse, fuzzy) + self.no_item.fix_groups(pattern, reverse, fuzzy) + + def optimise(self, info, reverse): + yes_item = self.yes_item.optimise(info, reverse) + no_item = self.no_item.optimise(info, reverse) + + return Conditional(info, self.group, yes_item, no_item, self.position) + + def pack_characters(self, info): + self.yes_item = self.yes_item.pack_characters(info) + self.no_item = self.no_item.pack_characters(info) + return self + + def remove_captures(self): + self.yes_item = self.yes_item.remove_captures() + self.no_item = self.no_item.remove_captures() + + def is_atomic(self): + return self.yes_item.is_atomic() and self.no_item.is_atomic() + + def can_be_affix(self): + return self.yes_item.can_be_affix() and self.no_item.can_be_affix() + + def contains_group(self): + return self.yes_item.contains_group() or self.no_item.contains_group() + + def get_firstset(self, reverse): + return (self.yes_item.get_firstset(reverse) | + self.no_item.get_firstset(reverse)) + + def _compile(self, reverse, fuzzy): + code = [(OP.GROUP_EXISTS, self.group)] + code.extend(self.yes_item.compile(reverse, fuzzy)) + add_code = self.no_item.compile(reverse, fuzzy) + if add_code: + code.append((OP.NEXT, )) + code.extend(add_code) + + code.append((OP.END, )) + + return code + + def dump(self, indent, reverse): + print("{}GROUP_EXISTS {}".format(INDENT * indent, self.group)) + self.yes_item.dump(indent + 1, reverse) + if not self.no_item.is_empty(): + print("{}OR".format(INDENT * indent)) + self.no_item.dump(indent + 1, reverse) + + def is_empty(self): + return self.yes_item.is_empty() and self.no_item.is_empty() + + def __eq__(self, other): + return type(self) is type(other) and (self.group, self.yes_item, + self.no_item) == (other.group, other.yes_item, other.no_item) + + def max_width(self): + return max(self.yes_item.max_width(), self.no_item.max_width()) + + def __del__(self): + self.info = None + +class DefaultBoundary(ZeroWidthBase): + _opcode = OP.DEFAULT_BOUNDARY + _op_name = "DEFAULT_BOUNDARY" + +class DefaultEndOfWord(ZeroWidthBase): + _opcode = OP.DEFAULT_END_OF_WORD + _op_name = "DEFAULT_END_OF_WORD" + +class DefaultStartOfWord(ZeroWidthBase): + _opcode = OP.DEFAULT_START_OF_WORD + _op_name = "DEFAULT_START_OF_WORD" + +class EndOfLine(ZeroWidthBase): + _opcode = OP.END_OF_LINE + _op_name = "END_OF_LINE" + +class EndOfLineU(EndOfLine): + _opcode = OP.END_OF_LINE_U + _op_name = "END_OF_LINE_U" + +class EndOfString(ZeroWidthBase): + _opcode = OP.END_OF_STRING + _op_name = "END_OF_STRING" + +class EndOfStringLine(ZeroWidthBase): + _opcode = OP.END_OF_STRING_LINE + _op_name = "END_OF_STRING_LINE" + +class EndOfStringLineU(EndOfStringLine): + _opcode = OP.END_OF_STRING_LINE_U + _op_name = "END_OF_STRING_LINE_U" + +class EndOfWord(ZeroWidthBase): + _opcode = OP.END_OF_WORD + _op_name = "END_OF_WORD" + +class Failure(ZeroWidthBase): + _op_name = "FAILURE" + + def _compile(self, reverse, fuzzy): + return [(OP.FAILURE, )] + +class Fuzzy(RegexBase): + def __init__(self, subpattern, constraints=None): + RegexBase.__init__(self) + if constraints is None: + constraints = {} + self.subpattern = subpattern + self.constraints = constraints + + # If an error type is mentioned in the cost equation, then its maximum + # defaults to unlimited. + if "cost" in constraints: + for e in "dis": + if e in constraints["cost"]: + constraints.setdefault(e, (0, None)) + + # If any error type is mentioned, then all the error maxima default to + # 0, otherwise they default to unlimited. + if set(constraints) & set("dis"): + for e in "dis": + constraints.setdefault(e, (0, 0)) + else: + for e in "dis": + constraints.setdefault(e, (0, None)) + + # The maximum of the generic error type defaults to unlimited. + constraints.setdefault("e", (0, None)) + + # The cost equation defaults to equal costs. Also, the cost of any + # error type not mentioned in the cost equation defaults to 0. + if "cost" in constraints: + for e in "dis": + constraints["cost"].setdefault(e, 0) + else: + constraints["cost"] = {"d": 1, "i": 1, "s": 1, "max": + constraints["e"][1]} + + def fix_groups(self, pattern, reverse, fuzzy): + self.subpattern.fix_groups(pattern, reverse, True) + + def pack_characters(self, info): + self.subpattern = self.subpattern.pack_characters(info) + return self + + def remove_captures(self): + self.subpattern = self.subpattern.remove_captures() + return self + + def is_atomic(self): + return self.subpattern.is_atomic() + + def contains_group(self): + return self.subpattern.contains_group() + + def _compile(self, reverse, fuzzy): + # The individual limits. + arguments = [] + for e in "dise": + v = self.constraints[e] + arguments.append(v[0]) + arguments.append(UNLIMITED if v[1] is None else v[1]) + + # The coeffs of the cost equation. + for e in "dis": + arguments.append(self.constraints["cost"][e]) + + # The maximum of the cost equation. + v = self.constraints["cost"]["max"] + arguments.append(UNLIMITED if v is None else v) + + flags = 0 + if reverse: + flags |= REVERSE_OP + + test = self.constraints.get("test") + + if test: + return ([(OP.FUZZY_EXT, flags) + tuple(arguments)] + + test.compile(reverse, True) + [(OP.NEXT,)] + + self.subpattern.compile(reverse, True) + [(OP.END,)]) + + return ([(OP.FUZZY, flags) + tuple(arguments)] + + self.subpattern.compile(reverse, True) + [(OP.END,)]) + + def dump(self, indent, reverse): + constraints = self._constraints_to_string() + if constraints: + constraints = " " + constraints + print("{}FUZZY{}".format(INDENT * indent, constraints)) + self.subpattern.dump(indent + 1, reverse) + + def is_empty(self): + return self.subpattern.is_empty() + + def __eq__(self, other): + return (type(self) is type(other) and self.subpattern == + other.subpattern and self.constraints == other.constraints) + + def max_width(self): + return UNLIMITED + + def _constraints_to_string(self): + constraints = [] + + for name in "ids": + min, max = self.constraints[name] + if max == 0: + continue + + con = "" + + if min > 0: + con = "{}<=".format(min) + + con += name + + if max is not None: + con += "<={}".format(max) + + constraints.append(con) + + cost = [] + for name in "ids": + coeff = self.constraints["cost"][name] + if coeff > 0: + cost.append("{}{}".format(coeff, name)) + + limit = self.constraints["cost"]["max"] + if limit is not None and limit > 0: + cost = "{}<={}".format("+".join(cost), limit) + constraints.append(cost) + + return ",".join(constraints) + +class Grapheme(RegexBase): + def _compile(self, reverse, fuzzy): + # Match at least 1 character until a grapheme boundary is reached. Note + # that this is the same whether matching forwards or backwards. + grapheme_matcher = Atomic(Sequence([LazyRepeat(AnyAll(), 1, None), + GraphemeBoundary()])) + + return grapheme_matcher.compile(reverse, fuzzy) + + def dump(self, indent, reverse): + print("{}GRAPHEME".format(INDENT * indent)) + + def max_width(self): + return UNLIMITED + +class GraphemeBoundary: + def compile(self, reverse, fuzzy): + return [(OP.GRAPHEME_BOUNDARY, 1)] + +class GreedyRepeat(RegexBase): + _opcode = OP.GREEDY_REPEAT + _op_name = "GREEDY_REPEAT" + + def __init__(self, subpattern, min_count, max_count): + RegexBase.__init__(self) + self.subpattern = subpattern + self.min_count = min_count + self.max_count = max_count + + def fix_groups(self, pattern, reverse, fuzzy): + self.subpattern.fix_groups(pattern, reverse, fuzzy) + + def optimise(self, info, reverse): + subpattern = self.subpattern.optimise(info, reverse) + + return type(self)(subpattern, self.min_count, self.max_count) + + def pack_characters(self, info): + self.subpattern = self.subpattern.pack_characters(info) + return self + + def remove_captures(self): + self.subpattern = self.subpattern.remove_captures() + return self + + def is_atomic(self): + return self.min_count == self.max_count and self.subpattern.is_atomic() + + def can_be_affix(self): + return False + + def contains_group(self): + return self.subpattern.contains_group() + + def get_firstset(self, reverse): + fs = self.subpattern.get_firstset(reverse) + if self.min_count == 0: + fs.add(None) + + return fs + + def _compile(self, reverse, fuzzy): + repeat = [self._opcode, self.min_count] + if self.max_count is None: + repeat.append(UNLIMITED) + else: + repeat.append(self.max_count) + + subpattern = self.subpattern.compile(reverse, fuzzy) + if not subpattern: + return [] + + return ([tuple(repeat)] + subpattern + [(OP.END, )]) + + def dump(self, indent, reverse): + if self.max_count is None: + limit = "INF" + else: + limit = self.max_count + print("{}{} {} {}".format(INDENT * indent, self._op_name, + self.min_count, limit)) + + self.subpattern.dump(indent + 1, reverse) + + def is_empty(self): + return self.subpattern.is_empty() + + def __eq__(self, other): + return type(self) is type(other) and (self.subpattern, self.min_count, + self.max_count) == (other.subpattern, other.min_count, + other.max_count) + + def max_width(self): + if self.max_count is None: + return UNLIMITED + + return self.subpattern.max_width() * self.max_count + + def get_required_string(self, reverse): + max_count = UNLIMITED if self.max_count is None else self.max_count + if self.min_count == 0: + w = self.subpattern.max_width() * max_count + return min(w, UNLIMITED), None + + ofs, req = self.subpattern.get_required_string(reverse) + if req: + return ofs, req + + w = self.subpattern.max_width() * max_count + return min(w, UNLIMITED), None + +class PossessiveRepeat(GreedyRepeat): + def is_atomic(self): + return True + + def _compile(self, reverse, fuzzy): + subpattern = self.subpattern.compile(reverse, fuzzy) + if not subpattern: + return [] + + repeat = [self._opcode, self.min_count] + if self.max_count is None: + repeat.append(UNLIMITED) + else: + repeat.append(self.max_count) + + return ([(OP.ATOMIC, ), tuple(repeat)] + subpattern + [(OP.END, ), + (OP.END, )]) + + def dump(self, indent, reverse): + print("{}ATOMIC".format(INDENT * indent)) + + if self.max_count is None: + limit = "INF" + else: + limit = self.max_count + print("{}{} {} {}".format(INDENT * (indent + 1), self._op_name, + self.min_count, limit)) + + self.subpattern.dump(indent + 2, reverse) + +class Group(RegexBase): + def __init__(self, info, group, subpattern): + RegexBase.__init__(self) + self.info = info + self.group = group + self.subpattern = subpattern + + self.call_ref = None + + def fix_groups(self, pattern, reverse, fuzzy): + self.info.defined_groups[self.group] = (self, reverse, fuzzy) + self.subpattern.fix_groups(pattern, reverse, fuzzy) + + def optimise(self, info, reverse): + subpattern = self.subpattern.optimise(info, reverse) + + return Group(self.info, self.group, subpattern) + + def pack_characters(self, info): + self.subpattern = self.subpattern.pack_characters(info) + return self + + def remove_captures(self): + return self.subpattern.remove_captures() + + def is_atomic(self): + return self.subpattern.is_atomic() + + def can_be_affix(self): + return False + + def contains_group(self): + return True + + def get_firstset(self, reverse): + return self.subpattern.get_firstset(reverse) + + def has_simple_start(self): + return self.subpattern.has_simple_start() + + def _compile(self, reverse, fuzzy): + code = [] + + public_group = private_group = self.group + if private_group < 0: + public_group = self.info.private_groups[private_group] + private_group = self.info.group_count - private_group + + key = self.group, reverse, fuzzy + ref = self.info.call_refs.get(key) + if ref is not None: + code += [(OP.CALL_REF, ref)] + + code += [(OP.GROUP, int(not reverse), private_group, public_group)] + code += self.subpattern.compile(reverse, fuzzy) + code += [(OP.END, )] + + if ref is not None: + code += [(OP.END, )] + + return code + + def dump(self, indent, reverse): + group = self.group + if group < 0: + group = private_groups[group] + print("{}GROUP {}".format(INDENT * indent, group)) + self.subpattern.dump(indent + 1, reverse) + + def __eq__(self, other): + return (type(self) is type(other) and (self.group, self.subpattern) == + (other.group, other.subpattern)) + + def max_width(self): + return self.subpattern.max_width() + + def get_required_string(self, reverse): + return self.subpattern.get_required_string(reverse) + + def __del__(self): + self.info = None + +class Keep(ZeroWidthBase): + _opcode = OP.KEEP + _op_name = "KEEP" + +class LazyRepeat(GreedyRepeat): + _opcode = OP.LAZY_REPEAT + _op_name = "LAZY_REPEAT" + +class LookAround(RegexBase): + _dir_text = {False: "AHEAD", True: "BEHIND"} + + def __init__(self, behind, positive, subpattern): + RegexBase.__init__(self) + self.behind = bool(behind) + self.positive = bool(positive) + self.subpattern = subpattern + + def fix_groups(self, pattern, reverse, fuzzy): + self.subpattern.fix_groups(pattern, self.behind, fuzzy) + + def optimise(self, info, reverse): + subpattern = self.subpattern.optimise(info, self.behind) + if self.positive and subpattern.is_empty(): + return subpattern + + return LookAround(self.behind, self.positive, subpattern) + + def pack_characters(self, info): + self.subpattern = self.subpattern.pack_characters(info) + return self + + def remove_captures(self): + return self.subpattern.remove_captures() + + def is_atomic(self): + return self.subpattern.is_atomic() + + def can_be_affix(self): + return self.subpattern.can_be_affix() + + def contains_group(self): + return self.subpattern.contains_group() + + def get_firstset(self, reverse): + if self.positive and self.behind == reverse: + return self.subpattern.get_firstset(reverse) + + return set([None]) + + def _compile(self, reverse, fuzzy): + flags = 0 + if self.positive: + flags |= POSITIVE_OP + if fuzzy: + flags |= FUZZY_OP + if reverse: + flags |= REVERSE_OP + + return ([(OP.LOOKAROUND, flags, int(not self.behind))] + + self.subpattern.compile(self.behind) + [(OP.END, )]) + + def dump(self, indent, reverse): + print("{}LOOK{} {}".format(INDENT * indent, + self._dir_text[self.behind], POS_TEXT[self.positive])) + self.subpattern.dump(indent + 1, self.behind) + + def is_empty(self): + return self.positive and self.subpattern.is_empty() + + def __eq__(self, other): + return type(self) is type(other) and (self.behind, self.positive, + self.subpattern) == (other.behind, other.positive, other.subpattern) + + def max_width(self): + return 0 + +class LookAroundConditional(RegexBase): + _dir_text = {False: "AHEAD", True: "BEHIND"} + + def __init__(self, behind, positive, subpattern, yes_item, no_item): + RegexBase.__init__(self) + self.behind = bool(behind) + self.positive = bool(positive) + self.subpattern = subpattern + self.yes_item = yes_item + self.no_item = no_item + + def fix_groups(self, pattern, reverse, fuzzy): + self.subpattern.fix_groups(pattern, reverse, fuzzy) + self.yes_item.fix_groups(pattern, reverse, fuzzy) + self.no_item.fix_groups(pattern, reverse, fuzzy) + + def optimise(self, info, reverse): + subpattern = self.subpattern.optimise(info, self.behind) + yes_item = self.yes_item.optimise(info, self.behind) + no_item = self.no_item.optimise(info, self.behind) + + return LookAroundConditional(self.behind, self.positive, subpattern, + yes_item, no_item) + + def pack_characters(self, info): + self.subpattern = self.subpattern.pack_characters(info) + self.yes_item = self.yes_item.pack_characters(info) + self.no_item = self.no_item.pack_characters(info) + return self + + def remove_captures(self): + self.subpattern = self.subpattern.remove_captures() + self.yes_item = self.yes_item.remove_captures() + self.no_item = self.no_item.remove_captures() + + def is_atomic(self): + return (self.subpattern.is_atomic() and self.yes_item.is_atomic() and + self.no_item.is_atomic()) + + def can_be_affix(self): + return (self.subpattern.can_be_affix() and self.yes_item.can_be_affix() + and self.no_item.can_be_affix()) + + def contains_group(self): + return (self.subpattern.contains_group() or + self.yes_item.contains_group() or self.no_item.contains_group()) + + def _compile(self, reverse, fuzzy): + code = [(OP.CONDITIONAL, int(self.positive), int(not self.behind))] + code.extend(self.subpattern.compile(self.behind, fuzzy)) + code.append((OP.NEXT, )) + code.extend(self.yes_item.compile(reverse, fuzzy)) + add_code = self.no_item.compile(reverse, fuzzy) + if add_code: + code.append((OP.NEXT, )) + code.extend(add_code) + + code.append((OP.END, )) + + return code + + def dump(self, indent, reverse): + print("{}CONDITIONAL {} {}".format(INDENT * indent, + self._dir_text[self.behind], POS_TEXT[self.positive])) + self.subpattern.dump(indent + 1, self.behind) + print("{}EITHER".format(INDENT * indent)) + self.yes_item.dump(indent + 1, reverse) + if not self.no_item.is_empty(): + print("{}OR".format(INDENT * indent)) + self.no_item.dump(indent + 1, reverse) + + def is_empty(self): + return (self.subpattern.is_empty() and self.yes_item.is_empty() or + self.no_item.is_empty()) + + def __eq__(self, other): + return type(self) is type(other) and (self.subpattern, self.yes_item, + self.no_item) == (other.subpattern, other.yes_item, other.no_item) + + def max_width(self): + return max(self.yes_item.max_width(), self.no_item.max_width()) + + def get_required_string(self, reverse): + return self.max_width(), None + +class PrecompiledCode(RegexBase): + def __init__(self, code): + self.code = code + + def _compile(self, reverse, fuzzy): + return [tuple(self.code)] + +class Property(RegexBase): + _opcode = {(NOCASE, False): OP.PROPERTY, (IGNORECASE, False): + OP.PROPERTY_IGN, (FULLCASE, False): OP.PROPERTY, (FULLIGNORECASE, False): + OP.PROPERTY_IGN, (NOCASE, True): OP.PROPERTY_REV, (IGNORECASE, True): + OP.PROPERTY_IGN_REV, (FULLCASE, True): OP.PROPERTY_REV, (FULLIGNORECASE, + True): OP.PROPERTY_IGN_REV} + + def __init__(self, value, positive=True, case_flags=NOCASE, + zerowidth=False): + RegexBase.__init__(self) + self.value = value + self.positive = bool(positive) + self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags] + self.zerowidth = bool(zerowidth) + + self._key = (self.__class__, self.value, self.positive, + self.case_flags, self.zerowidth) + + def rebuild(self, positive, case_flags, zerowidth): + return Property(self.value, positive, case_flags, zerowidth) + + def optimise(self, info, reverse, in_set=False): + return self + + def get_firstset(self, reverse): + return set([self]) + + def has_simple_start(self): + return True + + def _compile(self, reverse, fuzzy): + flags = 0 + if self.positive: + flags |= POSITIVE_OP + if self.zerowidth: + flags |= ZEROWIDTH_OP + if fuzzy: + flags |= FUZZY_OP + return [(self._opcode[self.case_flags, reverse], flags, self.value)] + + def dump(self, indent, reverse): + prop = PROPERTY_NAMES[self.value >> 16] + name, value = prop[0], prop[1][self.value & 0xFFFF] + print("{}PROPERTY {} {}:{}{}".format(INDENT * indent, + POS_TEXT[self.positive], name, value, CASE_TEXT[self.case_flags])) + + def matches(self, ch): + return _regex.has_property_value(self.value, ch) == self.positive + + def max_width(self): + return 1 + +class Prune(ZeroWidthBase): + _op_name = "PRUNE" + + def _compile(self, reverse, fuzzy): + return [(OP.PRUNE, )] + +class Range(RegexBase): + _opcode = {(NOCASE, False): OP.RANGE, (IGNORECASE, False): OP.RANGE_IGN, + (FULLCASE, False): OP.RANGE, (FULLIGNORECASE, False): OP.RANGE_IGN, + (NOCASE, True): OP.RANGE_REV, (IGNORECASE, True): OP.RANGE_IGN_REV, + (FULLCASE, True): OP.RANGE_REV, (FULLIGNORECASE, True): OP.RANGE_IGN_REV} + _op_name = "RANGE" + + def __init__(self, lower, upper, positive=True, case_flags=NOCASE, + zerowidth=False): + RegexBase.__init__(self) + self.lower = lower + self.upper = upper + self.positive = bool(positive) + self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags] + self.zerowidth = bool(zerowidth) + + self._key = (self.__class__, self.lower, self.upper, self.positive, + self.case_flags, self.zerowidth) + + def rebuild(self, positive, case_flags, zerowidth): + return Range(self.lower, self.upper, positive, case_flags, zerowidth) + + def optimise(self, info, reverse, in_set=False): + # Is the range case-sensitive? + if not self.positive or not (self.case_flags & IGNORECASE) or in_set: + return self + + # Is full case-folding possible? + if (not (info.flags & UNICODE) or (self.case_flags & FULLIGNORECASE) != + FULLIGNORECASE): + return self + + # Get the characters which expand to multiple codepoints on folding. + expanding_chars = _regex.get_expand_on_folding() + + # Get the folded characters in the range. + items = [] + for ch in expanding_chars: + if self.lower <= ord(ch) <= self.upper: + folded = _regex.fold_case(FULL_CASE_FOLDING, ch) + items.append(String([ord(c) for c in folded], + case_flags=self.case_flags)) + + if not items: + # We can fall back to simple case-folding. + return self + + if len(items) < self.upper - self.lower + 1: + # Not all the characters are covered by the full case-folding. + items.insert(0, self) + + return Branch(items) + + def _compile(self, reverse, fuzzy): + flags = 0 + if self.positive: + flags |= POSITIVE_OP + if self.zerowidth: + flags |= ZEROWIDTH_OP + if fuzzy: + flags |= FUZZY_OP + return [(self._opcode[self.case_flags, reverse], flags, self.lower, + self.upper)] + + def dump(self, indent, reverse): + display_lower = ascii(chr(self.lower)).lstrip("bu") + display_upper = ascii(chr(self.upper)).lstrip("bu") + print("{}RANGE {} {} {}{}".format(INDENT * indent, + POS_TEXT[self.positive], display_lower, display_upper, + CASE_TEXT[self.case_flags])) + + def matches(self, ch): + return (self.lower <= ch <= self.upper) == self.positive + + def max_width(self): + return 1 + +class RefGroup(RegexBase): + _opcode = {(NOCASE, False): OP.REF_GROUP, (IGNORECASE, False): + OP.REF_GROUP_IGN, (FULLCASE, False): OP.REF_GROUP, (FULLIGNORECASE, + False): OP.REF_GROUP_FLD, (NOCASE, True): OP.REF_GROUP_REV, (IGNORECASE, + True): OP.REF_GROUP_IGN_REV, (FULLCASE, True): OP.REF_GROUP_REV, + (FULLIGNORECASE, True): OP.REF_GROUP_FLD_REV} + + def __init__(self, info, group, position, case_flags=NOCASE): + RegexBase.__init__(self) + self.info = info + self.group = group + self.position = position + self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags] + + self._key = self.__class__, self.group, self.case_flags + + def fix_groups(self, pattern, reverse, fuzzy): + try: + self.group = int(self.group) + except ValueError: + try: + self.group = self.info.group_index[self.group] + except KeyError: + raise error("unknown group", pattern, self.position) + + if not 1 <= self.group <= self.info.group_count: + raise error("invalid group reference", pattern, self.position) + + self._key = self.__class__, self.group, self.case_flags + + def remove_captures(self): + raise error("group reference not allowed", pattern, self.position) + + def _compile(self, reverse, fuzzy): + flags = 0 + if fuzzy: + flags |= FUZZY_OP + return [(self._opcode[self.case_flags, reverse], flags, self.group)] + + def dump(self, indent, reverse): + print("{}REF_GROUP {}{}".format(INDENT * indent, self.group, + CASE_TEXT[self.case_flags])) + + def max_width(self): + return UNLIMITED + + def __del__(self): + self.info = None + +class SearchAnchor(ZeroWidthBase): + _opcode = OP.SEARCH_ANCHOR + _op_name = "SEARCH_ANCHOR" + +class Sequence(RegexBase): + def __init__(self, items=None): + RegexBase.__init__(self) + if items is None: + items = [] + + self.items = items + + def fix_groups(self, pattern, reverse, fuzzy): + for s in self.items: + s.fix_groups(pattern, reverse, fuzzy) + + def optimise(self, info, reverse): + # Flatten the sequences. + items = [] + for s in self.items: + s = s.optimise(info, reverse) + if isinstance(s, Sequence): + items.extend(s.items) + else: + items.append(s) + + return make_sequence(items) + + def pack_characters(self, info): + "Packs sequences of characters into strings." + items = [] + characters = [] + case_flags = NOCASE + for s in self.items: + if type(s) is Character and s.positive and not s.zerowidth: + if s.case_flags != case_flags: + # Different case sensitivity, so flush, unless neither the + # previous nor the new character are cased. + if s.case_flags or is_cased_i(info, s.value): + Sequence._flush_characters(info, characters, + case_flags, items) + + case_flags = s.case_flags + + characters.append(s.value) + elif type(s) is String or type(s) is Literal: + if s.case_flags != case_flags: + # Different case sensitivity, so flush, unless the neither + # the previous nor the new string are cased. + if s.case_flags or any(is_cased_i(info, c) for c in + characters): + Sequence._flush_characters(info, characters, + case_flags, items) + + case_flags = s.case_flags + + characters.extend(s.characters) + else: + Sequence._flush_characters(info, characters, case_flags, items) + + items.append(s.pack_characters(info)) + + Sequence._flush_characters(info, characters, case_flags, items) + + return make_sequence(items) + + def remove_captures(self): + self.items = [s.remove_captures() for s in self.items] + return self + + def is_atomic(self): + return all(s.is_atomic() for s in self.items) + + def can_be_affix(self): + return False + + def contains_group(self): + return any(s.contains_group() for s in self.items) + + def get_firstset(self, reverse): + fs = set() + items = self.items + if reverse: + items.reverse() + for s in items: + fs |= s.get_firstset(reverse) + if None not in fs: + return fs + fs.discard(None) + + return fs | set([None]) + + def has_simple_start(self): + return bool(self.items) and self.items[0].has_simple_start() + + def _compile(self, reverse, fuzzy): + seq = self.items + if reverse: + seq = seq[::-1] + + code = [] + for s in seq: + code.extend(s.compile(reverse, fuzzy)) + + return code + + def dump(self, indent, reverse): + for s in self.items: + s.dump(indent, reverse) + + @staticmethod + def _flush_characters(info, characters, case_flags, items): + if not characters: + return + + # Disregard case_flags if all of the characters are case-less. + if case_flags & IGNORECASE: + if not any(is_cased_i(info, c) for c in characters): + case_flags = NOCASE + + if (case_flags & FULLIGNORECASE) == FULLIGNORECASE: + literals = Sequence._fix_full_casefold(characters) + + for item in literals: + chars = item.characters + + if len(chars) == 1: + items.append(Character(chars[0], case_flags=item.case_flags)) + else: + items.append(String(chars, case_flags=item.case_flags)) + else: + if len(characters) == 1: + items.append(Character(characters[0], case_flags=case_flags)) + else: + items.append(String(characters, case_flags=case_flags)) + + characters[:] = [] + + @staticmethod + def _fix_full_casefold(characters): + # Split a literal needing full case-folding into chunks that need it + # and chunks that can use simple case-folding, which is faster. + expanded = [_regex.fold_case(FULL_CASE_FOLDING, c) for c in + _regex.get_expand_on_folding()] + string = _regex.fold_case(FULL_CASE_FOLDING, ''.join(chr(c) + for c in characters)).lower() + chunks = [] + + for e in expanded: + found = string.find(e) + + while found >= 0: + chunks.append((found, found + len(e))) + found = string.find(e, found + 1) + + pos = 0 + literals = [] + + for start, end in Sequence._merge_chunks(chunks): + if pos < start: + literals.append(Literal(characters[pos : start], + case_flags=IGNORECASE)) + + literals.append(Literal(characters[start : end], + case_flags=FULLIGNORECASE)) + pos = end + + if pos < len(characters): + literals.append(Literal(characters[pos : ], case_flags=IGNORECASE)) + + return literals + + @staticmethod + def _merge_chunks(chunks): + if len(chunks) < 2: + return chunks + + chunks.sort() + + start, end = chunks[0] + new_chunks = [] + + for s, e in chunks[1 : ]: + if s <= end: + end = max(end, e) + else: + new_chunks.append((start, end)) + start, end = s, e + + new_chunks.append((start, end)) + + return new_chunks + + def is_empty(self): + return all(i.is_empty() for i in self.items) + + def __eq__(self, other): + return type(self) is type(other) and self.items == other.items + + def max_width(self): + return sum(s.max_width() for s in self.items) + + def get_required_string(self, reverse): + seq = self.items + if reverse: + seq = seq[::-1] + + offset = 0 + + for s in seq: + ofs, req = s.get_required_string(reverse) + offset += ofs + if req: + return offset, req + + return offset, None + +class SetBase(RegexBase): + def __init__(self, info, items, positive=True, case_flags=NOCASE, + zerowidth=False): + RegexBase.__init__(self) + self.info = info + self.items = tuple(items) + self.positive = bool(positive) + self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags] + self.zerowidth = bool(zerowidth) + + self.char_width = 1 + + self._key = (self.__class__, self.items, self.positive, + self.case_flags, self.zerowidth) + + def rebuild(self, positive, case_flags, zerowidth): + return type(self)(self.info, self.items, positive, case_flags, + zerowidth).optimise(self.info, False) + + def get_firstset(self, reverse): + return set([self]) + + def has_simple_start(self): + return True + + def _compile(self, reverse, fuzzy): + flags = 0 + if self.positive: + flags |= POSITIVE_OP + if self.zerowidth: + flags |= ZEROWIDTH_OP + if fuzzy: + flags |= FUZZY_OP + code = [(self._opcode[self.case_flags, reverse], flags)] + for m in self.items: + code.extend(m.compile()) + + code.append((OP.END, )) + + return code + + def dump(self, indent, reverse): + print("{}{} {}{}".format(INDENT * indent, self._op_name, + POS_TEXT[self.positive], CASE_TEXT[self.case_flags])) + for i in self.items: + i.dump(indent + 1, reverse) + + def _handle_case_folding(self, info, in_set): + # Is the set case-sensitive? + if not self.positive or not (self.case_flags & IGNORECASE) or in_set: + return self + + # Is full case-folding possible? + if (not (self.info.flags & UNICODE) or (self.case_flags & + FULLIGNORECASE) != FULLIGNORECASE): + return self + + # Get the characters which expand to multiple codepoints on folding. + expanding_chars = _regex.get_expand_on_folding() + + # Get the folded characters in the set. + items = [] + seen = set() + for ch in expanding_chars: + if self.matches(ord(ch)): + folded = _regex.fold_case(FULL_CASE_FOLDING, ch) + if folded not in seen: + items.append(String([ord(c) for c in folded], + case_flags=self.case_flags)) + seen.add(folded) + + if not items: + # We can fall back to simple case-folding. + return self + + return Branch([self] + items) + + def max_width(self): + # Is the set case-sensitive? + if not self.positive or not (self.case_flags & IGNORECASE): + return 1 + + # Is full case-folding possible? + if (not (self.info.flags & UNICODE) or (self.case_flags & + FULLIGNORECASE) != FULLIGNORECASE): + return 1 + + # Get the characters which expand to multiple codepoints on folding. + expanding_chars = _regex.get_expand_on_folding() + + # Get the folded characters in the set. + seen = set() + for ch in expanding_chars: + if self.matches(ord(ch)): + folded = _regex.fold_case(FULL_CASE_FOLDING, ch) + seen.add(folded) + + if not seen: + return 1 + + return max(len(folded) for folded in seen) + + def __del__(self): + self.info = None + +class SetDiff(SetBase): + _opcode = {(NOCASE, False): OP.SET_DIFF, (IGNORECASE, False): + OP.SET_DIFF_IGN, (FULLCASE, False): OP.SET_DIFF, (FULLIGNORECASE, False): + OP.SET_DIFF_IGN, (NOCASE, True): OP.SET_DIFF_REV, (IGNORECASE, True): + OP.SET_DIFF_IGN_REV, (FULLCASE, True): OP.SET_DIFF_REV, (FULLIGNORECASE, + True): OP.SET_DIFF_IGN_REV} + _op_name = "SET_DIFF" + + def optimise(self, info, reverse, in_set=False): + items = self.items + if len(items) > 2: + items = [items[0], SetUnion(info, items[1 : ])] + + if len(items) == 1: + return items[0].with_flags(case_flags=self.case_flags, + zerowidth=self.zerowidth).optimise(info, reverse, in_set) + + self.items = tuple(m.optimise(info, reverse, in_set=True) for m in + items) + + return self._handle_case_folding(info, in_set) + + def matches(self, ch): + m = self.items[0].matches(ch) and not self.items[1].matches(ch) + return m == self.positive + +class SetInter(SetBase): + _opcode = {(NOCASE, False): OP.SET_INTER, (IGNORECASE, False): + OP.SET_INTER_IGN, (FULLCASE, False): OP.SET_INTER, (FULLIGNORECASE, + False): OP.SET_INTER_IGN, (NOCASE, True): OP.SET_INTER_REV, (IGNORECASE, + True): OP.SET_INTER_IGN_REV, (FULLCASE, True): OP.SET_INTER_REV, + (FULLIGNORECASE, True): OP.SET_INTER_IGN_REV} + _op_name = "SET_INTER" + + def optimise(self, info, reverse, in_set=False): + items = [] + for m in self.items: + m = m.optimise(info, reverse, in_set=True) + if isinstance(m, SetInter) and m.positive: + # Intersection in intersection. + items.extend(m.items) + else: + items.append(m) + + if len(items) == 1: + return items[0].with_flags(case_flags=self.case_flags, + zerowidth=self.zerowidth).optimise(info, reverse, in_set) + + self.items = tuple(items) + + return self._handle_case_folding(info, in_set) + + def matches(self, ch): + m = all(i.matches(ch) for i in self.items) + return m == self.positive + +class SetSymDiff(SetBase): + _opcode = {(NOCASE, False): OP.SET_SYM_DIFF, (IGNORECASE, False): + OP.SET_SYM_DIFF_IGN, (FULLCASE, False): OP.SET_SYM_DIFF, (FULLIGNORECASE, + False): OP.SET_SYM_DIFF_IGN, (NOCASE, True): OP.SET_SYM_DIFF_REV, + (IGNORECASE, True): OP.SET_SYM_DIFF_IGN_REV, (FULLCASE, True): + OP.SET_SYM_DIFF_REV, (FULLIGNORECASE, True): OP.SET_SYM_DIFF_IGN_REV} + _op_name = "SET_SYM_DIFF" + + def optimise(self, info, reverse, in_set=False): + items = [] + for m in self.items: + m = m.optimise(info, reverse, in_set=True) + if isinstance(m, SetSymDiff) and m.positive: + # Symmetric difference in symmetric difference. + items.extend(m.items) + else: + items.append(m) + + if len(items) == 1: + return items[0].with_flags(case_flags=self.case_flags, + zerowidth=self.zerowidth).optimise(info, reverse, in_set) + + self.items = tuple(items) + + return self._handle_case_folding(info, in_set) + + def matches(self, ch): + m = False + for i in self.items: + m = m != i.matches(ch) + + return m == self.positive + +class SetUnion(SetBase): + _opcode = {(NOCASE, False): OP.SET_UNION, (IGNORECASE, False): + OP.SET_UNION_IGN, (FULLCASE, False): OP.SET_UNION, (FULLIGNORECASE, + False): OP.SET_UNION_IGN, (NOCASE, True): OP.SET_UNION_REV, (IGNORECASE, + True): OP.SET_UNION_IGN_REV, (FULLCASE, True): OP.SET_UNION_REV, + (FULLIGNORECASE, True): OP.SET_UNION_IGN_REV} + _op_name = "SET_UNION" + + def optimise(self, info, reverse, in_set=False): + items = [] + for m in self.items: + m = m.optimise(info, reverse, in_set=True) + if isinstance(m, SetUnion) and m.positive: + # Union in union. + items.extend(m.items) + else: + items.append(m) + + if len(items) == 1: + i = items[0] + return i.with_flags(positive=i.positive == self.positive, + case_flags=self.case_flags, + zerowidth=self.zerowidth).optimise(info, reverse, in_set) + + self.items = tuple(items) + + return self._handle_case_folding(info, in_set) + + def _compile(self, reverse, fuzzy): + flags = 0 + if self.positive: + flags |= POSITIVE_OP + if self.zerowidth: + flags |= ZEROWIDTH_OP + if fuzzy: + flags |= FUZZY_OP + + characters, others = defaultdict(list), [] + for m in self.items: + if isinstance(m, Character): + characters[m.positive].append(m.value) + else: + others.append(m) + + code = [(self._opcode[self.case_flags, reverse], flags)] + + for positive, values in characters.items(): + flags = 0 + if positive: + flags |= POSITIVE_OP + if len(values) == 1: + code.append((OP.CHARACTER, flags, values[0])) + else: + code.append((OP.STRING, flags, len(values)) + tuple(values)) + + for m in others: + code.extend(m.compile()) + + code.append((OP.END, )) + + return code + + def matches(self, ch): + m = any(i.matches(ch) for i in self.items) + return m == self.positive + +class Skip(ZeroWidthBase): + _op_name = "SKIP" + _opcode = OP.SKIP + +class StartOfLine(ZeroWidthBase): + _opcode = OP.START_OF_LINE + _op_name = "START_OF_LINE" + +class StartOfLineU(StartOfLine): + _opcode = OP.START_OF_LINE_U + _op_name = "START_OF_LINE_U" + +class StartOfString(ZeroWidthBase): + _opcode = OP.START_OF_STRING + _op_name = "START_OF_STRING" + +class StartOfWord(ZeroWidthBase): + _opcode = OP.START_OF_WORD + _op_name = "START_OF_WORD" + +class String(RegexBase): + _opcode = {(NOCASE, False): OP.STRING, (IGNORECASE, False): OP.STRING_IGN, + (FULLCASE, False): OP.STRING, (FULLIGNORECASE, False): OP.STRING_FLD, + (NOCASE, True): OP.STRING_REV, (IGNORECASE, True): OP.STRING_IGN_REV, + (FULLCASE, True): OP.STRING_REV, (FULLIGNORECASE, True): + OP.STRING_FLD_REV} + + def __init__(self, characters, case_flags=NOCASE): + self.characters = tuple(characters) + self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags] + + if (self.case_flags & FULLIGNORECASE) == FULLIGNORECASE: + folded_characters = [] + for char in self.characters: + folded = _regex.fold_case(FULL_CASE_FOLDING, chr(char)) + folded_characters.extend(ord(c) for c in folded) + else: + folded_characters = self.characters + + self.folded_characters = tuple(folded_characters) + self.required = False + + self._key = self.__class__, self.characters, self.case_flags + + def get_firstset(self, reverse): + if reverse: + pos = -1 + else: + pos = 0 + return set([Character(self.characters[pos], + case_flags=self.case_flags)]) + + def has_simple_start(self): + return True + + def _compile(self, reverse, fuzzy): + flags = 0 + if fuzzy: + flags |= FUZZY_OP + if self.required: + flags |= REQUIRED_OP + return [(self._opcode[self.case_flags, reverse], flags, + len(self.folded_characters)) + self.folded_characters] + + def dump(self, indent, reverse): + display = ascii("".join(chr(c) for c in self.characters)).lstrip("bu") + print("{}STRING {}{}".format(INDENT * indent, display, + CASE_TEXT[self.case_flags])) + + def max_width(self): + return len(self.folded_characters) + + def get_required_string(self, reverse): + return 0, self + +class Literal(String): + def dump(self, indent, reverse): + literal = ''.join(chr(c) for c in self.characters) + display = ascii(literal).lstrip("bu") + print("{}LITERAL MATCH {}{}".format(INDENT * indent, display, + CASE_TEXT[self.case_flags])) + +class StringSet(Branch): + def __init__(self, info, name, case_flags=NOCASE): + self.info = info + self.name = name + self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags] + + self._key = self.__class__, self.name, self.case_flags + + self.set_key = (name, self.case_flags) + if self.set_key not in info.named_lists_used: + info.named_lists_used[self.set_key] = len(info.named_lists_used) + + index = self.info.named_lists_used[self.set_key] + items = self.info.kwargs[self.name] + + case_flags = self.case_flags + + encoding = self.info.flags & _ALL_ENCODINGS + fold_flags = encoding | case_flags + + choices = [] + + for string in items: + if isinstance(string, str): + string = [ord(c) for c in string] + + choices.append([Character(c, case_flags=case_flags) for c in + string]) + + # Sort from longest to shortest. + choices.sort(key=len, reverse=True) + + self.branches = [Sequence(choice) for choice in choices] + + def dump(self, indent, reverse): + print("{}STRING_SET {}{}".format(INDENT * indent, self.name, + CASE_TEXT[self.case_flags])) + + def __del__(self): + self.info = None + +class Source: + "Scanner for the regular expression source string." + def __init__(self, string): + if isinstance(string, str): + self.string = string + self.char_type = chr + else: + self.string = string.decode("latin-1") + self.char_type = lambda c: bytes([c]) + + self.pos = 0 + self.ignore_space = False + self.sep = string[ : 0] + + def get(self, override_ignore=False): + string = self.string + pos = self.pos + + try: + if self.ignore_space and not override_ignore: + while True: + if string[pos].isspace(): + # Skip over the whitespace. + pos += 1 + elif string[pos] == "#": + # Skip over the comment to the end of the line. + pos = string.index("\n", pos) + else: + break + + ch = string[pos] + self.pos = pos + 1 + return ch + except IndexError: + # We've reached the end of the string. + self.pos = pos + return string[ : 0] + except ValueError: + # The comment extended to the end of the string. + self.pos = len(string) + return string[ : 0] + + def get_many(self, count=1): + string = self.string + pos = self.pos + + try: + if self.ignore_space: + substring = [] + + while len(substring) < count: + while True: + if string[pos].isspace(): + # Skip over the whitespace. + pos += 1 + elif string[pos] == "#": + # Skip over the comment to the end of the line. + pos = string.index("\n", pos) + else: + break + + substring.append(string[pos]) + pos += 1 + + substring = "".join(substring) + else: + substring = string[pos : pos + count] + pos += len(substring) + + self.pos = pos + return substring + except IndexError: + # We've reached the end of the string. + self.pos = len(string) + return "".join(substring) + except ValueError: + # The comment extended to the end of the string. + self.pos = len(string) + return "".join(substring) + + def get_while(self, test_set, include=True, keep_spaces=False): + string = self.string + pos = self.pos + + if self.ignore_space and not keep_spaces: + try: + substring = [] + + while True: + if string[pos].isspace(): + # Skip over the whitespace. + pos += 1 + elif string[pos] == "#": + # Skip over the comment to the end of the line. + pos = string.index("\n", pos) + elif (string[pos] in test_set) == include: + substring.append(string[pos]) + pos += 1 + else: + break + + self.pos = pos + except IndexError: + # We've reached the end of the string. + self.pos = len(string) + except ValueError: + # The comment extended to the end of the string. + self.pos = len(string) + + return "".join(substring) + else: + try: + while (string[pos] in test_set) == include: + pos += 1 + + substring = string[self.pos : pos] + + self.pos = pos + + return substring + except IndexError: + # We've reached the end of the string. + substring = string[self.pos : pos] + + self.pos = pos + + return substring + + def skip_while(self, test_set, include=True): + string = self.string + pos = self.pos + + try: + if self.ignore_space: + while True: + if string[pos].isspace(): + # Skip over the whitespace. + pos += 1 + elif string[pos] == "#": + # Skip over the comment to the end of the line. + pos = string.index("\n", pos) + elif (string[pos] in test_set) == include: + pos += 1 + else: + break + else: + while (string[pos] in test_set) == include: + pos += 1 + + self.pos = pos + except IndexError: + # We've reached the end of the string. + self.pos = len(string) + except ValueError: + # The comment extended to the end of the string. + self.pos = len(string) + + def match(self, substring): + string = self.string + pos = self.pos + + if self.ignore_space: + try: + for c in substring: + while True: + if string[pos].isspace(): + # Skip over the whitespace. + pos += 1 + elif string[pos] == "#": + # Skip over the comment to the end of the line. + pos = string.index("\n", pos) + else: + break + + if string[pos] != c: + return False + + pos += 1 + + self.pos = pos + + return True + except IndexError: + # We've reached the end of the string. + return False + except ValueError: + # The comment extended to the end of the string. + return False + else: + if not string.startswith(substring, pos): + return False + + self.pos = pos + len(substring) + + return True + + def expect(self, substring): + if not self.match(substring): + raise error("missing {}".format(substring), self.string, self.pos) + + def at_end(self): + string = self.string + pos = self.pos + + try: + if self.ignore_space: + while True: + if string[pos].isspace(): + pos += 1 + elif string[pos] == "#": + pos = string.index("\n", pos) + else: + break + + return pos >= len(string) + except IndexError: + # We've reached the end of the string. + return True + except ValueError: + # The comment extended to the end of the string. + return True + +class Info: + "Info about the regular expression." + + def __init__(self, flags=0, char_type=None, kwargs={}): + flags |= DEFAULT_FLAGS[(flags & _ALL_VERSIONS) or DEFAULT_VERSION] + self.flags = flags + self.global_flags = flags + self.inline_locale = False + + self.kwargs = kwargs + + self.group_count = 0 + self.group_index = {} + self.group_name = {} + self.char_type = char_type + self.named_lists_used = {} + self.open_groups = [] + self.open_group_count = {} + self.defined_groups = {} + self.group_calls = [] + self.private_groups = {} + + def open_group(self, name=None): + group = self.group_index.get(name) + if group is None: + while True: + self.group_count += 1 + if name is None or self.group_count not in self.group_name: + break + + group = self.group_count + if name: + self.group_index[name] = group + self.group_name[group] = name + + if group in self.open_groups: + # We have a nested named group. We'll assign it a private group + # number, initially negative until we can assign a proper + # (positive) number. + group_alias = -(len(self.private_groups) + 1) + self.private_groups[group_alias] = group + group = group_alias + + self.open_groups.append(group) + self.open_group_count[group] = self.open_group_count.get(group, 0) + 1 + + return group + + def close_group(self): + self.open_groups.pop() + + def is_open_group(self, name): + # In version 1, a group reference can refer to an open group. We'll + # just pretend the group isn't open. + version = (self.flags & _ALL_VERSIONS) or DEFAULT_VERSION + if version == VERSION1: + return False + + if name.isdigit(): + group = int(name) + else: + group = self.group_index.get(name) + + return group in self.open_groups + +def _check_group_features(info, parsed): + """Checks whether the reverse and fuzzy features of the group calls match + the groups which they call. + """ + call_refs = {} + additional_groups = [] + for call, reverse, fuzzy in info.group_calls: + # Look up the reference of this group call. + key = (call.group, reverse, fuzzy) + ref = call_refs.get(key) + if ref is None: + # This group doesn't have a reference yet, so look up its features. + if call.group == 0: + # Calling the pattern as a whole. + rev = bool(info.flags & REVERSE) + fuz = isinstance(parsed, Fuzzy) + if (rev, fuz) != (reverse, fuzzy): + # The pattern as a whole doesn't have the features we want, + # so we'll need to make a copy of it with the desired + # features. + additional_groups.append((CallRef(len(call_refs), parsed), + reverse, fuzzy)) + else: + # Calling a capture group. + def_info = info.defined_groups[call.group] + group = def_info[0] + if def_info[1 : ] != (reverse, fuzzy): + # The group doesn't have the features we want, so we'll + # need to make a copy of it with the desired features. + additional_groups.append((group, reverse, fuzzy)) + + ref = len(call_refs) + call_refs[key] = ref + + call.call_ref = ref + + info.call_refs = call_refs + info.additional_groups = additional_groups + +def _get_required_string(parsed, flags): + "Gets the required string and related info of a parsed pattern." + + req_offset, required = parsed.get_required_string(bool(flags & REVERSE)) + if required: + required.required = True + if req_offset >= UNLIMITED: + req_offset = -1 + + req_flags = required.case_flags + if not (flags & UNICODE): + req_flags &= ~UNICODE + + req_chars = required.folded_characters + else: + req_offset = 0 + req_chars = () + req_flags = 0 + + return req_offset, req_chars, req_flags + +class Scanner: + def __init__(self, lexicon, flags=0): + self.lexicon = lexicon + + # Combine phrases into a compound pattern. + patterns = [] + for phrase, action in lexicon: + # Parse the regular expression. + source = Source(phrase) + info = Info(flags, source.char_type) + source.ignore_space = bool(info.flags & VERBOSE) + parsed = _parse_pattern(source, info) + if not source.at_end(): + raise error("unbalanced parenthesis", source.string, + source.pos) + + # We want to forbid capture groups within each phrase. + patterns.append(parsed.remove_captures()) + + # Combine all the subpatterns into one pattern. + info = Info(flags) + patterns = [Group(info, g + 1, p) for g, p in enumerate(patterns)] + parsed = Branch(patterns) + + # Optimise the compound pattern. + reverse = bool(info.flags & REVERSE) + parsed = parsed.optimise(info, reverse) + parsed = parsed.pack_characters(info) + + # Get the required string. + req_offset, req_chars, req_flags = _get_required_string(parsed, + info.flags) + + # Check the features of the groups. + _check_group_features(info, parsed) + + # Complain if there are any group calls. They are not supported by the + # Scanner class. + if info.call_refs: + raise error("recursive regex not supported by Scanner", + source.string, source.pos) + + reverse = bool(info.flags & REVERSE) + + # Compile the compound pattern. The result is a list of tuples. + code = parsed.compile(reverse) + [(OP.SUCCESS, )] + + # Flatten the code into a list of ints. + code = _flatten_code(code) + + if not parsed.has_simple_start(): + # Get the first set, if possible. + try: + fs_code = _compile_firstset(info, parsed.get_firstset(reverse)) + fs_code = _flatten_code(fs_code) + code = fs_code + code + except _FirstSetError: + pass + + # Check the global flags for conflicts. + version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION + if version not in (0, VERSION0, VERSION1): + raise ValueError("VERSION0 and VERSION1 flags are mutually incompatible") + + # Create the PatternObject. + # + # Local flags like IGNORECASE affect the code generation, but aren't + # needed by the PatternObject itself. Conversely, global flags like + # LOCALE _don't_ affect the code generation but _are_ needed by the + # PatternObject. + self.scanner = _regex.compile(None, (flags & GLOBAL_FLAGS) | version, + code, {}, {}, {}, [], req_offset, req_chars, req_flags, + len(patterns)) + + def scan(self, string): + result = [] + append = result.append + match = self.scanner.scanner(string).match + i = 0 + while True: + m = match() + if not m: + break + j = m.end() + if i == j: + break + action = self.lexicon[m.lastindex - 1][1] + if hasattr(action, '__call__'): + self.match = m + action = action(self, m.group()) + if action is not None: + append(action) + i = j + + return result, string[i : ] + +# Get the known properties dict. +PROPERTIES = _regex.get_properties() + +# Build the inverse of the properties dict. +PROPERTY_NAMES = {} +for prop_name, (prop_id, values) in PROPERTIES.items(): + name, prop_values = PROPERTY_NAMES.get(prop_id, ("", {})) + name = max(name, prop_name, key=len) + PROPERTY_NAMES[prop_id] = name, prop_values + + for val_name, val_id in values.items(): + prop_values[val_id] = max(prop_values.get(val_id, ""), val_name, + key=len) + +# Character escape sequences. +CHARACTER_ESCAPES = { + "a": "\a", + "b": "\b", + "f": "\f", + "n": "\n", + "r": "\r", + "t": "\t", + "v": "\v", +} + +# Predefined character set escape sequences. +CHARSET_ESCAPES = { + "d": lookup_property(None, "Digit", True), + "D": lookup_property(None, "Digit", False), + "h": lookup_property(None, "Blank", True), + "s": lookup_property(None, "Space", True), + "S": lookup_property(None, "Space", False), + "w": lookup_property(None, "Word", True), + "W": lookup_property(None, "Word", False), +} + +# Positional escape sequences. +POSITION_ESCAPES = { + "A": StartOfString(), + "b": Boundary(), + "B": Boundary(False), + "K": Keep(), + "m": StartOfWord(), + "M": EndOfWord(), + "Z": EndOfString(), +} + +# Positional escape sequences when WORD flag set. +WORD_POSITION_ESCAPES = dict(POSITION_ESCAPES) +WORD_POSITION_ESCAPES.update({ + "b": DefaultBoundary(), + "B": DefaultBoundary(False), + "m": DefaultStartOfWord(), + "M": DefaultEndOfWord(), +}) + +# Regex control verbs. +VERBS = { + "FAIL": Failure(), + "F": Failure(), + "PRUNE": Prune(), + "SKIP": Skip(), +} diff --git a/.venv/lib/python3.12/site-packages/regex/regex.py b/.venv/lib/python3.12/site-packages/regex/regex.py new file mode 100644 index 00000000..0fdb4da9 --- /dev/null +++ b/.venv/lib/python3.12/site-packages/regex/regex.py @@ -0,0 +1,746 @@ +# +# Secret Labs' Regular Expression Engine +# +# Copyright (c) 1998-2001 by Secret Labs AB. All rights reserved. +# +# This version of the SRE library can be redistributed under CNRI's +# Python 1.6 license. For any other use, please contact Secret Labs +# AB (info@pythonware.com). +# +# Portions of this engine have been developed in cooperation with +# CNRI. Hewlett-Packard provided funding for 1.6 integration and +# other compatibility work. +# +# 2010-01-16 mrab Python front-end re-written and extended + +r"""Support for regular expressions (RE). + +This module provides regular expression matching operations similar to those +found in Perl. It supports both 8-bit and Unicode strings; both the pattern and +the strings being processed can contain null bytes and characters outside the +US ASCII range. + +Regular expressions can contain both special and ordinary characters. Most +ordinary characters, like "A", "a", or "0", are the simplest regular +expressions; they simply match themselves. You can concatenate ordinary +characters, so last matches the string 'last'. + +There are a few differences between the old (legacy) behaviour and the new +(enhanced) behaviour, which are indicated by VERSION0 or VERSION1. + +The special characters are: + "." Matches any character except a newline. + "^" Matches the start of the string. + "$" Matches the end of the string or just before the + newline at the end of the string. + "*" Matches 0 or more (greedy) repetitions of the preceding + RE. Greedy means that it will match as many repetitions + as possible. + "+" Matches 1 or more (greedy) repetitions of the preceding + RE. + "?" Matches 0 or 1 (greedy) of the preceding RE. + *?,+?,?? Non-greedy versions of the previous three special + characters. + *+,++,?+ Possessive versions of the previous three special + characters. + {m,n} Matches from m to n repetitions of the preceding RE. + {m,n}? Non-greedy version of the above. + {m,n}+ Possessive version of the above. + {...} Fuzzy matching constraints. + "\\" Either escapes special characters or signals a special + sequence. + [...] Indicates a set of characters. A "^" as the first + character indicates a complementing set. + "|" A|B, creates an RE that will match either A or B. + (...) Matches the RE inside the parentheses. The contents are + captured and can be retrieved or matched later in the + string. + (?flags-flags) VERSION1: Sets/clears the flags for the remainder of + the group or pattern; VERSION0: Sets the flags for the + entire pattern. + (?:...) Non-capturing version of regular parentheses. + (?>...) Atomic non-capturing version of regular parentheses. + (?flags-flags:...) Non-capturing version of regular parentheses with local + flags. + (?P<name>...) The substring matched by the group is accessible by + name. + (?<name>...) The substring matched by the group is accessible by + name. + (?P=name) Matches the text matched earlier by the group named + name. + (?#...) A comment; ignored. + (?=...) Matches if ... matches next, but doesn't consume the + string. + (?!...) Matches if ... doesn't match next. + (?<=...) Matches if preceded by .... + (?<!...) Matches if not preceded by .... + (?(id)yes|no) Matches yes pattern if group id matched, the (optional) + no pattern otherwise. + (?(DEFINE)...) If there's no group called "DEFINE", then ... will be + ignored, but any group definitions will be available. + (?|...|...) (?|A|B), creates an RE that will match either A or B, + but reuses capture group numbers across the + alternatives. + (*FAIL) Forces matching to fail, which means immediate + backtracking. + (*F) Abbreviation for (*FAIL). + (*PRUNE) Discards the current backtracking information. Its + effect doesn't extend outside an atomic group or a + lookaround. + (*SKIP) Similar to (*PRUNE), except that it also sets where in + the text the next attempt at matching the entire + pattern will start. Its effect doesn't extend outside + an atomic group or a lookaround. + +The fuzzy matching constraints are: "i" to permit insertions, "d" to permit +deletions, "s" to permit substitutions, "e" to permit any of these. Limits are +optional with "<=" and "<". If any type of error is provided then any type not +provided is not permitted. + +A cost equation may be provided. + +Examples: + (?:fuzzy){i<=2} + (?:fuzzy){i<=1,s<=2,d<=1,1i+1s+1d<3} + +VERSION1: Set operators are supported, and a set can include nested sets. The +set operators, in order of increasing precedence, are: + || Set union ("x||y" means "x or y"). + ~~ (double tilde) Symmetric set difference ("x~~y" means "x or y, but not + both"). + && Set intersection ("x&&y" means "x and y"). + -- (double dash) Set difference ("x--y" means "x but not y"). + +Implicit union, ie, simple juxtaposition like in [ab], has the highest +precedence. + +VERSION0 and VERSION1: +The special sequences consist of "\\" and a character from the list below. If +the ordinary character is not on the list, then the resulting RE will match the +second character. + \number Matches the contents of the group of the same number if + number is no more than 2 digits, otherwise the character + with the 3-digit octal code. + \a Matches the bell character. + \A Matches only at the start of the string. + \b Matches the empty string, but only at the start or end of a + word. + \B Matches the empty string, but not at the start or end of a + word. + \d Matches any decimal digit; equivalent to the set [0-9] when + matching a bytestring or a Unicode string with the ASCII + flag, or the whole range of Unicode digits when matching a + Unicode string. + \D Matches any non-digit character; equivalent to [^\d]. + \f Matches the formfeed character. + \g<name> Matches the text matched by the group named name. + \G Matches the empty string, but only at the position where + the search started. + \h Matches horizontal whitespace. + \K Keeps only what follows for the entire match. + \L<name> Named list. The list is provided as a keyword argument. + \m Matches the empty string, but only at the start of a word. + \M Matches the empty string, but only at the end of a word. + \n Matches the newline character. + \N{name} Matches the named character. + \p{name=value} Matches the character if its property has the specified + value. + \P{name=value} Matches the character if its property hasn't the specified + value. + \r Matches the carriage-return character. + \s Matches any whitespace character; equivalent to + [ \t\n\r\f\v]. + \S Matches any non-whitespace character; equivalent to [^\s]. + \t Matches the tab character. + \uXXXX Matches the Unicode codepoint with 4-digit hex code XXXX. + \UXXXXXXXX Matches the Unicode codepoint with 8-digit hex code + XXXXXXXX. + \v Matches the vertical tab character. + \w Matches any alphanumeric character; equivalent to + [a-zA-Z0-9_] when matching a bytestring or a Unicode string + with the ASCII flag, or the whole range of Unicode + alphanumeric characters (letters plus digits plus + underscore) when matching a Unicode string. With LOCALE, it + will match the set [0-9_] plus characters defined as + letters for the current locale. + \W Matches the complement of \w; equivalent to [^\w]. + \xXX Matches the character with 2-digit hex code XX. + \X Matches a grapheme. + \Z Matches only at the end of the string. + \\ Matches a literal backslash. + +This module exports the following functions: + match Match a regular expression pattern at the beginning of a string. + fullmatch Match a regular expression pattern against all of a string. + search Search a string for the presence of a pattern. + sub Substitute occurrences of a pattern found in a string using a + template string. + subf Substitute occurrences of a pattern found in a string using a + format string. + subn Same as sub, but also return the number of substitutions made. + subfn Same as subf, but also return the number of substitutions made. + split Split a string by the occurrences of a pattern. VERSION1: will + split at zero-width match; VERSION0: won't split at zero-width + match. + splititer Return an iterator yielding the parts of a split string. + findall Find all occurrences of a pattern in a string. + finditer Return an iterator yielding a match object for each match. + compile Compile a pattern into a Pattern object. + purge Clear the regular expression cache. + escape Backslash all non-alphanumerics or special characters in a + string. + +Most of the functions support a concurrent parameter: if True, the GIL will be +released during matching, allowing other Python threads to run concurrently. If +the string changes during matching, the behaviour is undefined. This parameter +is not needed when working on the builtin (immutable) string classes. + +Some of the functions in this module take flags as optional parameters. Most of +these flags can also be set within an RE: + A a ASCII Make \w, \W, \b, \B, \d, and \D match the + corresponding ASCII character categories. Default + when matching a bytestring. + B b BESTMATCH Find the best fuzzy match (default is first). + D DEBUG Print the parsed pattern. + E e ENHANCEMATCH Attempt to improve the fit after finding the first + fuzzy match. + F f FULLCASE Use full case-folding when performing + case-insensitive matching in Unicode. + I i IGNORECASE Perform case-insensitive matching. + L L LOCALE Make \w, \W, \b, \B, \d, and \D dependent on the + current locale. (One byte per character only.) + M m MULTILINE "^" matches the beginning of lines (after a newline) + as well as the string. "$" matches the end of lines + (before a newline) as well as the end of the string. + P p POSIX Perform POSIX-standard matching (leftmost longest). + R r REVERSE Searches backwards. + S s DOTALL "." matches any character at all, including the + newline. + U u UNICODE Make \w, \W, \b, \B, \d, and \D dependent on the + Unicode locale. Default when matching a Unicode + string. + V0 V0 VERSION0 Turn on the old legacy behaviour. + V1 V1 VERSION1 Turn on the new enhanced behaviour. This flag + includes the FULLCASE flag. + W w WORD Make \b and \B work with default Unicode word breaks + and make ".", "^" and "$" work with Unicode line + breaks. + X x VERBOSE Ignore whitespace and comments for nicer looking REs. + +This module also defines an exception 'error'. + +""" + +# Public symbols. +__all__ = ["cache_all", "compile", "DEFAULT_VERSION", "escape", "findall", + "finditer", "fullmatch", "match", "purge", "search", "split", "splititer", + "sub", "subf", "subfn", "subn", "template", "Scanner", "A", "ASCII", "B", + "BESTMATCH", "D", "DEBUG", "E", "ENHANCEMATCH", "S", "DOTALL", "F", + "FULLCASE", "I", "IGNORECASE", "L", "LOCALE", "M", "MULTILINE", "P", "POSIX", + "R", "REVERSE", "T", "TEMPLATE", "U", "UNICODE", "V0", "VERSION0", "V1", + "VERSION1", "X", "VERBOSE", "W", "WORD", "error", "Regex", "__version__", + "__doc__", "RegexFlag"] + +__version__ = "2.5.148" + +# -------------------------------------------------------------------- +# Public interface. + +def match(pattern, string, flags=0, pos=None, endpos=None, partial=False, + concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Try to apply the pattern at the start of the string, returning a match + object, or None if no match was found.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.match(string, pos, endpos, concurrent, partial, timeout) + +def fullmatch(pattern, string, flags=0, pos=None, endpos=None, partial=False, + concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Try to apply the pattern against all of the string, returning a match + object, or None if no match was found.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.fullmatch(string, pos, endpos, concurrent, partial, timeout) + +def search(pattern, string, flags=0, pos=None, endpos=None, partial=False, + concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Search through string looking for a match to the pattern, returning a + match object, or None if no match was found.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.search(string, pos, endpos, concurrent, partial, timeout) + +def sub(pattern, repl, string, count=0, flags=0, pos=None, endpos=None, + concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Return the string obtained by replacing the leftmost (or rightmost with a + reverse pattern) non-overlapping occurrences of the pattern in string by the + replacement repl. repl can be either a string or a callable; if a string, + backslash escapes in it are processed; if a callable, it's passed the match + object and must return a replacement string to be used.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.sub(repl, string, count, pos, endpos, concurrent, timeout) + +def subf(pattern, format, string, count=0, flags=0, pos=None, endpos=None, + concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Return the string obtained by replacing the leftmost (or rightmost with a + reverse pattern) non-overlapping occurrences of the pattern in string by the + replacement format. format can be either a string or a callable; if a string, + it's treated as a format string; if a callable, it's passed the match object + and must return a replacement string to be used.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.subf(format, string, count, pos, endpos, concurrent, timeout) + +def subn(pattern, repl, string, count=0, flags=0, pos=None, endpos=None, + concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Return a 2-tuple containing (new_string, number). new_string is the string + obtained by replacing the leftmost (or rightmost with a reverse pattern) + non-overlapping occurrences of the pattern in the source string by the + replacement repl. number is the number of substitutions that were made. repl + can be either a string or a callable; if a string, backslash escapes in it + are processed; if a callable, it's passed the match object and must return a + replacement string to be used.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.subn(repl, string, count, pos, endpos, concurrent, timeout) + +def subfn(pattern, format, string, count=0, flags=0, pos=None, endpos=None, + concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Return a 2-tuple containing (new_string, number). new_string is the string + obtained by replacing the leftmost (or rightmost with a reverse pattern) + non-overlapping occurrences of the pattern in the source string by the + replacement format. number is the number of substitutions that were made. format + can be either a string or a callable; if a string, it's treated as a format + string; if a callable, it's passed the match object and must return a + replacement string to be used.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.subfn(format, string, count, pos, endpos, concurrent, timeout) + +def split(pattern, string, maxsplit=0, flags=0, concurrent=None, timeout=None, + ignore_unused=False, **kwargs): + """Split the source string by the occurrences of the pattern, returning a + list containing the resulting substrings. If capturing parentheses are used + in pattern, then the text of all groups in the pattern are also returned as + part of the resulting list. If maxsplit is nonzero, at most maxsplit splits + occur, and the remainder of the string is returned as the final element of + the list.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.split(string, maxsplit, concurrent, timeout) + +def splititer(pattern, string, maxsplit=0, flags=0, concurrent=None, + timeout=None, ignore_unused=False, **kwargs): + "Return an iterator yielding the parts of a split string." + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.splititer(string, maxsplit, concurrent, timeout) + +def findall(pattern, string, flags=0, pos=None, endpos=None, overlapped=False, + concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Return a list of all matches in the string. The matches may be overlapped + if overlapped is True. If one or more groups are present in the pattern, + return a list of groups; this will be a list of tuples if the pattern has + more than one group. Empty matches are included in the result.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.findall(string, pos, endpos, overlapped, concurrent, timeout) + +def finditer(pattern, string, flags=0, pos=None, endpos=None, overlapped=False, + partial=False, concurrent=None, timeout=None, ignore_unused=False, **kwargs): + """Return an iterator over all matches in the string. The matches may be + overlapped if overlapped is True. For each match, the iterator returns a + match object. Empty matches are included in the result.""" + pat = _compile(pattern, flags, ignore_unused, kwargs, True) + return pat.finditer(string, pos, endpos, overlapped, concurrent, partial, + timeout) + +def compile(pattern, flags=0, ignore_unused=False, cache_pattern=None, **kwargs): + "Compile a regular expression pattern, returning a pattern object." + if cache_pattern is None: + cache_pattern = _cache_all + return _compile(pattern, flags, ignore_unused, kwargs, cache_pattern) + +def purge(): + "Clear the regular expression cache" + _cache.clear() + _locale_sensitive.clear() + +# Whether to cache all patterns. +_cache_all = True + +def cache_all(value=True): + """Sets whether to cache all patterns, even those are compiled explicitly. + Passing None has no effect, but returns the current setting.""" + global _cache_all + + if value is None: + return _cache_all + + _cache_all = value + +def template(pattern, flags=0): + "Compile a template pattern, returning a pattern object." + return _compile(pattern, flags | TEMPLATE, False, {}, False) + +def escape(pattern, special_only=True, literal_spaces=False): + """Escape a string for use as a literal in a pattern. If special_only is + True, escape only special characters, else escape all non-alphanumeric + characters. If literal_spaces is True, don't escape spaces.""" + # Convert it to Unicode. + if isinstance(pattern, bytes): + p = pattern.decode("latin-1") + else: + p = pattern + + s = [] + if special_only: + for c in p: + if c == " " and literal_spaces: + s.append(c) + elif c in _METACHARS or c.isspace(): + s.append("\\") + s.append(c) + else: + s.append(c) + else: + for c in p: + if c == " " and literal_spaces: + s.append(c) + elif c in _ALNUM: + s.append(c) + else: + s.append("\\") + s.append(c) + + r = "".join(s) + # Convert it back to bytes if necessary. + if isinstance(pattern, bytes): + r = r.encode("latin-1") + + return r + +# -------------------------------------------------------------------- +# Internals. + +import regex._regex_core as _regex_core +import regex._regex as _regex +from threading import RLock as _RLock +from locale import getpreferredencoding as _getpreferredencoding +from regex._regex_core import * +from regex._regex_core import (_ALL_VERSIONS, _ALL_ENCODINGS, _FirstSetError, + _UnscopedFlagSet, _check_group_features, _compile_firstset, + _compile_replacement, _flatten_code, _fold_case, _get_required_string, + _parse_pattern, _shrink_cache) +from regex._regex_core import (ALNUM as _ALNUM, Info as _Info, OP as _OP, Source + as _Source, Fuzzy as _Fuzzy) + +# Version 0 is the old behaviour, compatible with the original 're' module. +# Version 1 is the new behaviour, which differs slightly. + +DEFAULT_VERSION = VERSION0 + +_METACHARS = frozenset("()[]{}?*+|^$\\.-#&~") + +_regex_core.DEFAULT_VERSION = DEFAULT_VERSION + +# Caches for the patterns and replacements. +_cache = {} +_cache_lock = _RLock() +_named_args = {} +_replacement_cache = {} +_locale_sensitive = {} + +# Maximum size of the cache. +_MAXCACHE = 500 +_MAXREPCACHE = 500 + +def _compile(pattern, flags, ignore_unused, kwargs, cache_it): + "Compiles a regular expression to a PatternObject." + + global DEFAULT_VERSION + try: + from regex import DEFAULT_VERSION + except ImportError: + pass + + # We won't bother to cache the pattern if we're debugging. + if (flags & DEBUG) != 0: + cache_it = False + + # What locale is this pattern using? + locale_key = (type(pattern), pattern) + if _locale_sensitive.get(locale_key, True) or (flags & LOCALE) != 0: + # This pattern is, or might be, locale-sensitive. + pattern_locale = _getpreferredencoding() + else: + # This pattern is definitely not locale-sensitive. + pattern_locale = None + + def complain_unused_args(): + if ignore_unused: + return + + # Complain about any unused keyword arguments, possibly resulting from a typo. + unused_kwargs = set(kwargs) - {k for k, v in args_needed} + if unused_kwargs: + any_one = next(iter(unused_kwargs)) + raise ValueError('unused keyword argument {!a}'.format(any_one)) + + if cache_it: + try: + # Do we know what keyword arguments are needed? + args_key = pattern, type(pattern), flags + args_needed = _named_args[args_key] + + # Are we being provided with its required keyword arguments? + args_supplied = set() + if args_needed: + for k, v in args_needed: + try: + args_supplied.add((k, frozenset(kwargs[k]))) + except KeyError: + raise error("missing named list: {!r}".format(k)) + + complain_unused_args() + + args_supplied = frozenset(args_supplied) + + # Have we already seen this regular expression and named list? + pattern_key = (pattern, type(pattern), flags, args_supplied, + DEFAULT_VERSION, pattern_locale) + return _cache[pattern_key] + except KeyError: + # It's a new pattern, or new named list for a known pattern. + pass + + # Guess the encoding from the class of the pattern string. + if isinstance(pattern, str): + guess_encoding = UNICODE + elif isinstance(pattern, bytes): + guess_encoding = ASCII + elif isinstance(pattern, Pattern): + if flags: + raise ValueError("cannot process flags argument with a compiled pattern") + + return pattern + else: + raise TypeError("first argument must be a string or compiled pattern") + + # Set the default version in the core code in case it has been changed. + _regex_core.DEFAULT_VERSION = DEFAULT_VERSION + + global_flags = flags + + while True: + caught_exception = None + try: + source = _Source(pattern) + info = _Info(global_flags, source.char_type, kwargs) + info.guess_encoding = guess_encoding + source.ignore_space = bool(info.flags & VERBOSE) + parsed = _parse_pattern(source, info) + break + except _UnscopedFlagSet: + # Remember the global flags for the next attempt. + global_flags = info.global_flags + except error as e: + caught_exception = e + + if caught_exception: + raise error(caught_exception.msg, caught_exception.pattern, + caught_exception.pos) + + if not source.at_end(): + raise error("unbalanced parenthesis", pattern, source.pos) + + # Check the global flags for conflicts. + version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION + if version not in (0, VERSION0, VERSION1): + raise ValueError("VERSION0 and VERSION1 flags are mutually incompatible") + + if (info.flags & _ALL_ENCODINGS) not in (0, ASCII, LOCALE, UNICODE): + raise ValueError("ASCII, LOCALE and UNICODE flags are mutually incompatible") + + if isinstance(pattern, bytes) and (info.flags & UNICODE): + raise ValueError("cannot use UNICODE flag with a bytes pattern") + + if not (info.flags & _ALL_ENCODINGS): + if isinstance(pattern, str): + info.flags |= UNICODE + else: + info.flags |= ASCII + + reverse = bool(info.flags & REVERSE) + fuzzy = isinstance(parsed, _Fuzzy) + + # Remember whether this pattern as an inline locale flag. + _locale_sensitive[locale_key] = info.inline_locale + + # Fix the group references. + caught_exception = None + try: + parsed.fix_groups(pattern, reverse, False) + except error as e: + caught_exception = e + + if caught_exception: + raise error(caught_exception.msg, caught_exception.pattern, + caught_exception.pos) + + # Should we print the parsed pattern? + if flags & DEBUG: + parsed.dump(indent=0, reverse=reverse) + + # Optimise the parsed pattern. + parsed = parsed.optimise(info, reverse) + parsed = parsed.pack_characters(info) + + # Get the required string. + req_offset, req_chars, req_flags = _get_required_string(parsed, info.flags) + + # Build the named lists. + named_lists = {} + named_list_indexes = [None] * len(info.named_lists_used) + args_needed = set() + for key, index in info.named_lists_used.items(): + name, case_flags = key + values = frozenset(kwargs[name]) + if case_flags: + items = frozenset(_fold_case(info, v) for v in values) + else: + items = values + named_lists[name] = values + named_list_indexes[index] = items + args_needed.add((name, values)) + + complain_unused_args() + + # Check the features of the groups. + _check_group_features(info, parsed) + + # Compile the parsed pattern. The result is a list of tuples. + code = parsed.compile(reverse) + + # Is there a group call to the pattern as a whole? + key = (0, reverse, fuzzy) + ref = info.call_refs.get(key) + if ref is not None: + code = [(_OP.CALL_REF, ref)] + code + [(_OP.END, )] + + # Add the final 'success' opcode. + code += [(_OP.SUCCESS, )] + + # Compile the additional copies of the groups that we need. + for group, rev, fuz in info.additional_groups: + code += group.compile(rev, fuz) + + # Flatten the code into a list of ints. + code = _flatten_code(code) + + if not parsed.has_simple_start(): + # Get the first set, if possible. + try: + fs_code = _compile_firstset(info, parsed.get_firstset(reverse)) + fs_code = _flatten_code(fs_code) + code = fs_code + code + except _FirstSetError: + pass + + # The named capture groups. + index_group = dict((v, n) for n, v in info.group_index.items()) + + # Create the PatternObject. + # + # Local flags like IGNORECASE affect the code generation, but aren't needed + # by the PatternObject itself. Conversely, global flags like LOCALE _don't_ + # affect the code generation but _are_ needed by the PatternObject. + compiled_pattern = _regex.compile(pattern, info.flags | version, code, + info.group_index, index_group, named_lists, named_list_indexes, + req_offset, req_chars, req_flags, info.group_count) + + # Do we need to reduce the size of the cache? + if len(_cache) >= _MAXCACHE: + with _cache_lock: + _shrink_cache(_cache, _named_args, _locale_sensitive, _MAXCACHE) + + if cache_it: + if (info.flags & LOCALE) == 0: + pattern_locale = None + + args_needed = frozenset(args_needed) + + # Store this regular expression and named list. + pattern_key = (pattern, type(pattern), flags, args_needed, + DEFAULT_VERSION, pattern_locale) + _cache[pattern_key] = compiled_pattern + + # Store what keyword arguments are needed. + _named_args[args_key] = args_needed + + return compiled_pattern + +def _compile_replacement_helper(pattern, template): + "Compiles a replacement template." + # This function is called by the _regex module. + + # Have we seen this before? + key = pattern.pattern, pattern.flags, template + compiled = _replacement_cache.get(key) + if compiled is not None: + return compiled + + if len(_replacement_cache) >= _MAXREPCACHE: + _replacement_cache.clear() + + is_unicode = isinstance(template, str) + source = _Source(template) + if is_unicode: + def make_string(char_codes): + return "".join(chr(c) for c in char_codes) + else: + def make_string(char_codes): + return bytes(char_codes) + + compiled = [] + literal = [] + while True: + ch = source.get() + if not ch: + break + if ch == "\\": + # '_compile_replacement' will return either an int group reference + # or a string literal. It returns items (plural) in order to handle + # a 2-character literal (an invalid escape sequence). + is_group, items = _compile_replacement(source, pattern, is_unicode) + if is_group: + # It's a group, so first flush the literal. + if literal: + compiled.append(make_string(literal)) + literal = [] + compiled.extend(items) + else: + literal.extend(items) + else: + literal.append(ord(ch)) + + # Flush the literal. + if literal: + compiled.append(make_string(literal)) + + _replacement_cache[key] = compiled + + return compiled + +# We define Pattern here after all the support objects have been defined. +_pat = _compile('', 0, False, {}, False) +Pattern = type(_pat) +Match = type(_pat.match('')) +del _pat + +# Make Pattern public for typing annotations. +__all__.append("Pattern") +__all__.append("Match") + +# We'll define an alias for the 'compile' function so that the repr of a +# pattern object is eval-able. +Regex = compile + +# Register myself for pickling. +import copyreg as _copy_reg + +def _pickle(pattern): + return _regex.compile, pattern._pickled_data + +_copy_reg.pickle(Pattern, _pickle) diff --git a/.venv/lib/python3.12/site-packages/regex/test_regex.py b/.venv/lib/python3.12/site-packages/regex/test_regex.py new file mode 100644 index 00000000..bce5a871 --- /dev/null +++ b/.venv/lib/python3.12/site-packages/regex/test_regex.py @@ -0,0 +1,4488 @@ +from weakref import proxy +import copy +import pickle +import regex +import string +import sys +import unittest + +# String subclasses for issue 18468. +class StrSubclass(str): + def __getitem__(self, index): + return StrSubclass(super().__getitem__(index)) + +class BytesSubclass(bytes): + def __getitem__(self, index): + return BytesSubclass(super().__getitem__(index)) + +class RegexTests(unittest.TestCase): + PATTERN_CLASS = "<class '_regex.Pattern'>" + FLAGS_WITH_COMPILED_PAT = "cannot process flags argument with a compiled pattern" + INVALID_GROUP_REF = "invalid group reference" + MISSING_GT = "missing >" + BAD_GROUP_NAME = "bad character in group name" + MISSING_GROUP_NAME = "missing group name" + MISSING_LT = "missing <" + UNKNOWN_GROUP_I = "unknown group" + UNKNOWN_GROUP = "unknown group" + BAD_ESCAPE = r"bad escape \(end of pattern\)" + BAD_OCTAL_ESCAPE = r"bad escape \\" + BAD_SET = "unterminated character set" + STR_PAT_ON_BYTES = "cannot use a string pattern on a bytes-like object" + BYTES_PAT_ON_STR = "cannot use a bytes pattern on a string-like object" + STR_PAT_BYTES_TEMPL = "expected str instance, bytes found" + BYTES_PAT_STR_TEMPL = "expected a bytes-like object, str found" + BYTES_PAT_UNI_FLAG = "cannot use UNICODE flag with a bytes pattern" + MIXED_FLAGS = "ASCII, LOCALE and UNICODE flags are mutually incompatible" + MISSING_RPAREN = "missing \\)" + TRAILING_CHARS = "unbalanced parenthesis" + BAD_CHAR_RANGE = "bad character range" + NOTHING_TO_REPEAT = "nothing to repeat" + MULTIPLE_REPEAT = "multiple repeat" + OPEN_GROUP = "cannot refer to an open group" + DUPLICATE_GROUP = "duplicate group" + CANT_TURN_OFF = "bad inline flags: cannot turn flags off" + UNDEF_CHAR_NAME = "undefined character name" + + def assertTypedEqual(self, actual, expect, msg=None): + self.assertEqual(actual, expect, msg) + + def recurse(actual, expect): + if isinstance(expect, (tuple, list)): + for x, y in zip(actual, expect): + recurse(x, y) + else: + self.assertIs(type(actual), type(expect), msg) + + recurse(actual, expect) + + def test_weakref(self): + s = 'QabbbcR' + x = regex.compile('ab+c') + y = proxy(x) + if x.findall('QabbbcR') != y.findall('QabbbcR'): + self.fail() + + def test_search_star_plus(self): + self.assertEqual(regex.search('a*', 'xxx').span(0), (0, 0)) + self.assertEqual(regex.search('x*', 'axx').span(), (0, 0)) + self.assertEqual(regex.search('x+', 'axx').span(0), (1, 3)) + self.assertEqual(regex.search('x+', 'axx').span(), (1, 3)) + self.assertEqual(regex.search('x', 'aaa'), None) + self.assertEqual(regex.match('a*', 'xxx').span(0), (0, 0)) + self.assertEqual(regex.match('a*', 'xxx').span(), (0, 0)) + self.assertEqual(regex.match('x*', 'xxxa').span(0), (0, 3)) + self.assertEqual(regex.match('x*', 'xxxa').span(), (0, 3)) + self.assertEqual(regex.match('a+', 'xxx'), None) + + def bump_num(self, matchobj): + int_value = int(matchobj[0]) + return str(int_value + 1) + + def test_basic_regex_sub(self): + self.assertEqual(regex.sub("(?i)b+", "x", "bbbb BBBB"), 'x x') + self.assertEqual(regex.sub(r'\d+', self.bump_num, '08.2 -2 23x99y'), + '9.3 -3 24x100y') + self.assertEqual(regex.sub(r'\d+', self.bump_num, '08.2 -2 23x99y', 3), + '9.3 -3 23x99y') + + self.assertEqual(regex.sub('.', lambda m: r"\n", 'x'), "\\n") + self.assertEqual(regex.sub('.', r"\n", 'x'), "\n") + + self.assertEqual(regex.sub('(?P<a>x)', r'\g<a>\g<a>', 'xx'), 'xxxx') + self.assertEqual(regex.sub('(?P<a>x)', r'\g<a>\g<1>', 'xx'), 'xxxx') + self.assertEqual(regex.sub('(?P<unk>x)', r'\g<unk>\g<unk>', 'xx'), + 'xxxx') + self.assertEqual(regex.sub('(?P<unk>x)', r'\g<1>\g<1>', 'xx'), 'xxxx') + + self.assertEqual(regex.sub('a', r'\t\n\v\r\f\a\b', 'a'), "\t\n\v\r\f\a\b") + self.assertEqual(regex.sub('a', '\t\n\v\r\f\a', 'a'), "\t\n\v\r\f\a") + self.assertEqual(regex.sub('a', '\t\n\v\r\f\a', 'a'), chr(9) + chr(10) + + chr(11) + chr(13) + chr(12) + chr(7)) + + self.assertEqual(regex.sub(r'^\s*', 'X', 'test'), 'Xtest') + + self.assertEqual(regex.sub(r"x", r"\x0A", "x"), "\n") + self.assertEqual(regex.sub(r"x", r"\u000A", "x"), "\n") + self.assertEqual(regex.sub(r"x", r"\U0000000A", "x"), "\n") + self.assertEqual(regex.sub(r"x", r"\N{LATIN CAPITAL LETTER A}", + "x"), "A") + + self.assertEqual(regex.sub(br"x", br"\x0A", b"x"), b"\n") + + def test_bug_449964(self): + # Fails for group followed by other escape. + self.assertEqual(regex.sub(r'(?P<unk>x)', r'\g<1>\g<1>\b', 'xx'), + "xx\bxx\b") + + def test_bug_449000(self): + # Test for sub() on escaped characters. + self.assertEqual(regex.sub(r'\r\n', r'\n', 'abc\r\ndef\r\n'), + "abc\ndef\n") + self.assertEqual(regex.sub('\r\n', r'\n', 'abc\r\ndef\r\n'), + "abc\ndef\n") + self.assertEqual(regex.sub(r'\r\n', '\n', 'abc\r\ndef\r\n'), + "abc\ndef\n") + self.assertEqual(regex.sub('\r\n', '\n', 'abc\r\ndef\r\n'), + "abc\ndef\n") + + def test_bug_1661(self): + # Verify that flags do not get silently ignored with compiled patterns + pattern = regex.compile('.') + self.assertRaisesRegex(ValueError, self.FLAGS_WITH_COMPILED_PAT, + lambda: regex.match(pattern, 'A', regex.I)) + self.assertRaisesRegex(ValueError, self.FLAGS_WITH_COMPILED_PAT, + lambda: regex.search(pattern, 'A', regex.I)) + self.assertRaisesRegex(ValueError, self.FLAGS_WITH_COMPILED_PAT, + lambda: regex.findall(pattern, 'A', regex.I)) + self.assertRaisesRegex(ValueError, self.FLAGS_WITH_COMPILED_PAT, + lambda: regex.compile(pattern, regex.I)) + + def test_bug_3629(self): + # A regex that triggered a bug in the sre-code validator + self.assertEqual(repr(type(regex.compile("(?P<quote>)(?(quote))"))), + self.PATTERN_CLASS) + + def test_sub_template_numeric_escape(self): + # Bug 776311 and friends. + self.assertEqual(regex.sub('x', r'\0', 'x'), "\0") + self.assertEqual(regex.sub('x', r'\000', 'x'), "\000") + self.assertEqual(regex.sub('x', r'\001', 'x'), "\001") + self.assertEqual(regex.sub('x', r'\008', 'x'), "\0" + "8") + self.assertEqual(regex.sub('x', r'\009', 'x'), "\0" + "9") + self.assertEqual(regex.sub('x', r'\111', 'x'), "\111") + self.assertEqual(regex.sub('x', r'\117', 'x'), "\117") + + self.assertEqual(regex.sub('x', r'\1111', 'x'), "\1111") + self.assertEqual(regex.sub('x', r'\1111', 'x'), "\111" + "1") + + self.assertEqual(regex.sub('x', r'\00', 'x'), '\x00') + self.assertEqual(regex.sub('x', r'\07', 'x'), '\x07') + self.assertEqual(regex.sub('x', r'\08', 'x'), "\0" + "8") + self.assertEqual(regex.sub('x', r'\09', 'x'), "\0" + "9") + self.assertEqual(regex.sub('x', r'\0a', 'x'), "\0" + "a") + + self.assertEqual(regex.sub('x', r'\400', 'x'), "\u0100") + self.assertEqual(regex.sub('x', r'\777', 'x'), "\u01FF") + self.assertEqual(regex.sub(b'x', br'\400', b'x'), b"\x00") + self.assertEqual(regex.sub(b'x', br'\777', b'x'), b"\xFF") + + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\1', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\8', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\9', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\11', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\18', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\1a', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\90', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\99', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\118', 'x')) # r'\11' + '8' + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\11a', 'x')) + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\181', 'x')) # r'\18' + '1' + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.sub('x', r'\800', 'x')) # r'\80' + '0' + + # In Python 2.3 (etc), these loop endlessly in sre_parser.py. + self.assertEqual(regex.sub('(((((((((((x)))))))))))', r'\11', 'x'), + 'x') + self.assertEqual(regex.sub('((((((((((y))))))))))(.)', r'\118', 'xyz'), + 'xz8') + self.assertEqual(regex.sub('((((((((((y))))))))))(.)', r'\11a', 'xyz'), + 'xza') + + def test_qualified_re_sub(self): + self.assertEqual(regex.sub('a', 'b', 'aaaaa'), 'bbbbb') + self.assertEqual(regex.sub('a', 'b', 'aaaaa', 1), 'baaaa') + + def test_bug_114660(self): + self.assertEqual(regex.sub(r'(\S)\s+(\S)', r'\1 \2', 'hello there'), + 'hello there') + + def test_bug_462270(self): + # Test for empty sub() behaviour, see SF bug #462270 + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.sub('(?V0)x*', '-', 'abxd'), '-a-b--d-') + else: + self.assertEqual(regex.sub('(?V0)x*', '-', 'abxd'), '-a-b-d-') + self.assertEqual(regex.sub('(?V1)x*', '-', 'abxd'), '-a-b--d-') + self.assertEqual(regex.sub('x+', '-', 'abxd'), 'ab-d') + + def test_bug_14462(self): + # chr(255) is a valid identifier in Python 3. + group_name = '\xFF' + self.assertEqual(regex.search(r'(?P<' + group_name + '>a)', + 'abc').group(group_name), 'a') + + def test_symbolic_refs(self): + self.assertRaisesRegex(regex.error, self.MISSING_GT, lambda: + regex.sub('(?P<a>x)', r'\g<a', 'xx')) + self.assertRaisesRegex(regex.error, self.MISSING_GROUP_NAME, lambda: + regex.sub('(?P<a>x)', r'\g<', 'xx')) + self.assertRaisesRegex(regex.error, self.MISSING_LT, lambda: + regex.sub('(?P<a>x)', r'\g', 'xx')) + self.assertRaisesRegex(regex.error, self.BAD_GROUP_NAME, lambda: + regex.sub('(?P<a>x)', r'\g<a a>', 'xx')) + self.assertRaisesRegex(regex.error, self.BAD_GROUP_NAME, lambda: + regex.sub('(?P<a>x)', r'\g<1a1>', 'xx')) + self.assertRaisesRegex(IndexError, self.UNKNOWN_GROUP_I, lambda: + regex.sub('(?P<a>x)', r'\g<ab>', 'xx')) + + # The new behaviour of unmatched but valid groups is to treat them like + # empty matches in the replacement template, like in Perl. + self.assertEqual(regex.sub('(?P<a>x)|(?P<b>y)', r'\g<b>', 'xx'), '') + self.assertEqual(regex.sub('(?P<a>x)|(?P<b>y)', r'\2', 'xx'), '') + + # The old behaviour was to raise it as an IndexError. + self.assertRaisesRegex(regex.error, self.BAD_GROUP_NAME, lambda: + regex.sub('(?P<a>x)', r'\g<-1>', 'xx')) + + def test_re_subn(self): + self.assertEqual(regex.subn("(?i)b+", "x", "bbbb BBBB"), ('x x', 2)) + self.assertEqual(regex.subn("b+", "x", "bbbb BBBB"), ('x BBBB', 1)) + self.assertEqual(regex.subn("b+", "x", "xyz"), ('xyz', 0)) + self.assertEqual(regex.subn("b*", "x", "xyz"), ('xxxyxzx', 4)) + self.assertEqual(regex.subn("b*", "x", "xyz", 2), ('xxxyz', 2)) + + def test_re_split(self): + self.assertEqual(regex.split(":", ":a:b::c"), ['', 'a', 'b', '', 'c']) + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.split(":*", ":a:b::c"), ['', '', 'a', '', + 'b', '', 'c', '']) + self.assertEqual(regex.split("(:*)", ":a:b::c"), ['', ':', '', '', + 'a', ':', '', '', 'b', '::', '', '', 'c', '', '']) + self.assertEqual(regex.split("(?::*)", ":a:b::c"), ['', '', 'a', + '', 'b', '', 'c', '']) + self.assertEqual(regex.split("(:)*", ":a:b::c"), ['', ':', '', + None, 'a', ':', '', None, 'b', ':', '', None, 'c', None, '']) + else: + self.assertEqual(regex.split(":*", ":a:b::c"), ['', 'a', 'b', 'c']) + self.assertEqual(regex.split("(:*)", ":a:b::c"), ['', ':', 'a', + ':', 'b', '::', 'c']) + self.assertEqual(regex.split("(?::*)", ":a:b::c"), ['', 'a', 'b', + 'c']) + self.assertEqual(regex.split("(:)*", ":a:b::c"), ['', ':', 'a', + ':', 'b', ':', 'c']) + self.assertEqual(regex.split("([b:]+)", ":a:b::c"), ['', ':', 'a', + ':b::', 'c']) + self.assertEqual(regex.split("(b)|(:+)", ":a:b::c"), ['', None, ':', + 'a', None, ':', '', 'b', None, '', None, '::', 'c']) + self.assertEqual(regex.split("(?:b)|(?::+)", ":a:b::c"), ['', 'a', '', + '', 'c']) + + self.assertEqual(regex.split("x", "xaxbxc"), ['', 'a', 'b', 'c']) + self.assertEqual([m for m in regex.splititer("x", "xaxbxc")], ['', 'a', + 'b', 'c']) + + self.assertEqual(regex.split("(?r)x", "xaxbxc"), ['c', 'b', 'a', '']) + self.assertEqual([m for m in regex.splititer("(?r)x", "xaxbxc")], ['c', + 'b', 'a', '']) + + self.assertEqual(regex.split("(x)|(y)", "xaxbxc"), ['', 'x', None, 'a', + 'x', None, 'b', 'x', None, 'c']) + self.assertEqual([m for m in regex.splititer("(x)|(y)", "xaxbxc")], + ['', 'x', None, 'a', 'x', None, 'b', 'x', None, 'c']) + + self.assertEqual(regex.split("(?r)(x)|(y)", "xaxbxc"), ['c', 'x', None, + 'b', 'x', None, 'a', 'x', None, '']) + self.assertEqual([m for m in regex.splititer("(?r)(x)|(y)", "xaxbxc")], + ['c', 'x', None, 'b', 'x', None, 'a', 'x', None, '']) + + self.assertEqual(regex.split(r"(?V1)\b", "a b c"), ['', 'a', ' ', 'b', + ' ', 'c', '']) + self.assertEqual(regex.split(r"(?V1)\m", "a b c"), ['', 'a ', 'b ', + 'c']) + self.assertEqual(regex.split(r"(?V1)\M", "a b c"), ['a', ' b', ' c', + '']) + + def test_qualified_re_split(self): + self.assertEqual(regex.split(":", ":a:b::c", 2), ['', 'a', 'b::c']) + self.assertEqual(regex.split(':', 'a:b:c:d', 2), ['a', 'b', 'c:d']) + self.assertEqual(regex.split("(:)", ":a:b::c", 2), ['', ':', 'a', ':', + 'b::c']) + + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.split("(:*)", ":a:b::c", 2), ['', ':', '', + '', 'a:b::c']) + else: + self.assertEqual(regex.split("(:*)", ":a:b::c", 2), ['', ':', 'a', + ':', 'b::c']) + + def test_re_findall(self): + self.assertEqual(regex.findall(":+", "abc"), []) + self.assertEqual(regex.findall(":+", "a:b::c:::d"), [':', '::', ':::']) + self.assertEqual(regex.findall("(:+)", "a:b::c:::d"), [':', '::', + ':::']) + self.assertEqual(regex.findall("(:)(:*)", "a:b::c:::d"), [(':', ''), + (':', ':'), (':', '::')]) + + self.assertEqual(regex.findall(r"\((?P<test>.{0,5}?TEST)\)", + "(MY TEST)"), ["MY TEST"]) + self.assertEqual(regex.findall(r"\((?P<test>.{0,3}?TEST)\)", + "(MY TEST)"), ["MY TEST"]) + self.assertEqual(regex.findall(r"\((?P<test>.{0,3}?T)\)", "(MY T)"), + ["MY T"]) + + self.assertEqual(regex.findall(r"[^a]{2}[A-Z]", "\n S"), [' S']) + self.assertEqual(regex.findall(r"[^a]{2,3}[A-Z]", "\n S"), ['\n S']) + self.assertEqual(regex.findall(r"[^a]{2,3}[A-Z]", "\n S"), [' S']) + + self.assertEqual(regex.findall(r"X(Y[^Y]+?){1,2}( |Q)+DEF", + "XYABCYPPQ\nQ DEF"), [('YPPQ\n', ' ')]) + + self.assertEqual(regex.findall(r"(\nTest(\n+.+?){0,2}?)?\n+End", + "\nTest\nxyz\nxyz\nEnd"), [('\nTest\nxyz\nxyz', '\nxyz')]) + + def test_bug_117612(self): + self.assertEqual(regex.findall(r"(a|(b))", "aba"), [('a', ''), ('b', + 'b'), ('a', '')]) + + def test_re_match(self): + self.assertEqual(regex.match('a', 'a')[:], ('a',)) + self.assertEqual(regex.match('(a)', 'a')[:], ('a', 'a')) + self.assertEqual(regex.match(r'(a)', 'a')[0], 'a') + self.assertEqual(regex.match(r'(a)', 'a')[1], 'a') + self.assertEqual(regex.match(r'(a)', 'a').group(1, 1), ('a', 'a')) + + pat = regex.compile('((a)|(b))(c)?') + self.assertEqual(pat.match('a')[:], ('a', 'a', 'a', None, None)) + self.assertEqual(pat.match('b')[:], ('b', 'b', None, 'b', None)) + self.assertEqual(pat.match('ac')[:], ('ac', 'a', 'a', None, 'c')) + self.assertEqual(pat.match('bc')[:], ('bc', 'b', None, 'b', 'c')) + self.assertEqual(pat.match('bc')[:], ('bc', 'b', None, 'b', 'c')) + + # A single group. + m = regex.match('(a)', 'a') + self.assertEqual(m.group(), 'a') + self.assertEqual(m.group(0), 'a') + self.assertEqual(m.group(1), 'a') + self.assertEqual(m.group(1, 1), ('a', 'a')) + + pat = regex.compile('(?:(?P<a1>a)|(?P<b2>b))(?P<c3>c)?') + self.assertEqual(pat.match('a').group(1, 2, 3), ('a', None, None)) + self.assertEqual(pat.match('b').group('a1', 'b2', 'c3'), (None, 'b', + None)) + self.assertEqual(pat.match('ac').group(1, 'b2', 3), ('a', None, 'c')) + + def test_re_groupref_exists(self): + self.assertEqual(regex.match(r'^(\()?([^()]+)(?(1)\))$', '(a)')[:], + ('(a)', '(', 'a')) + self.assertEqual(regex.match(r'^(\()?([^()]+)(?(1)\))$', 'a')[:], ('a', + None, 'a')) + self.assertEqual(regex.match(r'^(\()?([^()]+)(?(1)\))$', 'a)'), None) + self.assertEqual(regex.match(r'^(\()?([^()]+)(?(1)\))$', '(a'), None) + self.assertEqual(regex.match('^(?:(a)|c)((?(1)b|d))$', 'ab')[:], ('ab', + 'a', 'b')) + self.assertEqual(regex.match('^(?:(a)|c)((?(1)b|d))$', 'cd')[:], ('cd', + None, 'd')) + self.assertEqual(regex.match('^(?:(a)|c)((?(1)|d))$', 'cd')[:], ('cd', + None, 'd')) + self.assertEqual(regex.match('^(?:(a)|c)((?(1)|d))$', 'a')[:], ('a', + 'a', '')) + + # Tests for bug #1177831: exercise groups other than the first group. + p = regex.compile('(?P<g1>a)(?P<g2>b)?((?(g2)c|d))') + self.assertEqual(p.match('abc')[:], ('abc', 'a', 'b', 'c')) + self.assertEqual(p.match('ad')[:], ('ad', 'a', None, 'd')) + self.assertEqual(p.match('abd'), None) + self.assertEqual(p.match('ac'), None) + + def test_re_groupref(self): + self.assertEqual(regex.match(r'^(\|)?([^()]+)\1$', '|a|')[:], ('|a|', + '|', 'a')) + self.assertEqual(regex.match(r'^(\|)?([^()]+)\1?$', 'a')[:], ('a', + None, 'a')) + self.assertEqual(regex.match(r'^(\|)?([^()]+)\1$', 'a|'), None) + self.assertEqual(regex.match(r'^(\|)?([^()]+)\1$', '|a'), None) + self.assertEqual(regex.match(r'^(?:(a)|c)(\1)$', 'aa')[:], ('aa', 'a', + 'a')) + self.assertEqual(regex.match(r'^(?:(a)|c)(\1)?$', 'c')[:], ('c', None, + None)) + + self.assertEqual(regex.findall(r"(?i)(.{1,40}?),(.{1,40}?)(?:;)+(.{1,80}).{1,40}?\3(\ |;)+(.{1,80}?)\1", + "TEST, BEST; LEST ; Lest 123 Test, Best"), [('TEST', ' BEST', + ' LEST', ' ', '123 ')]) + + def test_groupdict(self): + self.assertEqual(regex.match('(?P<first>first) (?P<second>second)', + 'first second').groupdict(), {'first': 'first', 'second': 'second'}) + + def test_expand(self): + self.assertEqual(regex.match("(?P<first>first) (?P<second>second)", + "first second").expand(r"\2 \1 \g<second> \g<first>"), + 'second first second first') + + def test_repeat_minmax(self): + self.assertEqual(regex.match(r"^(\w){1}$", "abc"), None) + self.assertEqual(regex.match(r"^(\w){1}?$", "abc"), None) + self.assertEqual(regex.match(r"^(\w){1,2}$", "abc"), None) + self.assertEqual(regex.match(r"^(\w){1,2}?$", "abc"), None) + + self.assertEqual(regex.match(r"^(\w){3}$", "abc")[1], 'c') + self.assertEqual(regex.match(r"^(\w){1,3}$", "abc")[1], 'c') + self.assertEqual(regex.match(r"^(\w){1,4}$", "abc")[1], 'c') + self.assertEqual(regex.match(r"^(\w){3,4}?$", "abc")[1], 'c') + self.assertEqual(regex.match(r"^(\w){3}?$", "abc")[1], 'c') + self.assertEqual(regex.match(r"^(\w){1,3}?$", "abc")[1], 'c') + self.assertEqual(regex.match(r"^(\w){1,4}?$", "abc")[1], 'c') + self.assertEqual(regex.match(r"^(\w){3,4}?$", "abc")[1], 'c') + + self.assertEqual(regex.match("^x{1}$", "xxx"), None) + self.assertEqual(regex.match("^x{1}?$", "xxx"), None) + self.assertEqual(regex.match("^x{1,2}$", "xxx"), None) + self.assertEqual(regex.match("^x{1,2}?$", "xxx"), None) + + self.assertEqual(regex.match("^x{1}", "xxx")[0], 'x') + self.assertEqual(regex.match("^x{1}?", "xxx")[0], 'x') + self.assertEqual(regex.match("^x{0,1}", "xxx")[0], 'x') + self.assertEqual(regex.match("^x{0,1}?", "xxx")[0], '') + + self.assertEqual(bool(regex.match("^x{3}$", "xxx")), True) + self.assertEqual(bool(regex.match("^x{1,3}$", "xxx")), True) + self.assertEqual(bool(regex.match("^x{1,4}$", "xxx")), True) + self.assertEqual(bool(regex.match("^x{3,4}?$", "xxx")), True) + self.assertEqual(bool(regex.match("^x{3}?$", "xxx")), True) + self.assertEqual(bool(regex.match("^x{1,3}?$", "xxx")), True) + self.assertEqual(bool(regex.match("^x{1,4}?$", "xxx")), True) + self.assertEqual(bool(regex.match("^x{3,4}?$", "xxx")), True) + + self.assertEqual(regex.match("^x{}$", "xxx"), None) + self.assertEqual(bool(regex.match("^x{}$", "x{}")), True) + + def test_getattr(self): + self.assertEqual(regex.compile("(?i)(a)(b)").pattern, '(?i)(a)(b)') + self.assertEqual(regex.compile("(?i)(a)(b)").flags, regex.I | regex.U | + regex.DEFAULT_VERSION) + self.assertEqual(regex.compile(b"(?i)(a)(b)").flags, regex.A | regex.I + | regex.DEFAULT_VERSION) + self.assertEqual(regex.compile("(?i)(a)(b)").groups, 2) + self.assertEqual(regex.compile("(?i)(a)(b)").groupindex, {}) + + self.assertEqual(regex.compile("(?i)(?P<first>a)(?P<other>b)").groupindex, + {'first': 1, 'other': 2}) + + self.assertEqual(regex.match("(a)", "a").pos, 0) + self.assertEqual(regex.match("(a)", "a").endpos, 1) + + self.assertEqual(regex.search("b(c)", "abcdef").pos, 0) + self.assertEqual(regex.search("b(c)", "abcdef").endpos, 6) + self.assertEqual(regex.search("b(c)", "abcdef").span(), (1, 3)) + self.assertEqual(regex.search("b(c)", "abcdef").span(1), (2, 3)) + + self.assertEqual(regex.match("(a)", "a").string, 'a') + self.assertEqual(regex.match("(a)", "a").regs, ((0, 1), (0, 1))) + self.assertEqual(repr(type(regex.match("(a)", "a").re)), + self.PATTERN_CLASS) + + # Issue 14260. + p = regex.compile(r'abc(?P<n>def)') + p.groupindex["n"] = 0 + self.assertEqual(p.groupindex["n"], 1) + + def test_special_escapes(self): + self.assertEqual(regex.search(r"\b(b.)\b", "abcd abc bcd bx")[1], 'bx') + self.assertEqual(regex.search(r"\B(b.)\B", "abc bcd bc abxd")[1], 'bx') + self.assertEqual(regex.search(br"\b(b.)\b", b"abcd abc bcd bx", + regex.LOCALE)[1], b'bx') + self.assertEqual(regex.search(br"\B(b.)\B", b"abc bcd bc abxd", + regex.LOCALE)[1], b'bx') + self.assertEqual(regex.search(r"\b(b.)\b", "abcd abc bcd bx", + regex.UNICODE)[1], 'bx') + self.assertEqual(regex.search(r"\B(b.)\B", "abc bcd bc abxd", + regex.UNICODE)[1], 'bx') + + self.assertEqual(regex.search(r"^abc$", "\nabc\n", regex.M)[0], 'abc') + self.assertEqual(regex.search(r"^\Aabc\Z$", "abc", regex.M)[0], 'abc') + self.assertEqual(regex.search(r"^\Aabc\Z$", "\nabc\n", regex.M), None) + + self.assertEqual(regex.search(br"\b(b.)\b", b"abcd abc bcd bx")[1], + b'bx') + self.assertEqual(regex.search(br"\B(b.)\B", b"abc bcd bc abxd")[1], + b'bx') + self.assertEqual(regex.search(br"^abc$", b"\nabc\n", regex.M)[0], + b'abc') + self.assertEqual(regex.search(br"^\Aabc\Z$", b"abc", regex.M)[0], + b'abc') + self.assertEqual(regex.search(br"^\Aabc\Z$", b"\nabc\n", regex.M), + None) + + self.assertEqual(regex.search(r"\d\D\w\W\s\S", "1aa! a")[0], '1aa! a') + self.assertEqual(regex.search(br"\d\D\w\W\s\S", b"1aa! a", + regex.LOCALE)[0], b'1aa! a') + self.assertEqual(regex.search(r"\d\D\w\W\s\S", "1aa! a", + regex.UNICODE)[0], '1aa! a') + + def test_bigcharset(self): + self.assertEqual(regex.match(r"([\u2222\u2223])", "\u2222")[1], + '\u2222') + self.assertEqual(regex.match(r"([\u2222\u2223])", "\u2222", + regex.UNICODE)[1], '\u2222') + self.assertEqual("".join(regex.findall(".", + "e\xe8\xe9\xea\xeb\u0113\u011b\u0117", flags=regex.UNICODE)), + 'e\xe8\xe9\xea\xeb\u0113\u011b\u0117') + self.assertEqual("".join(regex.findall(r"[e\xe8\xe9\xea\xeb\u0113\u011b\u0117]", + "e\xe8\xe9\xea\xeb\u0113\u011b\u0117", flags=regex.UNICODE)), + 'e\xe8\xe9\xea\xeb\u0113\u011b\u0117') + self.assertEqual("".join(regex.findall(r"e|\xe8|\xe9|\xea|\xeb|\u0113|\u011b|\u0117", + "e\xe8\xe9\xea\xeb\u0113\u011b\u0117", flags=regex.UNICODE)), + 'e\xe8\xe9\xea\xeb\u0113\u011b\u0117') + + def test_anyall(self): + self.assertEqual(regex.match("a.b", "a\nb", regex.DOTALL)[0], "a\nb") + self.assertEqual(regex.match("a.*b", "a\n\nb", regex.DOTALL)[0], + "a\n\nb") + + def test_non_consuming(self): + self.assertEqual(regex.match(r"(a(?=\s[^a]))", "a b")[1], 'a') + self.assertEqual(regex.match(r"(a(?=\s[^a]*))", "a b")[1], 'a') + self.assertEqual(regex.match(r"(a(?=\s[abc]))", "a b")[1], 'a') + self.assertEqual(regex.match(r"(a(?=\s[abc]*))", "a bc")[1], 'a') + self.assertEqual(regex.match(r"(a)(?=\s\1)", "a a")[1], 'a') + self.assertEqual(regex.match(r"(a)(?=\s\1*)", "a aa")[1], 'a') + self.assertEqual(regex.match(r"(a)(?=\s(abc|a))", "a a")[1], 'a') + + self.assertEqual(regex.match(r"(a(?!\s[^a]))", "a a")[1], 'a') + self.assertEqual(regex.match(r"(a(?!\s[abc]))", "a d")[1], 'a') + self.assertEqual(regex.match(r"(a)(?!\s\1)", "a b")[1], 'a') + self.assertEqual(regex.match(r"(a)(?!\s(abc|a))", "a b")[1], 'a') + + def test_ignore_case(self): + self.assertEqual(regex.match("abc", "ABC", regex.I)[0], 'ABC') + self.assertEqual(regex.match(b"abc", b"ABC", regex.I)[0], b'ABC') + + self.assertEqual(regex.match(r"(a\s[^a]*)", "a bb", regex.I)[1], + 'a bb') + self.assertEqual(regex.match(r"(a\s[abc])", "a b", regex.I)[1], 'a b') + self.assertEqual(regex.match(r"(a\s[abc]*)", "a bb", regex.I)[1], + 'a bb') + self.assertEqual(regex.match(r"((a)\s\2)", "a a", regex.I)[1], 'a a') + self.assertEqual(regex.match(r"((a)\s\2*)", "a aa", regex.I)[1], + 'a aa') + self.assertEqual(regex.match(r"((a)\s(abc|a))", "a a", regex.I)[1], + 'a a') + self.assertEqual(regex.match(r"((a)\s(abc|a)*)", "a aa", regex.I)[1], + 'a aa') + + # Issue 3511. + self.assertEqual(regex.match(r"[Z-a]", "_").span(), (0, 1)) + self.assertEqual(regex.match(r"(?i)[Z-a]", "_").span(), (0, 1)) + + self.assertEqual(bool(regex.match(r"(?i)nao", "nAo")), True) + self.assertEqual(bool(regex.match(r"(?i)n\xE3o", "n\xC3o")), True) + self.assertEqual(bool(regex.match(r"(?i)n\xE3o", "N\xC3O")), True) + self.assertEqual(bool(regex.match(r"(?i)s", "\u017F")), True) + + def test_case_folding(self): + self.assertEqual(regex.search(r"(?fi)ss", "SS").span(), (0, 2)) + self.assertEqual(regex.search(r"(?fi)SS", "ss").span(), (0, 2)) + self.assertEqual(regex.search(r"(?fi)SS", + "\N{LATIN SMALL LETTER SHARP S}").span(), (0, 1)) + self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LETTER SHARP S}", + "SS").span(), (0, 2)) + + self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LIGATURE ST}", + "ST").span(), (0, 2)) + self.assertEqual(regex.search(r"(?fi)ST", + "\N{LATIN SMALL LIGATURE ST}").span(), (0, 1)) + self.assertEqual(regex.search(r"(?fi)ST", + "\N{LATIN SMALL LIGATURE LONG S T}").span(), (0, 1)) + + self.assertEqual(regex.search(r"(?fi)SST", + "\N{LATIN SMALL LETTER SHARP S}t").span(), (0, 2)) + self.assertEqual(regex.search(r"(?fi)SST", + "s\N{LATIN SMALL LIGATURE LONG S T}").span(), (0, 2)) + self.assertEqual(regex.search(r"(?fi)SST", + "s\N{LATIN SMALL LIGATURE ST}").span(), (0, 2)) + self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LIGATURE ST}", + "SST").span(), (1, 3)) + self.assertEqual(regex.search(r"(?fi)SST", + "s\N{LATIN SMALL LIGATURE ST}").span(), (0, 2)) + + self.assertEqual(regex.search(r"(?fi)FFI", + "\N{LATIN SMALL LIGATURE FFI}").span(), (0, 1)) + self.assertEqual(regex.search(r"(?fi)FFI", + "\N{LATIN SMALL LIGATURE FF}i").span(), (0, 2)) + self.assertEqual(regex.search(r"(?fi)FFI", + "f\N{LATIN SMALL LIGATURE FI}").span(), (0, 2)) + self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LIGATURE FFI}", + "FFI").span(), (0, 3)) + self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LIGATURE FF}i", + "FFI").span(), (0, 3)) + self.assertEqual(regex.search(r"(?fi)f\N{LATIN SMALL LIGATURE FI}", + "FFI").span(), (0, 3)) + + sigma = "\u03A3\u03C3\u03C2" + for ch1 in sigma: + for ch2 in sigma: + if not regex.match(r"(?fi)" + ch1, ch2): + self.fail() + + self.assertEqual(bool(regex.search(r"(?iV1)ff", "\uFB00\uFB01")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)ff", "\uFB01\uFB00")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)fi", "\uFB00\uFB01")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)fi", "\uFB01\uFB00")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)fffi", "\uFB00\uFB01")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)f\uFB03", + "\uFB00\uFB01")), True) + self.assertEqual(bool(regex.search(r"(?iV1)ff", "\uFB00\uFB01")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)fi", "\uFB00\uFB01")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)fffi", "\uFB00\uFB01")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)f\uFB03", + "\uFB00\uFB01")), True) + self.assertEqual(bool(regex.search(r"(?iV1)f\uFB01", "\uFB00i")), + True) + self.assertEqual(bool(regex.search(r"(?iV1)f\uFB01", "\uFB00i")), + True) + + self.assertEqual(regex.findall(r"(?iV0)\m(?:word){e<=3}\M(?<!\m(?:word){e<=1}\M)", + "word word2 word word3 word word234 word23 word"), ["word234", + "word23"]) + self.assertEqual(regex.findall(r"(?iV1)\m(?:word){e<=3}\M(?<!\m(?:word){e<=1}\M)", + "word word2 word word3 word word234 word23 word"), ["word234", + "word23"]) + + self.assertEqual(regex.search(r"(?fi)a\N{LATIN SMALL LIGATURE FFI}ne", + " affine ").span(), (2, 8)) + self.assertEqual(regex.search(r"(?fi)a(?:\N{LATIN SMALL LIGATURE FFI}|x)ne", + " affine ").span(), (2, 8)) + self.assertEqual(regex.search(r"(?fi)a(?:\N{LATIN SMALL LIGATURE FFI}|xy)ne", + " affine ").span(), (2, 8)) + self.assertEqual(regex.search(r"(?fi)a\L<options>ne", "affine", + options=["\N{LATIN SMALL LIGATURE FFI}"]).span(), (0, 6)) + self.assertEqual(regex.search(r"(?fi)a\L<options>ne", + "a\N{LATIN SMALL LIGATURE FFI}ne", options=["ffi"]).span(), (0, 4)) + + def test_category(self): + self.assertEqual(regex.match(r"(\s)", " ")[1], ' ') + + def test_not_literal(self): + self.assertEqual(regex.search(r"\s([^a])", " b")[1], 'b') + self.assertEqual(regex.search(r"\s([^a]*)", " bb")[1], 'bb') + + def test_search_coverage(self): + self.assertEqual(regex.search(r"\s(b)", " b")[1], 'b') + self.assertEqual(regex.search(r"a\s", "a ")[0], 'a ') + + def test_re_escape(self): + p = "" + self.assertEqual(regex.escape(p), p) + for i in range(0, 256): + p += chr(i) + self.assertEqual(bool(regex.match(regex.escape(chr(i)), chr(i))), + True) + self.assertEqual(regex.match(regex.escape(chr(i)), chr(i)).span(), + (0, 1)) + + pat = regex.compile(regex.escape(p)) + self.assertEqual(pat.match(p).span(), (0, 256)) + + def test_re_escape_byte(self): + p = b"" + self.assertEqual(regex.escape(p), p) + for i in range(0, 256): + b = bytes([i]) + p += b + self.assertEqual(bool(regex.match(regex.escape(b), b)), True) + self.assertEqual(regex.match(regex.escape(b), b).span(), (0, 1)) + + pat = regex.compile(regex.escape(p)) + self.assertEqual(pat.match(p).span(), (0, 256)) + + def test_constants(self): + if regex.I != regex.IGNORECASE: + self.fail() + if regex.L != regex.LOCALE: + self.fail() + if regex.M != regex.MULTILINE: + self.fail() + if regex.S != regex.DOTALL: + self.fail() + if regex.X != regex.VERBOSE: + self.fail() + + def test_flags(self): + for flag in [regex.I, regex.M, regex.X, regex.S, regex.L]: + self.assertEqual(repr(type(regex.compile('^pattern$', flag))), + self.PATTERN_CLASS) + + def test_sre_character_literals(self): + for i in [0, 8, 16, 32, 64, 127, 128, 255]: + self.assertEqual(bool(regex.match(r"\%03o" % i, chr(i))), True) + self.assertEqual(bool(regex.match(r"\%03o0" % i, chr(i) + "0")), + True) + self.assertEqual(bool(regex.match(r"\%03o8" % i, chr(i) + "8")), + True) + self.assertEqual(bool(regex.match(r"\x%02x" % i, chr(i))), True) + self.assertEqual(bool(regex.match(r"\x%02x0" % i, chr(i) + "0")), + True) + self.assertEqual(bool(regex.match(r"\x%02xz" % i, chr(i) + "z")), + True) + + self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda: + regex.match(r"\911", "")) + + def test_sre_character_class_literals(self): + for i in [0, 8, 16, 32, 64, 127, 128, 255]: + self.assertEqual(bool(regex.match(r"[\%03o]" % i, chr(i))), True) + self.assertEqual(bool(regex.match(r"[\%03o0]" % i, chr(i))), True) + self.assertEqual(bool(regex.match(r"[\%03o8]" % i, chr(i))), True) + self.assertEqual(bool(regex.match(r"[\x%02x]" % i, chr(i))), True) + self.assertEqual(bool(regex.match(r"[\x%02x0]" % i, chr(i))), True) + self.assertEqual(bool(regex.match(r"[\x%02xz]" % i, chr(i))), True) + + self.assertRaisesRegex(regex.error, self.BAD_OCTAL_ESCAPE, lambda: + regex.match(r"[\911]", "")) + + def test_bug_113254(self): + self.assertEqual(regex.match(r'(a)|(b)', 'b').start(1), -1) + self.assertEqual(regex.match(r'(a)|(b)', 'b').end(1), -1) + self.assertEqual(regex.match(r'(a)|(b)', 'b').span(1), (-1, -1)) + + def test_bug_527371(self): + # Bug described in patches 527371/672491. + self.assertEqual(regex.match(r'(a)?a','a').lastindex, None) + self.assertEqual(regex.match(r'(a)(b)?b','ab').lastindex, 1) + self.assertEqual(regex.match(r'(?P<a>a)(?P<b>b)?b','ab').lastgroup, + 'a') + self.assertEqual(regex.match("(?P<a>a(b))", "ab").lastgroup, 'a') + self.assertEqual(regex.match("((a))", "a").lastindex, 1) + + def test_bug_545855(self): + # Bug 545855 -- This pattern failed to cause a compile error as it + # should, instead provoking a TypeError. + self.assertRaisesRegex(regex.error, self.BAD_SET, lambda: + regex.compile('foo[a-')) + + def test_bug_418626(self): + # Bugs 418626 at al. -- Testing Greg Chapman's addition of op code + # SRE_OP_MIN_REPEAT_ONE for eliminating recursion on simple uses of + # pattern '*?' on a long string. + self.assertEqual(regex.match('.*?c', 10000 * 'ab' + 'cd').end(0), + 20001) + self.assertEqual(regex.match('.*?cd', 5000 * 'ab' + 'c' + 5000 * 'ab' + + 'cde').end(0), 20003) + self.assertEqual(regex.match('.*?cd', 20000 * 'abc' + 'de').end(0), + 60001) + # Non-simple '*?' still used to hit the recursion limit, before the + # non-recursive scheme was implemented. + self.assertEqual(regex.search('(a|b)*?c', 10000 * 'ab' + 'cd').end(0), + 20001) + + def test_bug_612074(self): + pat = "[" + regex.escape("\u2039") + "]" + self.assertEqual(regex.compile(pat) and 1, 1) + + def test_stack_overflow(self): + # Nasty cases that used to overflow the straightforward recursive + # implementation of repeated groups. + self.assertEqual(regex.match('(x)*', 50000 * 'x')[1], 'x') + self.assertEqual(regex.match('(x)*y', 50000 * 'x' + 'y')[1], 'x') + self.assertEqual(regex.match('(x)*?y', 50000 * 'x' + 'y')[1], 'x') + + def test_scanner(self): + def s_ident(scanner, token): return token + def s_operator(scanner, token): return "op%s" % token + def s_float(scanner, token): return float(token) + def s_int(scanner, token): return int(token) + + scanner = regex.Scanner([(r"[a-zA-Z_]\w*", s_ident), (r"\d+\.\d*", + s_float), (r"\d+", s_int), (r"=|\+|-|\*|/", s_operator), (r"\s+", + None), ]) + + self.assertEqual(repr(type(scanner.scanner.scanner("").pattern)), + self.PATTERN_CLASS) + + self.assertEqual(scanner.scan("sum = 3*foo + 312.50 + bar"), (['sum', + 'op=', 3, 'op*', 'foo', 'op+', 312.5, 'op+', 'bar'], '')) + + def test_bug_448951(self): + # Bug 448951 (similar to 429357, but with single char match). + # (Also test greedy matches.) + for op in '', '?', '*': + self.assertEqual(regex.match(r'((.%s):)?z' % op, 'z')[:], ('z', + None, None)) + self.assertEqual(regex.match(r'((.%s):)?z' % op, 'a:z')[:], ('a:z', + 'a:', 'a')) + + def test_bug_725106(self): + # Capturing groups in alternatives in repeats. + self.assertEqual(regex.match('^((a)|b)*', 'abc')[:], ('ab', 'b', 'a')) + self.assertEqual(regex.match('^(([ab])|c)*', 'abc')[:], ('abc', 'c', + 'b')) + self.assertEqual(regex.match('^((d)|[ab])*', 'abc')[:], ('ab', 'b', + None)) + self.assertEqual(regex.match('^((a)c|[ab])*', 'abc')[:], ('ab', 'b', + None)) + self.assertEqual(regex.match('^((a)|b)*?c', 'abc')[:], ('abc', 'b', + 'a')) + self.assertEqual(regex.match('^(([ab])|c)*?d', 'abcd')[:], ('abcd', + 'c', 'b')) + self.assertEqual(regex.match('^((d)|[ab])*?c', 'abc')[:], ('abc', 'b', + None)) + self.assertEqual(regex.match('^((a)c|[ab])*?c', 'abc')[:], ('abc', 'b', + None)) + + def test_bug_725149(self): + # Mark_stack_base restoring before restoring marks. + self.assertEqual(regex.match('(a)(?:(?=(b)*)c)*', 'abb')[:], ('a', 'a', + None)) + self.assertEqual(regex.match('(a)((?!(b)*))*', 'abb')[:], ('a', 'a', + None, None)) + + def test_bug_764548(self): + # Bug 764548, regex.compile() barfs on str/unicode subclasses. + class my_unicode(str): pass + pat = regex.compile(my_unicode("abc")) + self.assertEqual(pat.match("xyz"), None) + + def test_finditer(self): + it = regex.finditer(r":+", "a:b::c:::d") + self.assertEqual([item[0] for item in it], [':', '::', ':::']) + + def test_bug_926075(self): + if regex.compile('bug_926075') is regex.compile(b'bug_926075'): + self.fail() + + def test_bug_931848(self): + pattern = "[\u002E\u3002\uFF0E\uFF61]" + self.assertEqual(regex.compile(pattern).split("a.b.c"), ['a', 'b', + 'c']) + + def test_bug_581080(self): + it = regex.finditer(r"\s", "a b") + self.assertEqual(next(it).span(), (1, 2)) + self.assertRaises(StopIteration, lambda: next(it)) + + scanner = regex.compile(r"\s").scanner("a b") + self.assertEqual(scanner.search().span(), (1, 2)) + self.assertEqual(scanner.search(), None) + + def test_bug_817234(self): + it = regex.finditer(r".*", "asdf") + self.assertEqual(next(it).span(), (0, 4)) + self.assertEqual(next(it).span(), (4, 4)) + self.assertRaises(StopIteration, lambda: next(it)) + + def test_empty_array(self): + # SF buf 1647541. + import array + for typecode in 'bBuhHiIlLfd': + a = array.array(typecode) + self.assertEqual(regex.compile(b"bla").match(a), None) + self.assertEqual(regex.compile(b"").match(a)[1 : ], ()) + + def test_inline_flags(self): + # Bug #1700. + upper_char = chr(0x1ea0) # Latin Capital Letter A with Dot Below + lower_char = chr(0x1ea1) # Latin Small Letter A with Dot Below + + p = regex.compile(upper_char, regex.I | regex.U) + self.assertEqual(bool(p.match(lower_char)), True) + + p = regex.compile(lower_char, regex.I | regex.U) + self.assertEqual(bool(p.match(upper_char)), True) + + p = regex.compile('(?i)' + upper_char, regex.U) + self.assertEqual(bool(p.match(lower_char)), True) + + p = regex.compile('(?i)' + lower_char, regex.U) + self.assertEqual(bool(p.match(upper_char)), True) + + p = regex.compile('(?iu)' + upper_char) + self.assertEqual(bool(p.match(lower_char)), True) + + p = regex.compile('(?iu)' + lower_char) + self.assertEqual(bool(p.match(upper_char)), True) + + # Changed to positional flags in regex 2023.12.23. + self.assertEqual(bool(regex.match(r"(?i)a", "A")), True) + self.assertEqual(regex.match(r"a(?i)", "A"), None) + + def test_dollar_matches_twice(self): + # $ matches the end of string, and just before the terminating \n. + pattern = regex.compile('$') + self.assertEqual(pattern.sub('#', 'a\nb\n'), 'a\nb#\n#') + self.assertEqual(pattern.sub('#', 'a\nb\nc'), 'a\nb\nc#') + self.assertEqual(pattern.sub('#', '\n'), '#\n#') + + pattern = regex.compile('$', regex.MULTILINE) + self.assertEqual(pattern.sub('#', 'a\nb\n' ), 'a#\nb#\n#') + self.assertEqual(pattern.sub('#', 'a\nb\nc'), 'a#\nb#\nc#') + self.assertEqual(pattern.sub('#', '\n'), '#\n#') + + def test_bytes_str_mixing(self): + # Mixing str and bytes is disallowed. + pat = regex.compile('.') + bpat = regex.compile(b'.') + self.assertRaisesRegex(TypeError, self.STR_PAT_ON_BYTES, lambda: + pat.match(b'b')) + self.assertRaisesRegex(TypeError, self.BYTES_PAT_ON_STR, lambda: + bpat.match('b')) + self.assertRaisesRegex(TypeError, self.STR_PAT_BYTES_TEMPL, lambda: + pat.sub(b'b', 'c')) + self.assertRaisesRegex(TypeError, self.STR_PAT_ON_BYTES, lambda: + pat.sub('b', b'c')) + self.assertRaisesRegex(TypeError, self.STR_PAT_ON_BYTES, lambda: + pat.sub(b'b', b'c')) + self.assertRaisesRegex(TypeError, self.BYTES_PAT_ON_STR, lambda: + bpat.sub(b'b', 'c')) + self.assertRaisesRegex(TypeError, self.BYTES_PAT_STR_TEMPL, lambda: + bpat.sub('b', b'c')) + self.assertRaisesRegex(TypeError, self.BYTES_PAT_ON_STR, lambda: + bpat.sub('b', 'c')) + + self.assertRaisesRegex(ValueError, self.BYTES_PAT_UNI_FLAG, lambda: + regex.compile(br'\w', regex.UNICODE)) + self.assertRaisesRegex(ValueError, self.BYTES_PAT_UNI_FLAG, lambda: + regex.compile(br'(?u)\w')) + self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda: + regex.compile(r'\w', regex.UNICODE | regex.ASCII)) + self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda: + regex.compile(r'(?u)\w', regex.ASCII)) + self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda: + regex.compile(r'(?a)\w', regex.UNICODE)) + self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda: + regex.compile(r'(?au)\w')) + + def test_ascii_and_unicode_flag(self): + # String patterns. + for flags in (0, regex.UNICODE): + pat = regex.compile('\xc0', flags | regex.IGNORECASE) + self.assertEqual(bool(pat.match('\xe0')), True) + pat = regex.compile(r'\w', flags) + self.assertEqual(bool(pat.match('\xe0')), True) + + pat = regex.compile('\xc0', regex.ASCII | regex.IGNORECASE) + self.assertEqual(pat.match('\xe0'), None) + pat = regex.compile('(?a)\xc0', regex.IGNORECASE) + self.assertEqual(pat.match('\xe0'), None) + pat = regex.compile(r'\w', regex.ASCII) + self.assertEqual(pat.match('\xe0'), None) + pat = regex.compile(r'(?a)\w') + self.assertEqual(pat.match('\xe0'), None) + + # Bytes patterns. + for flags in (0, regex.ASCII): + pat = regex.compile(b'\xc0', flags | regex.IGNORECASE) + self.assertEqual(pat.match(b'\xe0'), None) + pat = regex.compile(br'\w') + self.assertEqual(pat.match(b'\xe0'), None) + + self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda: + regex.compile(r'(?au)\w')) + + def test_subscripting_match(self): + m = regex.match(r'(?<a>\w)', 'xy') + if not m: + self.fail("Failed: expected match but returned None") + elif not m or m[0] != m.group(0) or m[1] != m.group(1): + self.fail("Failed") + if not m: + self.fail("Failed: expected match but returned None") + elif m[:] != ('x', 'x'): + self.fail("Failed: expected \"('x', 'x')\" but got {} instead".format(ascii(m[:]))) + + def test_new_named_groups(self): + m0 = regex.match(r'(?P<a>\w)', 'x') + m1 = regex.match(r'(?<a>\w)', 'x') + if not (m0 and m1 and m0[:] == m1[:]): + self.fail("Failed") + + def test_properties(self): + self.assertEqual(regex.match(b'(?ai)\xC0', b'\xE0'), None) + self.assertEqual(regex.match(br'(?ai)\xC0', b'\xE0'), None) + self.assertEqual(regex.match(br'(?a)\w', b'\xE0'), None) + self.assertEqual(bool(regex.match(r'\w', '\xE0')), True) + + # Dropped the following test. It's not possible to determine what the + # correct result should be in the general case. +# self.assertEqual(bool(regex.match(br'(?L)\w', b'\xE0')), +# b'\xE0'.isalnum()) + + self.assertEqual(bool(regex.match(br'(?L)\d', b'0')), True) + self.assertEqual(bool(regex.match(br'(?L)\s', b' ')), True) + self.assertEqual(bool(regex.match(br'(?L)\w', b'a')), True) + self.assertEqual(regex.match(br'(?L)\d', b'?'), None) + self.assertEqual(regex.match(br'(?L)\s', b'?'), None) + self.assertEqual(regex.match(br'(?L)\w', b'?'), None) + + self.assertEqual(regex.match(br'(?L)\D', b'0'), None) + self.assertEqual(regex.match(br'(?L)\S', b' '), None) + self.assertEqual(regex.match(br'(?L)\W', b'a'), None) + self.assertEqual(bool(regex.match(br'(?L)\D', b'?')), True) + self.assertEqual(bool(regex.match(br'(?L)\S', b'?')), True) + self.assertEqual(bool(regex.match(br'(?L)\W', b'?')), True) + + self.assertEqual(bool(regex.match(r'\p{Cyrillic}', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'(?i)\p{Cyrillic}', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{IsCyrillic}', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{Script=Cyrillic}', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{InCyrillic}', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{Block=Cyrillic}', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:Cyrillic:]]', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:IsCyrillic:]]', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:Script=Cyrillic:]]', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:InCyrillic:]]', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:Block=Cyrillic:]]', + '\N{CYRILLIC CAPITAL LETTER A}')), True) + + self.assertEqual(bool(regex.match(r'\P{Cyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\P{IsCyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\P{Script=Cyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\P{InCyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\P{Block=Cyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{^Cyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{^IsCyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{^Script=Cyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{^InCyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'\p{^Block=Cyrillic}', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:^Cyrillic:]]', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:^IsCyrillic:]]', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:^Script=Cyrillic:]]', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:^InCyrillic:]]', + '\N{LATIN CAPITAL LETTER A}')), True) + self.assertEqual(bool(regex.match(r'[[:^Block=Cyrillic:]]', + '\N{LATIN CAPITAL LETTER A}')), True) + + self.assertEqual(bool(regex.match(r'\d', '0')), True) + self.assertEqual(bool(regex.match(r'\s', ' ')), True) + self.assertEqual(bool(regex.match(r'\w', 'A')), True) + self.assertEqual(regex.match(r"\d", "?"), None) + self.assertEqual(regex.match(r"\s", "?"), None) + self.assertEqual(regex.match(r"\w", "?"), None) + self.assertEqual(regex.match(r"\D", "0"), None) + self.assertEqual(regex.match(r"\S", " "), None) + self.assertEqual(regex.match(r"\W", "A"), None) + self.assertEqual(bool(regex.match(r'\D', '?')), True) + self.assertEqual(bool(regex.match(r'\S', '?')), True) + self.assertEqual(bool(regex.match(r'\W', '?')), True) + + self.assertEqual(bool(regex.match(r'\p{L}', 'A')), True) + self.assertEqual(bool(regex.match(r'\p{L}', 'a')), True) + self.assertEqual(bool(regex.match(r'\p{Lu}', 'A')), True) + self.assertEqual(bool(regex.match(r'\p{Ll}', 'a')), True) + + self.assertEqual(bool(regex.match(r'(?i)a', 'a')), True) + self.assertEqual(bool(regex.match(r'(?i)a', 'A')), True) + + self.assertEqual(bool(regex.match(r'\w', '0')), True) + self.assertEqual(bool(regex.match(r'\w', 'a')), True) + self.assertEqual(bool(regex.match(r'\w', '_')), True) + + self.assertEqual(regex.match(r"\X", "\xE0").span(), (0, 1)) + self.assertEqual(regex.match(r"\X", "a\u0300").span(), (0, 2)) + self.assertEqual(regex.findall(r"\X", + "a\xE0a\u0300e\xE9e\u0301"), ['a', '\xe0', 'a\u0300', 'e', + '\xe9', 'e\u0301']) + self.assertEqual(regex.findall(r"\X{3}", + "a\xE0a\u0300e\xE9e\u0301"), ['a\xe0a\u0300', 'e\xe9e\u0301']) + self.assertEqual(regex.findall(r"\X", "\r\r\n\u0301A\u0301"), + ['\r', '\r\n', '\u0301', 'A\u0301']) + + self.assertEqual(bool(regex.match(r'\p{Ll}', 'a')), True) + + chars_u = "-09AZaz_\u0393\u03b3" + chars_b = b"-09AZaz_" + word_set = set("Ll Lm Lo Lt Lu Mc Me Mn Nd Nl No Pc".split()) + + tests = [ + (r"\w", chars_u, "09AZaz_\u0393\u03b3"), + (r"[[:word:]]", chars_u, "09AZaz_\u0393\u03b3"), + (r"\W", chars_u, "-"), + (r"[[:^word:]]", chars_u, "-"), + (r"\d", chars_u, "09"), + (r"[[:digit:]]", chars_u, "09"), + (r"\D", chars_u, "-AZaz_\u0393\u03b3"), + (r"[[:^digit:]]", chars_u, "-AZaz_\u0393\u03b3"), + (r"[[:alpha:]]", chars_u, "AZaz\u0393\u03b3"), + (r"[[:^alpha:]]", chars_u, "-09_"), + (r"[[:alnum:]]", chars_u, "09AZaz\u0393\u03b3"), + (r"[[:^alnum:]]", chars_u, "-_"), + (r"[[:xdigit:]]", chars_u, "09Aa"), + (r"[[:^xdigit:]]", chars_u, "-Zz_\u0393\u03b3"), + (r"\p{InBasicLatin}", "a\xE1", "a"), + (r"\P{InBasicLatin}", "a\xE1", "\xE1"), + (r"(?i)\p{InBasicLatin}", "a\xE1", "a"), + (r"(?i)\P{InBasicLatin}", "a\xE1", "\xE1"), + + (br"(?L)\w", chars_b, b"09AZaz_"), + (br"(?L)[[:word:]]", chars_b, b"09AZaz_"), + (br"(?L)\W", chars_b, b"-"), + (br"(?L)[[:^word:]]", chars_b, b"-"), + (br"(?L)\d", chars_b, b"09"), + (br"(?L)[[:digit:]]", chars_b, b"09"), + (br"(?L)\D", chars_b, b"-AZaz_"), + (br"(?L)[[:^digit:]]", chars_b, b"-AZaz_"), + (br"(?L)[[:alpha:]]", chars_b, b"AZaz"), + (br"(?L)[[:^alpha:]]", chars_b, b"-09_"), + (br"(?L)[[:alnum:]]", chars_b, b"09AZaz"), + (br"(?L)[[:^alnum:]]", chars_b, b"-_"), + (br"(?L)[[:xdigit:]]", chars_b, b"09Aa"), + (br"(?L)[[:^xdigit:]]", chars_b, b"-Zz_"), + + (br"(?a)\w", chars_b, b"09AZaz_"), + (br"(?a)[[:word:]]", chars_b, b"09AZaz_"), + (br"(?a)\W", chars_b, b"-"), + (br"(?a)[[:^word:]]", chars_b, b"-"), + (br"(?a)\d", chars_b, b"09"), + (br"(?a)[[:digit:]]", chars_b, b"09"), + (br"(?a)\D", chars_b, b"-AZaz_"), + (br"(?a)[[:^digit:]]", chars_b, b"-AZaz_"), + (br"(?a)[[:alpha:]]", chars_b, b"AZaz"), + (br"(?a)[[:^alpha:]]", chars_b, b"-09_"), + (br"(?a)[[:alnum:]]", chars_b, b"09AZaz"), + (br"(?a)[[:^alnum:]]", chars_b, b"-_"), + (br"(?a)[[:xdigit:]]", chars_b, b"09Aa"), + (br"(?a)[[:^xdigit:]]", chars_b, b"-Zz_"), + ] + for pattern, chars, expected in tests: + try: + if chars[ : 0].join(regex.findall(pattern, chars)) != expected: + self.fail("Failed: {}".format(pattern)) + except Exception as e: + self.fail("Failed: {} raised {}".format(pattern, ascii(e))) + + self.assertEqual(bool(regex.match(r"\p{NumericValue=0}", "0")), + True) + self.assertEqual(bool(regex.match(r"\p{NumericValue=1/2}", + "\N{VULGAR FRACTION ONE HALF}")), True) + self.assertEqual(bool(regex.match(r"\p{NumericValue=0.5}", + "\N{VULGAR FRACTION ONE HALF}")), True) + + def test_word_class(self): + self.assertEqual(regex.findall(r"\w+", + " \u0939\u093f\u0928\u094d\u0926\u0940,"), + ['\u0939\u093f\u0928\u094d\u0926\u0940']) + self.assertEqual(regex.findall(r"\W+", + " \u0939\u093f\u0928\u094d\u0926\u0940,"), [' ', ',']) + self.assertEqual(regex.split(r"(?V1)\b", + " \u0939\u093f\u0928\u094d\u0926\u0940,"), [' ', + '\u0939\u093f\u0928\u094d\u0926\u0940', ',']) + self.assertEqual(regex.split(r"(?V1)\B", + " \u0939\u093f\u0928\u094d\u0926\u0940,"), ['', ' \u0939', + '\u093f', '\u0928', '\u094d', '\u0926', '\u0940,', '']) + + def test_search_anchor(self): + self.assertEqual(regex.findall(r"\G\w{2}", "abcd ef"), ['ab', 'cd']) + + def test_search_reverse(self): + self.assertEqual(regex.findall(r"(?r).", "abc"), ['c', 'b', 'a']) + self.assertEqual(regex.findall(r"(?r).", "abc", overlapped=True), ['c', + 'b', 'a']) + self.assertEqual(regex.findall(r"(?r)..", "abcde"), ['de', 'bc']) + self.assertEqual(regex.findall(r"(?r)..", "abcde", overlapped=True), + ['de', 'cd', 'bc', 'ab']) + self.assertEqual(regex.findall(r"(?r)(.)(-)(.)", "a-b-c", + overlapped=True), [("b", "-", "c"), ("a", "-", "b")]) + + self.assertEqual([m[0] for m in regex.finditer(r"(?r).", "abc")], ['c', + 'b', 'a']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r)..", "abcde", + overlapped=True)], ['de', 'cd', 'bc', 'ab']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r).", "abc")], ['c', + 'b', 'a']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r)..", "abcde", + overlapped=True)], ['de', 'cd', 'bc', 'ab']) + + self.assertEqual(regex.findall(r"^|\w+", "foo bar"), ['', 'foo', + 'bar']) + self.assertEqual(regex.findall(r"(?V1)^|\w+", "foo bar"), ['', 'foo', + 'bar']) + self.assertEqual(regex.findall(r"(?r)^|\w+", "foo bar"), ['bar', 'foo', + '']) + self.assertEqual(regex.findall(r"(?rV1)^|\w+", "foo bar"), ['bar', + 'foo', '']) + + self.assertEqual([m[0] for m in regex.finditer(r"^|\w+", "foo bar")], + ['', 'foo', 'bar']) + self.assertEqual([m[0] for m in regex.finditer(r"(?V1)^|\w+", + "foo bar")], ['', 'foo', 'bar']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r)^|\w+", + "foo bar")], ['bar', 'foo', '']) + self.assertEqual([m[0] for m in regex.finditer(r"(?rV1)^|\w+", + "foo bar")], ['bar', 'foo', '']) + + self.assertEqual(regex.findall(r"\G\w{2}", "abcd ef"), ['ab', 'cd']) + self.assertEqual(regex.findall(r".{2}(?<=\G.*)", "abcd"), ['ab', 'cd']) + self.assertEqual(regex.findall(r"(?r)\G\w{2}", "abcd ef"), []) + self.assertEqual(regex.findall(r"(?r)\w{2}\G", "abcd ef"), ['ef']) + + self.assertEqual(regex.findall(r"q*", "qqwe"), ['qq', '', '', '']) + self.assertEqual(regex.findall(r"(?V1)q*", "qqwe"), ['qq', '', '', '']) + self.assertEqual(regex.findall(r"(?r)q*", "qqwe"), ['', '', 'qq', '']) + self.assertEqual(regex.findall(r"(?rV1)q*", "qqwe"), ['', '', 'qq', + '']) + + self.assertEqual(regex.findall(".", "abcd", pos=1, endpos=3), ['b', + 'c']) + self.assertEqual(regex.findall(".", "abcd", pos=1, endpos=-1), ['b', + 'c']) + self.assertEqual([m[0] for m in regex.finditer(".", "abcd", pos=1, + endpos=3)], ['b', 'c']) + self.assertEqual([m[0] for m in regex.finditer(".", "abcd", pos=1, + endpos=-1)], ['b', 'c']) + + self.assertEqual([m[0] for m in regex.finditer("(?r).", "abcd", pos=1, + endpos=3)], ['c', 'b']) + self.assertEqual([m[0] for m in regex.finditer("(?r).", "abcd", pos=1, + endpos=-1)], ['c', 'b']) + self.assertEqual(regex.findall("(?r).", "abcd", pos=1, endpos=3), ['c', + 'b']) + self.assertEqual(regex.findall("(?r).", "abcd", pos=1, endpos=-1), + ['c', 'b']) + + self.assertEqual(regex.findall(r"[ab]", "aB", regex.I), ['a', 'B']) + self.assertEqual(regex.findall(r"(?r)[ab]", "aB", regex.I), ['B', 'a']) + + self.assertEqual(regex.findall(r"(?r).{2}", "abc"), ['bc']) + self.assertEqual(regex.findall(r"(?r).{2}", "abc", overlapped=True), + ['bc', 'ab']) + self.assertEqual(regex.findall(r"(\w+) (\w+)", + "first second third fourth fifth"), [('first', 'second'), ('third', + 'fourth')]) + self.assertEqual(regex.findall(r"(?r)(\w+) (\w+)", + "first second third fourth fifth"), [('fourth', 'fifth'), ('second', + 'third')]) + + self.assertEqual([m[0] for m in regex.finditer(r"(?r).{2}", "abc")], + ['bc']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r).{2}", "abc", + overlapped=True)], ['bc', 'ab']) + self.assertEqual([m[0] for m in regex.finditer(r"(\w+) (\w+)", + "first second third fourth fifth")], ['first second', + 'third fourth']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r)(\w+) (\w+)", + "first second third fourth fifth")], ['fourth fifth', + 'second third']) + + self.assertEqual(regex.search("abcdef", "abcdef").span(), (0, 6)) + self.assertEqual(regex.search("(?r)abcdef", "abcdef").span(), (0, 6)) + self.assertEqual(regex.search("(?i)abcdef", "ABCDEF").span(), (0, 6)) + self.assertEqual(regex.search("(?ir)abcdef", "ABCDEF").span(), (0, 6)) + + self.assertEqual(regex.sub(r"(.)", r"\1", "abc"), 'abc') + self.assertEqual(regex.sub(r"(?r)(.)", r"\1", "abc"), 'abc') + + def test_atomic(self): + # Issue 433030. + self.assertEqual(regex.search(r"(?>a*)a", "aa"), None) + + def test_possessive(self): + # Single-character non-possessive. + self.assertEqual(regex.search(r"a?a", "a").span(), (0, 1)) + self.assertEqual(regex.search(r"a*a", "aaa").span(), (0, 3)) + self.assertEqual(regex.search(r"a+a", "aaa").span(), (0, 3)) + self.assertEqual(regex.search(r"a{1,3}a", "aaa").span(), (0, 3)) + + # Multiple-character non-possessive. + self.assertEqual(regex.search(r"(?:ab)?ab", "ab").span(), (0, 2)) + self.assertEqual(regex.search(r"(?:ab)*ab", "ababab").span(), (0, 6)) + self.assertEqual(regex.search(r"(?:ab)+ab", "ababab").span(), (0, 6)) + self.assertEqual(regex.search(r"(?:ab){1,3}ab", "ababab").span(), (0, + 6)) + + # Single-character possessive. + self.assertEqual(regex.search(r"a?+a", "a"), None) + self.assertEqual(regex.search(r"a*+a", "aaa"), None) + self.assertEqual(regex.search(r"a++a", "aaa"), None) + self.assertEqual(regex.search(r"a{1,3}+a", "aaa"), None) + + # Multiple-character possessive. + self.assertEqual(regex.search(r"(?:ab)?+ab", "ab"), None) + self.assertEqual(regex.search(r"(?:ab)*+ab", "ababab"), None) + self.assertEqual(regex.search(r"(?:ab)++ab", "ababab"), None) + self.assertEqual(regex.search(r"(?:ab){1,3}+ab", "ababab"), None) + + def test_zerowidth(self): + # Issue 3262. + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.split(r"\b", "a b"), ['', 'a', ' ', 'b', + '']) + else: + self.assertEqual(regex.split(r"\b", "a b"), ['a b']) + self.assertEqual(regex.split(r"(?V1)\b", "a b"), ['', 'a', ' ', 'b', + '']) + + # Issue 1647489. + self.assertEqual(regex.findall(r"^|\w+", "foo bar"), ['', 'foo', + 'bar']) + self.assertEqual([m[0] for m in regex.finditer(r"^|\w+", "foo bar")], + ['', 'foo', 'bar']) + self.assertEqual(regex.findall(r"(?r)^|\w+", "foo bar"), ['bar', + 'foo', '']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r)^|\w+", + "foo bar")], ['bar', 'foo', '']) + self.assertEqual(regex.findall(r"(?V1)^|\w+", "foo bar"), ['', 'foo', + 'bar']) + self.assertEqual([m[0] for m in regex.finditer(r"(?V1)^|\w+", + "foo bar")], ['', 'foo', 'bar']) + self.assertEqual(regex.findall(r"(?rV1)^|\w+", "foo bar"), ['bar', + 'foo', '']) + self.assertEqual([m[0] for m in regex.finditer(r"(?rV1)^|\w+", + "foo bar")], ['bar', 'foo', '']) + + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.split("", "xaxbxc"), ['', 'x', 'a', 'x', + 'b', 'x', 'c', '']) + self.assertEqual([m for m in regex.splititer("", "xaxbxc")], ['', + 'x', 'a', 'x', 'b', 'x', 'c', '']) + else: + self.assertEqual(regex.split("", "xaxbxc"), ['xaxbxc']) + self.assertEqual([m for m in regex.splititer("", "xaxbxc")], + ['xaxbxc']) + + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.split("(?r)", "xaxbxc"), ['', 'c', 'x', 'b', + 'x', 'a', 'x', '']) + self.assertEqual([m for m in regex.splititer("(?r)", "xaxbxc")], + ['', 'c', 'x', 'b', 'x', 'a', 'x', '']) + else: + self.assertEqual(regex.split("(?r)", "xaxbxc"), ['xaxbxc']) + self.assertEqual([m for m in regex.splititer("(?r)", "xaxbxc")], + ['xaxbxc']) + + self.assertEqual(regex.split("(?V1)", "xaxbxc"), ['', 'x', 'a', 'x', + 'b', 'x', 'c', '']) + self.assertEqual([m for m in regex.splititer("(?V1)", "xaxbxc")], ['', + 'x', 'a', 'x', 'b', 'x', 'c', '']) + + self.assertEqual(regex.split("(?rV1)", "xaxbxc"), ['', 'c', 'x', 'b', + 'x', 'a', 'x', '']) + self.assertEqual([m for m in regex.splititer("(?rV1)", "xaxbxc")], ['', + 'c', 'x', 'b', 'x', 'a', 'x', '']) + + def test_scoped_and_inline_flags(self): + # Issues 433028, 433024, 433027. + self.assertEqual(regex.search(r"(?i)Ab", "ab").span(), (0, 2)) + self.assertEqual(regex.search(r"(?i:A)b", "ab").span(), (0, 2)) + # Changed to positional flags in regex 2023.12.23. + self.assertEqual(regex.search(r"A(?i)b", "ab"), None) + + self.assertEqual(regex.search(r"(?V0)Ab", "ab"), None) + self.assertEqual(regex.search(r"(?V1)Ab", "ab"), None) + self.assertEqual(regex.search(r"(?-i)Ab", "ab", flags=regex.I), None) + self.assertEqual(regex.search(r"(?-i:A)b", "ab", flags=regex.I), None) + self.assertEqual(regex.search(r"A(?-i)b", "ab", flags=regex.I).span(), + (0, 2)) + + def test_repeated_repeats(self): + # Issue 2537. + self.assertEqual(regex.search(r"(?:a+)+", "aaa").span(), (0, 3)) + self.assertEqual(regex.search(r"(?:(?:ab)+c)+", "abcabc").span(), (0, + 6)) + + # Hg issue 286. + self.assertEqual(regex.search(r"(?:a+){2,}", "aaa").span(), (0, 3)) + + def test_lookbehind(self): + self.assertEqual(regex.search(r"123(?<=a\d+)", "a123").span(), (1, 4)) + self.assertEqual(regex.search(r"123(?<=a\d+)", "b123"), None) + self.assertEqual(regex.search(r"123(?<!a\d+)", "a123"), None) + self.assertEqual(regex.search(r"123(?<!a\d+)", "b123").span(), (1, 4)) + + self.assertEqual(bool(regex.match("(a)b(?<=b)(c)", "abc")), True) + self.assertEqual(regex.match("(a)b(?<=c)(c)", "abc"), None) + self.assertEqual(bool(regex.match("(a)b(?=c)(c)", "abc")), True) + self.assertEqual(regex.match("(a)b(?=b)(c)", "abc"), None) + + self.assertEqual(regex.match("(?:(a)|(x))b(?<=(?(2)x|c))c", "abc"), + None) + self.assertEqual(regex.match("(?:(a)|(x))b(?<=(?(2)b|x))c", "abc"), + None) + self.assertEqual(bool(regex.match("(?:(a)|(x))b(?<=(?(2)x|b))c", + "abc")), True) + self.assertEqual(regex.match("(?:(a)|(x))b(?<=(?(1)c|x))c", "abc"), + None) + self.assertEqual(bool(regex.match("(?:(a)|(x))b(?<=(?(1)b|x))c", + "abc")), True) + + self.assertEqual(bool(regex.match("(?:(a)|(x))b(?=(?(2)x|c))c", + "abc")), True) + self.assertEqual(regex.match("(?:(a)|(x))b(?=(?(2)c|x))c", "abc"), + None) + self.assertEqual(bool(regex.match("(?:(a)|(x))b(?=(?(2)x|c))c", + "abc")), True) + self.assertEqual(regex.match("(?:(a)|(x))b(?=(?(1)b|x))c", "abc"), + None) + self.assertEqual(bool(regex.match("(?:(a)|(x))b(?=(?(1)c|x))c", + "abc")), True) + + self.assertEqual(regex.match("(a)b(?<=(?(2)x|c))(c)", "abc"), None) + self.assertEqual(regex.match("(a)b(?<=(?(2)b|x))(c)", "abc"), None) + self.assertEqual(regex.match("(a)b(?<=(?(1)c|x))(c)", "abc"), None) + self.assertEqual(bool(regex.match("(a)b(?<=(?(1)b|x))(c)", "abc")), + True) + + self.assertEqual(bool(regex.match("(a)b(?=(?(2)x|c))(c)", "abc")), + True) + self.assertEqual(regex.match("(a)b(?=(?(2)b|x))(c)", "abc"), None) + self.assertEqual(bool(regex.match("(a)b(?=(?(1)c|x))(c)", "abc")), + True) + + self.assertEqual(repr(type(regex.compile(r"(a)\2(b)"))), + self.PATTERN_CLASS) + + def test_unmatched_in_sub(self): + # Issue 1519638. + + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "xy"), + 'y-x-') + else: + self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "xy"), + 'y-x') + self.assertEqual(regex.sub(r"(?V1)(x)?(y)?", r"\2-\1", "xy"), 'y-x-') + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "x"), '-x-') + else: + self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "x"), '-x') + self.assertEqual(regex.sub(r"(?V1)(x)?(y)?", r"\2-\1", "x"), '-x-') + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "y"), 'y--') + else: + self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "y"), 'y-') + self.assertEqual(regex.sub(r"(?V1)(x)?(y)?", r"\2-\1", "y"), 'y--') + + def test_bug_10328 (self): + # Issue 10328. + pat = regex.compile(r'(?mV0)(?P<trailing_ws>[ \t]+\r*$)|(?P<no_final_newline>(?<=[^\n])\Z)') + if sys.version_info >= (3, 7, 0): + self.assertEqual(pat.subn(lambda m: '<' + m.lastgroup + '>', + 'foobar '), ('foobar<trailing_ws><no_final_newline>', 2)) + else: + self.assertEqual(pat.subn(lambda m: '<' + m.lastgroup + '>', + 'foobar '), ('foobar<trailing_ws>', 1)) + self.assertEqual([m.group() for m in pat.finditer('foobar ')], [' ', + '']) + pat = regex.compile(r'(?mV1)(?P<trailing_ws>[ \t]+\r*$)|(?P<no_final_newline>(?<=[^\n])\Z)') + self.assertEqual(pat.subn(lambda m: '<' + m.lastgroup + '>', + 'foobar '), ('foobar<trailing_ws><no_final_newline>', 2)) + self.assertEqual([m.group() for m in pat.finditer('foobar ')], [' ', + '']) + + def test_overlapped(self): + self.assertEqual(regex.findall(r"..", "abcde"), ['ab', 'cd']) + self.assertEqual(regex.findall(r"..", "abcde", overlapped=True), ['ab', + 'bc', 'cd', 'de']) + self.assertEqual(regex.findall(r"(?r)..", "abcde"), ['de', 'bc']) + self.assertEqual(regex.findall(r"(?r)..", "abcde", overlapped=True), + ['de', 'cd', 'bc', 'ab']) + self.assertEqual(regex.findall(r"(.)(-)(.)", "a-b-c", overlapped=True), + [("a", "-", "b"), ("b", "-", "c")]) + + self.assertEqual([m[0] for m in regex.finditer(r"..", "abcde")], ['ab', + 'cd']) + self.assertEqual([m[0] for m in regex.finditer(r"..", "abcde", + overlapped=True)], ['ab', 'bc', 'cd', 'de']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r)..", "abcde")], + ['de', 'bc']) + self.assertEqual([m[0] for m in regex.finditer(r"(?r)..", "abcde", + overlapped=True)], ['de', 'cd', 'bc', 'ab']) + + self.assertEqual([m.groups() for m in regex.finditer(r"(.)(-)(.)", + "a-b-c", overlapped=True)], [("a", "-", "b"), ("b", "-", "c")]) + self.assertEqual([m.groups() for m in regex.finditer(r"(?r)(.)(-)(.)", + "a-b-c", overlapped=True)], [("b", "-", "c"), ("a", "-", "b")]) + + def test_splititer(self): + self.assertEqual(regex.split(r",", "a,b,,c,"), ['a', 'b', '', 'c', '']) + self.assertEqual([m for m in regex.splititer(r",", "a,b,,c,")], ['a', + 'b', '', 'c', '']) + + def test_grapheme(self): + self.assertEqual(regex.match(r"\X", "\xE0").span(), (0, 1)) + self.assertEqual(regex.match(r"\X", "a\u0300").span(), (0, 2)) + + self.assertEqual(regex.findall(r"\X", + "a\xE0a\u0300e\xE9e\u0301"), ['a', '\xe0', 'a\u0300', 'e', + '\xe9', 'e\u0301']) + self.assertEqual(regex.findall(r"\X{3}", + "a\xE0a\u0300e\xE9e\u0301"), ['a\xe0a\u0300', 'e\xe9e\u0301']) + self.assertEqual(regex.findall(r"\X", "\r\r\n\u0301A\u0301"), + ['\r', '\r\n', '\u0301', 'A\u0301']) + + def test_word_boundary(self): + text = 'The quick ("brown") fox can\'t jump 32.3 feet, right?' + self.assertEqual(regex.split(r'(?V1)\b', text), ['', 'The', ' ', + 'quick', ' ("', 'brown', '") ', 'fox', ' ', 'can', "'", 't', + ' ', 'jump', ' ', '32', '.', '3', ' ', 'feet', ', ', + 'right', '?']) + self.assertEqual(regex.split(r'(?V1w)\b', text), ['', 'The', ' ', + 'quick', ' ', '(', '"', 'brown', '"', ')', ' ', 'fox', ' ', + "can't", ' ', 'jump', ' ', '32.3', ' ', 'feet', ',', ' ', + 'right', '?', '']) + + text = "The fox" + self.assertEqual(regex.split(r'(?V1)\b', text), ['', 'The', ' ', + 'fox', '']) + self.assertEqual(regex.split(r'(?V1w)\b', text), ['', 'The', ' ', + 'fox', '']) + + text = "can't aujourd'hui l'objectif" + self.assertEqual(regex.split(r'(?V1)\b', text), ['', 'can', "'", + 't', ' ', 'aujourd', "'", 'hui', ' ', 'l', "'", 'objectif', + '']) + self.assertEqual(regex.split(r'(?V1w)\b', text), ['', "can't", ' ', + "aujourd'hui", ' ', "l'objectif", '']) + + def test_line_boundary(self): + self.assertEqual(regex.findall(r".+", "Line 1\nLine 2\n"), ["Line 1", + "Line 2"]) + self.assertEqual(regex.findall(r".+", "Line 1\rLine 2\r"), + ["Line 1\rLine 2\r"]) + self.assertEqual(regex.findall(r".+", "Line 1\r\nLine 2\r\n"), + ["Line 1\r", "Line 2\r"]) + self.assertEqual(regex.findall(r"(?w).+", "Line 1\nLine 2\n"), + ["Line 1", "Line 2"]) + self.assertEqual(regex.findall(r"(?w).+", "Line 1\rLine 2\r"), + ["Line 1", "Line 2"]) + self.assertEqual(regex.findall(r"(?w).+", "Line 1\r\nLine 2\r\n"), + ["Line 1", "Line 2"]) + + self.assertEqual(regex.search(r"^abc", "abc").start(), 0) + self.assertEqual(regex.search(r"^abc", "\nabc"), None) + self.assertEqual(regex.search(r"^abc", "\rabc"), None) + self.assertEqual(regex.search(r"(?w)^abc", "abc").start(), 0) + self.assertEqual(regex.search(r"(?w)^abc", "\nabc"), None) + self.assertEqual(regex.search(r"(?w)^abc", "\rabc"), None) + + self.assertEqual(regex.search(r"abc$", "abc").start(), 0) + self.assertEqual(regex.search(r"abc$", "abc\n").start(), 0) + self.assertEqual(regex.search(r"abc$", "abc\r"), None) + self.assertEqual(regex.search(r"(?w)abc$", "abc").start(), 0) + self.assertEqual(regex.search(r"(?w)abc$", "abc\n").start(), 0) + self.assertEqual(regex.search(r"(?w)abc$", "abc\r").start(), 0) + + self.assertEqual(regex.search(r"(?m)^abc", "abc").start(), 0) + self.assertEqual(regex.search(r"(?m)^abc", "\nabc").start(), 1) + self.assertEqual(regex.search(r"(?m)^abc", "\rabc"), None) + self.assertEqual(regex.search(r"(?mw)^abc", "abc").start(), 0) + self.assertEqual(regex.search(r"(?mw)^abc", "\nabc").start(), 1) + self.assertEqual(regex.search(r"(?mw)^abc", "\rabc").start(), 1) + + self.assertEqual(regex.search(r"(?m)abc$", "abc").start(), 0) + self.assertEqual(regex.search(r"(?m)abc$", "abc\n").start(), 0) + self.assertEqual(regex.search(r"(?m)abc$", "abc\r"), None) + self.assertEqual(regex.search(r"(?mw)abc$", "abc").start(), 0) + self.assertEqual(regex.search(r"(?mw)abc$", "abc\n").start(), 0) + self.assertEqual(regex.search(r"(?mw)abc$", "abc\r").start(), 0) + + def test_branch_reset(self): + self.assertEqual(regex.match(r"(?:(a)|(b))(c)", "ac").groups(), ('a', + None, 'c')) + self.assertEqual(regex.match(r"(?:(a)|(b))(c)", "bc").groups(), (None, + 'b', 'c')) + self.assertEqual(regex.match(r"(?:(?<a>a)|(?<b>b))(?<c>c)", + "ac").groups(), ('a', None, 'c')) + self.assertEqual(regex.match(r"(?:(?<a>a)|(?<b>b))(?<c>c)", + "bc").groups(), (None, 'b', 'c')) + + self.assertEqual(regex.match(r"(?<a>a)(?:(?<b>b)|(?<c>c))(?<d>d)", + "abd").groups(), ('a', 'b', None, 'd')) + self.assertEqual(regex.match(r"(?<a>a)(?:(?<b>b)|(?<c>c))(?<d>d)", + "acd").groups(), ('a', None, 'c', 'd')) + self.assertEqual(regex.match(r"(a)(?:(b)|(c))(d)", "abd").groups(), + ('a', 'b', None, 'd')) + + self.assertEqual(regex.match(r"(a)(?:(b)|(c))(d)", "acd").groups(), + ('a', None, 'c', 'd')) + self.assertEqual(regex.match(r"(a)(?|(b)|(b))(d)", "abd").groups(), + ('a', 'b', 'd')) + self.assertEqual(regex.match(r"(?|(?<a>a)|(?<b>b))(c)", "ac").groups(), + ('a', None, 'c')) + self.assertEqual(regex.match(r"(?|(?<a>a)|(?<b>b))(c)", "bc").groups(), + (None, 'b', 'c')) + self.assertEqual(regex.match(r"(?|(?<a>a)|(?<a>b))(c)", "ac").groups(), + ('a', 'c')) + + self.assertEqual(regex.match(r"(?|(?<a>a)|(?<a>b))(c)", "bc").groups(), + ('b', 'c')) + + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(?<b>c)(?<a>d))(e)", + "abe").groups(), ('a', 'b', 'e')) + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(?<b>c)(?<a>d))(e)", + "cde").groups(), ('d', 'c', 'e')) + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(?<b>c)(d))(e)", + "abe").groups(), ('a', 'b', 'e')) + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(?<b>c)(d))(e)", + "cde").groups(), ('d', 'c', 'e')) + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(d))(e)", + "abe").groups(), ('a', 'b', 'e')) + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(d))(e)", + "cde").groups(), ('c', 'd', 'e')) + + # Hg issue 87: Allow duplicate names of groups + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(?<a>d))(e)", + "abe").groups(), ("a", "b", "e")) + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(?<a>d))(e)", + "abe").capturesdict(), {"a": ["a"], "b": ["b"]}) + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(?<a>d))(e)", + "cde").groups(), ("d", None, "e")) + self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(?<a>d))(e)", + "cde").capturesdict(), {"a": ["c", "d"], "b": []}) + + def test_set(self): + self.assertEqual(regex.match(r"[a]", "a").span(), (0, 1)) + self.assertEqual(regex.match(r"(?i)[a]", "A").span(), (0, 1)) + self.assertEqual(regex.match(r"[a-b]", r"a").span(), (0, 1)) + self.assertEqual(regex.match(r"(?i)[a-b]", r"A").span(), (0, 1)) + + self.assertEqual(regex.sub(r"(?V0)([][])", r"-", "a[b]c"), "a-b-c") + + self.assertEqual(regex.findall(r"[\p{Alpha}]", "a0"), ["a"]) + self.assertEqual(regex.findall(r"(?i)[\p{Alpha}]", "A0"), ["A"]) + + self.assertEqual(regex.findall(r"[a\p{Alpha}]", "ab0"), ["a", "b"]) + self.assertEqual(regex.findall(r"[a\P{Alpha}]", "ab0"), ["a", "0"]) + self.assertEqual(regex.findall(r"(?i)[a\p{Alpha}]", "ab0"), ["a", + "b"]) + self.assertEqual(regex.findall(r"(?i)[a\P{Alpha}]", "ab0"), ["a", + "0"]) + + self.assertEqual(regex.findall(r"[a-b\p{Alpha}]", "abC0"), ["a", + "b", "C"]) + self.assertEqual(regex.findall(r"(?i)[a-b\p{Alpha}]", "AbC0"), ["A", + "b", "C"]) + + self.assertEqual(regex.findall(r"[\p{Alpha}]", "a0"), ["a"]) + self.assertEqual(regex.findall(r"[\P{Alpha}]", "a0"), ["0"]) + self.assertEqual(regex.findall(r"[^\p{Alpha}]", "a0"), ["0"]) + self.assertEqual(regex.findall(r"[^\P{Alpha}]", "a0"), ["a"]) + + self.assertEqual("".join(regex.findall(r"[^\d-h]", "a^b12c-h")), + 'a^bc') + self.assertEqual("".join(regex.findall(r"[^\dh]", "a^b12c-h")), + 'a^bc-') + self.assertEqual("".join(regex.findall(r"[^h\s\db]", "a^b 12c-h")), + 'a^c-') + self.assertEqual("".join(regex.findall(r"[^b\w]", "a b")), ' ') + self.assertEqual("".join(regex.findall(r"[^b\S]", "a b")), ' ') + self.assertEqual("".join(regex.findall(r"[^8\d]", "a 1b2")), 'a b') + + all_chars = "".join(chr(c) for c in range(0x100)) + self.assertEqual(len(regex.findall(r"\p{ASCII}", all_chars)), 128) + self.assertEqual(len(regex.findall(r"\p{Letter}", all_chars)), + 117) + self.assertEqual(len(regex.findall(r"\p{Digit}", all_chars)), 10) + + # Set operators + self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Letter}]", + all_chars)), 52) + self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Alnum}&&\p{Letter}]", + all_chars)), 52) + self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Alnum}&&\p{Digit}]", + all_chars)), 10) + self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Cc}]", + all_chars)), 33) + self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Graph}]", + all_chars)), 94) + self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}--\p{Cc}]", + all_chars)), 95) + self.assertEqual(len(regex.findall(r"[\p{Letter}\p{Digit}]", + all_chars)), 127) + self.assertEqual(len(regex.findall(r"(?V1)[\p{Letter}||\p{Digit}]", + all_chars)), 127) + self.assertEqual(len(regex.findall(r"\p{HexDigit}", all_chars)), + 22) + self.assertEqual(len(regex.findall(r"(?V1)[\p{HexDigit}~~\p{Digit}]", + all_chars)), 12) + self.assertEqual(len(regex.findall(r"(?V1)[\p{Digit}~~\p{HexDigit}]", + all_chars)), 12) + + self.assertEqual(repr(type(regex.compile(r"(?V0)([][-])"))), + self.PATTERN_CLASS) + self.assertEqual(regex.findall(r"(?V1)[[a-z]--[aei]]", "abc"), ["b", + "c"]) + self.assertEqual(regex.findall(r"(?iV1)[[a-z]--[aei]]", "abc"), ["b", + "c"]) + self.assertEqual(regex.findall(r"(?V1)[\w--a]","abc"), ["b", "c"]) + self.assertEqual(regex.findall(r"(?iV1)[\w--a]","abc"), ["b", "c"]) + + def test_various(self): + tests = [ + # Test ?P< and ?P= extensions. + ('(?P<foo_123', '', '', regex.error, self.MISSING_GT), # Unterminated group identifier. + ('(?P<1>a)', '', '', regex.error, self.BAD_GROUP_NAME), # Begins with a digit. + ('(?P<!>a)', '', '', regex.error, self.BAD_GROUP_NAME), # Begins with an illegal char. + ('(?P<foo!>a)', '', '', regex.error, self.BAD_GROUP_NAME), # Begins with an illegal char. + + # Same tests, for the ?P= form. + ('(?P<foo_123>a)(?P=foo_123', 'aa', '', regex.error, + self.MISSING_RPAREN), + ('(?P<foo_123>a)(?P=1)', 'aa', '1', ascii('a')), + ('(?P<foo_123>a)(?P=0)', 'aa', '', regex.error, + self.BAD_GROUP_NAME), + ('(?P<foo_123>a)(?P=-1)', 'aa', '', regex.error, + self.BAD_GROUP_NAME), + ('(?P<foo_123>a)(?P=!)', 'aa', '', regex.error, + self.BAD_GROUP_NAME), + ('(?P<foo_123>a)(?P=foo_124)', 'aa', '', regex.error, + self.UNKNOWN_GROUP), # Backref to undefined group. + + ('(?P<foo_123>a)', 'a', '1', ascii('a')), + ('(?P<foo_123>a)(?P=foo_123)', 'aa', '1', ascii('a')), + + # Mal-formed \g in pattern treated as literal for compatibility. + (r'(?<foo_123>a)\g<foo_123', 'aa', '', ascii(None)), + (r'(?<foo_123>a)\g<1>', 'aa', '1', ascii('a')), + (r'(?<foo_123>a)\g<!>', 'aa', '', ascii(None)), + (r'(?<foo_123>a)\g<foo_124>', 'aa', '', regex.error, + self.UNKNOWN_GROUP), # Backref to undefined group. + + ('(?<foo_123>a)', 'a', '1', ascii('a')), + (r'(?<foo_123>a)\g<foo_123>', 'aa', '1', ascii('a')), + + # Test octal escapes. + ('\\1', 'a', '', regex.error, self.INVALID_GROUP_REF), # Backreference. + ('[\\1]', '\1', '0', "'\\x01'"), # Character. + ('\\09', chr(0) + '9', '0', ascii(chr(0) + '9')), + ('\\141', 'a', '0', ascii('a')), + ('(a)(b)(c)(d)(e)(f)(g)(h)(i)(j)(k)(l)\\119', 'abcdefghijklk9', + '0,11', ascii(('abcdefghijklk9', 'k'))), + + # Test \0 is handled everywhere. + (r'\0', '\0', '0', ascii('\0')), + (r'[\0a]', '\0', '0', ascii('\0')), + (r'[a\0]', '\0', '0', ascii('\0')), + (r'[^a\0]', '\0', '', ascii(None)), + + # Test various letter escapes. + (r'\a[\b]\f\n\r\t\v', '\a\b\f\n\r\t\v', '0', + ascii('\a\b\f\n\r\t\v')), + (r'[\a][\b][\f][\n][\r][\t][\v]', '\a\b\f\n\r\t\v', '0', + ascii('\a\b\f\n\r\t\v')), + (r'\xff', '\377', '0', ascii(chr(255))), + + # New \x semantics. + (r'\x00ffffffffffffff', '\377', '', ascii(None)), + (r'\x00f', '\017', '', ascii(None)), + (r'\x00fe', '\376', '', ascii(None)), + + (r'\x00ff', '\377', '', ascii(None)), + (r'\t\n\v\r\f\a\g', '\t\n\v\r\f\ag', '0', ascii('\t\n\v\r\f\ag')), + ('\t\n\v\r\f\a\\g', '\t\n\v\r\f\ag', '0', ascii('\t\n\v\r\f\ag')), + (r'\t\n\v\r\f\a', '\t\n\v\r\f\a', '0', ascii(chr(9) + chr(10) + + chr(11) + chr(13) + chr(12) + chr(7))), + (r'[\t][\n][\v][\r][\f][\b]', '\t\n\v\r\f\b', '0', + ascii('\t\n\v\r\f\b')), + + (r"^\w+=(\\[\000-\277]|[^\n\\])*", + "SRC=eval.c g.c blah blah blah \\\\\n\tapes.c", '0', + ascii("SRC=eval.c g.c blah blah blah \\\\")), + + # Test that . only matches \n in DOTALL mode. + ('a.b', 'acb', '0', ascii('acb')), + ('a.b', 'a\nb', '', ascii(None)), + ('a.*b', 'acc\nccb', '', ascii(None)), + ('a.{4,5}b', 'acc\nccb', '', ascii(None)), + ('a.b', 'a\rb', '0', ascii('a\rb')), + # Changed to positional flags in regex 2023.12.23. + ('a.b(?s)', 'a\nb', '', ascii(None)), + ('(?s)a.b', 'a\nb', '0', ascii('a\nb')), + ('a.*(?s)b', 'acc\nccb', '', ascii(None)), + ('(?s)a.*b', 'acc\nccb', '0', ascii('acc\nccb')), + ('(?s)a.{4,5}b', 'acc\nccb', '0', ascii('acc\nccb')), + + (')', '', '', regex.error, self.TRAILING_CHARS), # Unmatched right bracket. + ('', '', '0', "''"), # Empty pattern. + ('abc', 'abc', '0', ascii('abc')), + ('abc', 'xbc', '', ascii(None)), + ('abc', 'axc', '', ascii(None)), + ('abc', 'abx', '', ascii(None)), + ('abc', 'xabcy', '0', ascii('abc')), + ('abc', 'ababc', '0', ascii('abc')), + ('ab*c', 'abc', '0', ascii('abc')), + ('ab*bc', 'abc', '0', ascii('abc')), + + ('ab*bc', 'abbc', '0', ascii('abbc')), + ('ab*bc', 'abbbbc', '0', ascii('abbbbc')), + ('ab+bc', 'abbc', '0', ascii('abbc')), + ('ab+bc', 'abc', '', ascii(None)), + ('ab+bc', 'abq', '', ascii(None)), + ('ab+bc', 'abbbbc', '0', ascii('abbbbc')), + ('ab?bc', 'abbc', '0', ascii('abbc')), + ('ab?bc', 'abc', '0', ascii('abc')), + ('ab?bc', 'abbbbc', '', ascii(None)), + ('ab?c', 'abc', '0', ascii('abc')), + + ('^abc$', 'abc', '0', ascii('abc')), + ('^abc$', 'abcc', '', ascii(None)), + ('^abc', 'abcc', '0', ascii('abc')), + ('^abc$', 'aabc', '', ascii(None)), + ('abc$', 'aabc', '0', ascii('abc')), + ('^', 'abc', '0', ascii('')), + ('$', 'abc', '0', ascii('')), + ('a.c', 'abc', '0', ascii('abc')), + ('a.c', 'axc', '0', ascii('axc')), + ('a.*c', 'axyzc', '0', ascii('axyzc')), + + ('a.*c', 'axyzd', '', ascii(None)), + ('a[bc]d', 'abc', '', ascii(None)), + ('a[bc]d', 'abd', '0', ascii('abd')), + ('a[b-d]e', 'abd', '', ascii(None)), + ('a[b-d]e', 'ace', '0', ascii('ace')), + ('a[b-d]', 'aac', '0', ascii('ac')), + ('a[-b]', 'a-', '0', ascii('a-')), + ('a[\\-b]', 'a-', '0', ascii('a-')), + ('a[b-]', 'a-', '0', ascii('a-')), + ('a[]b', '-', '', regex.error, self.BAD_SET), + + ('a[', '-', '', regex.error, self.BAD_SET), + ('a\\', '-', '', regex.error, self.BAD_ESCAPE), + ('abc)', '-', '', regex.error, self.TRAILING_CHARS), + ('(abc', '-', '', regex.error, self.MISSING_RPAREN), + ('a]', 'a]', '0', ascii('a]')), + ('a[]]b', 'a]b', '0', ascii('a]b')), + ('a[]]b', 'a]b', '0', ascii('a]b')), + ('a[^bc]d', 'aed', '0', ascii('aed')), + ('a[^bc]d', 'abd', '', ascii(None)), + ('a[^-b]c', 'adc', '0', ascii('adc')), + + ('a[^-b]c', 'a-c', '', ascii(None)), + ('a[^]b]c', 'a]c', '', ascii(None)), + ('a[^]b]c', 'adc', '0', ascii('adc')), + ('\\ba\\b', 'a-', '0', ascii('a')), + ('\\ba\\b', '-a', '0', ascii('a')), + ('\\ba\\b', '-a-', '0', ascii('a')), + ('\\by\\b', 'xy', '', ascii(None)), + ('\\by\\b', 'yz', '', ascii(None)), + ('\\by\\b', 'xyz', '', ascii(None)), + ('x\\b', 'xyz', '', ascii(None)), + + ('x\\B', 'xyz', '0', ascii('x')), + ('\\Bz', 'xyz', '0', ascii('z')), + ('z\\B', 'xyz', '', ascii(None)), + ('\\Bx', 'xyz', '', ascii(None)), + ('\\Ba\\B', 'a-', '', ascii(None)), + ('\\Ba\\B', '-a', '', ascii(None)), + ('\\Ba\\B', '-a-', '', ascii(None)), + ('\\By\\B', 'xy', '', ascii(None)), + ('\\By\\B', 'yz', '', ascii(None)), + ('\\By\\b', 'xy', '0', ascii('y')), + + ('\\by\\B', 'yz', '0', ascii('y')), + ('\\By\\B', 'xyz', '0', ascii('y')), + ('ab|cd', 'abc', '0', ascii('ab')), + ('ab|cd', 'abcd', '0', ascii('ab')), + ('()ef', 'def', '0,1', ascii(('ef', ''))), + ('$b', 'b', '', ascii(None)), + ('a\\(b', 'a(b', '', ascii(('a(b',))), + ('a\\(*b', 'ab', '0', ascii('ab')), + ('a\\(*b', 'a((b', '0', ascii('a((b')), + ('a\\\\b', 'a\\b', '0', ascii('a\\b')), + + ('((a))', 'abc', '0,1,2', ascii(('a', 'a', 'a'))), + ('(a)b(c)', 'abc', '0,1,2', ascii(('abc', 'a', 'c'))), + ('a+b+c', 'aabbabc', '0', ascii('abc')), + ('(a+|b)*', 'ab', '0,1', ascii(('ab', 'b'))), + ('(a+|b)+', 'ab', '0,1', ascii(('ab', 'b'))), + ('(a+|b)?', 'ab', '0,1', ascii(('a', 'a'))), + (')(', '-', '', regex.error, self.TRAILING_CHARS), + ('[^ab]*', 'cde', '0', ascii('cde')), + ('abc', '', '', ascii(None)), + ('a*', '', '0', ascii('')), + + ('a|b|c|d|e', 'e', '0', ascii('e')), + ('(a|b|c|d|e)f', 'ef', '0,1', ascii(('ef', 'e'))), + ('abcd*efg', 'abcdefg', '0', ascii('abcdefg')), + ('ab*', 'xabyabbbz', '0', ascii('ab')), + ('ab*', 'xayabbbz', '0', ascii('a')), + ('(ab|cd)e', 'abcde', '0,1', ascii(('cde', 'cd'))), + ('[abhgefdc]ij', 'hij', '0', ascii('hij')), + ('^(ab|cd)e', 'abcde', '', ascii(None)), + ('(abc|)ef', 'abcdef', '0,1', ascii(('ef', ''))), + ('(a|b)c*d', 'abcd', '0,1', ascii(('bcd', 'b'))), + + ('(ab|ab*)bc', 'abc', '0,1', ascii(('abc', 'a'))), + ('a([bc]*)c*', 'abc', '0,1', ascii(('abc', 'bc'))), + ('a([bc]*)(c*d)', 'abcd', '0,1,2', ascii(('abcd', 'bc', 'd'))), + ('a([bc]+)(c*d)', 'abcd', '0,1,2', ascii(('abcd', 'bc', 'd'))), + ('a([bc]*)(c+d)', 'abcd', '0,1,2', ascii(('abcd', 'b', 'cd'))), + ('a[bcd]*dcdcde', 'adcdcde', '0', ascii('adcdcde')), + ('a[bcd]+dcdcde', 'adcdcde', '', ascii(None)), + ('(ab|a)b*c', 'abc', '0,1', ascii(('abc', 'ab'))), + ('((a)(b)c)(d)', 'abcd', '1,2,3,4', ascii(('abc', 'a', 'b', 'd'))), + ('[a-zA-Z_][a-zA-Z0-9_]*', 'alpha', '0', ascii('alpha')), + + ('^a(bc+|b[eh])g|.h$', 'abh', '0,1', ascii(('bh', None))), + ('(bc+d$|ef*g.|h?i(j|k))', 'effgz', '0,1,2', ascii(('effgz', + 'effgz', None))), + ('(bc+d$|ef*g.|h?i(j|k))', 'ij', '0,1,2', ascii(('ij', 'ij', + 'j'))), + ('(bc+d$|ef*g.|h?i(j|k))', 'effg', '', ascii(None)), + ('(bc+d$|ef*g.|h?i(j|k))', 'bcdd', '', ascii(None)), + ('(bc+d$|ef*g.|h?i(j|k))', 'reffgz', '0,1,2', ascii(('effgz', + 'effgz', None))), + ('(((((((((a)))))))))', 'a', '0', ascii('a')), + ('multiple words of text', 'uh-uh', '', ascii(None)), + ('multiple words', 'multiple words, yeah', '0', + ascii('multiple words')), + ('(.*)c(.*)', 'abcde', '0,1,2', ascii(('abcde', 'ab', 'de'))), + + ('\\((.*), (.*)\\)', '(a, b)', '2,1', ascii(('b', 'a'))), + ('[k]', 'ab', '', ascii(None)), + ('a[-]?c', 'ac', '0', ascii('ac')), + ('(abc)\\1', 'abcabc', '1', ascii('abc')), + ('([a-c]*)\\1', 'abcabc', '1', ascii('abc')), + ('^(.+)?B', 'AB', '1', ascii('A')), + ('(a+).\\1$', 'aaaaa', '0,1', ascii(('aaaaa', 'aa'))), + ('^(a+).\\1$', 'aaaa', '', ascii(None)), + ('(abc)\\1', 'abcabc', '0,1', ascii(('abcabc', 'abc'))), + ('([a-c]+)\\1', 'abcabc', '0,1', ascii(('abcabc', 'abc'))), + + ('(a)\\1', 'aa', '0,1', ascii(('aa', 'a'))), + ('(a+)\\1', 'aa', '0,1', ascii(('aa', 'a'))), + ('(a+)+\\1', 'aa', '0,1', ascii(('aa', 'a'))), + ('(a).+\\1', 'aba', '0,1', ascii(('aba', 'a'))), + ('(a)ba*\\1', 'aba', '0,1', ascii(('aba', 'a'))), + ('(aa|a)a\\1$', 'aaa', '0,1', ascii(('aaa', 'a'))), + ('(a|aa)a\\1$', 'aaa', '0,1', ascii(('aaa', 'a'))), + ('(a+)a\\1$', 'aaa', '0,1', ascii(('aaa', 'a'))), + ('([abc]*)\\1', 'abcabc', '0,1', ascii(('abcabc', 'abc'))), + ('(a)(b)c|ab', 'ab', '0,1,2', ascii(('ab', None, None))), + + ('(a)+x', 'aaax', '0,1', ascii(('aaax', 'a'))), + ('([ac])+x', 'aacx', '0,1', ascii(('aacx', 'c'))), + ('([^/]*/)*sub1/', 'd:msgs/tdir/sub1/trial/away.cpp', '0,1', + ascii(('d:msgs/tdir/sub1/', 'tdir/'))), + ('([^.]*)\\.([^:]*):[T ]+(.*)', 'track1.title:TBlah blah blah', + '0,1,2,3', ascii(('track1.title:TBlah blah blah', 'track1', + 'title', 'Blah blah blah'))), + ('([^N]*N)+', 'abNNxyzN', '0,1', ascii(('abNNxyzN', 'xyzN'))), + ('([^N]*N)+', 'abNNxyz', '0,1', ascii(('abNN', 'N'))), + ('([abc]*)x', 'abcx', '0,1', ascii(('abcx', 'abc'))), + ('([abc]*)x', 'abc', '', ascii(None)), + ('([xyz]*)x', 'abcx', '0,1', ascii(('x', ''))), + ('(a)+b|aac', 'aac', '0,1', ascii(('aac', None))), + + # Test symbolic groups. + ('(?P<i d>aaa)a', 'aaaa', '', regex.error, self.BAD_GROUP_NAME), + ('(?P<id>aaa)a', 'aaaa', '0,id', ascii(('aaaa', 'aaa'))), + ('(?P<id>aa)(?P=id)', 'aaaa', '0,id', ascii(('aaaa', 'aa'))), + ('(?P<id>aa)(?P=xd)', 'aaaa', '', regex.error, self.UNKNOWN_GROUP), + + # Character properties. + (r"\g", "g", '0', ascii('g')), + (r"\g<1>", "g", '', regex.error, self.INVALID_GROUP_REF), + (r"(.)\g<1>", "gg", '0', ascii('gg')), + (r"(.)\g<1>", "gg", '', ascii(('gg', 'g'))), + (r"\N", "N", '0', ascii('N')), + (r"\N{LATIN SMALL LETTER A}", "a", '0', ascii('a')), + (r"\p", "p", '0', ascii('p')), + (r"\p{Ll}", "a", '0', ascii('a')), + (r"\P", "P", '0', ascii('P')), + (r"\P{Lu}", "p", '0', ascii('p')), + + # All tests from Perl. + ('abc', 'abc', '0', ascii('abc')), + ('abc', 'xbc', '', ascii(None)), + ('abc', 'axc', '', ascii(None)), + ('abc', 'abx', '', ascii(None)), + ('abc', 'xabcy', '0', ascii('abc')), + ('abc', 'ababc', '0', ascii('abc')), + + ('ab*c', 'abc', '0', ascii('abc')), + ('ab*bc', 'abc', '0', ascii('abc')), + ('ab*bc', 'abbc', '0', ascii('abbc')), + ('ab*bc', 'abbbbc', '0', ascii('abbbbc')), + ('ab{0,}bc', 'abbbbc', '0', ascii('abbbbc')), + ('ab+bc', 'abbc', '0', ascii('abbc')), + ('ab+bc', 'abc', '', ascii(None)), + ('ab+bc', 'abq', '', ascii(None)), + ('ab{1,}bc', 'abq', '', ascii(None)), + ('ab+bc', 'abbbbc', '0', ascii('abbbbc')), + + ('ab{1,}bc', 'abbbbc', '0', ascii('abbbbc')), + ('ab{1,3}bc', 'abbbbc', '0', ascii('abbbbc')), + ('ab{3,4}bc', 'abbbbc', '0', ascii('abbbbc')), + ('ab{4,5}bc', 'abbbbc', '', ascii(None)), + ('ab?bc', 'abbc', '0', ascii('abbc')), + ('ab?bc', 'abc', '0', ascii('abc')), + ('ab{0,1}bc', 'abc', '0', ascii('abc')), + ('ab?bc', 'abbbbc', '', ascii(None)), + ('ab?c', 'abc', '0', ascii('abc')), + ('ab{0,1}c', 'abc', '0', ascii('abc')), + + ('^abc$', 'abc', '0', ascii('abc')), + ('^abc$', 'abcc', '', ascii(None)), + ('^abc', 'abcc', '0', ascii('abc')), + ('^abc$', 'aabc', '', ascii(None)), + ('abc$', 'aabc', '0', ascii('abc')), + ('^', 'abc', '0', ascii('')), + ('$', 'abc', '0', ascii('')), + ('a.c', 'abc', '0', ascii('abc')), + ('a.c', 'axc', '0', ascii('axc')), + ('a.*c', 'axyzc', '0', ascii('axyzc')), + + ('a.*c', 'axyzd', '', ascii(None)), + ('a[bc]d', 'abc', '', ascii(None)), + ('a[bc]d', 'abd', '0', ascii('abd')), + ('a[b-d]e', 'abd', '', ascii(None)), + ('a[b-d]e', 'ace', '0', ascii('ace')), + ('a[b-d]', 'aac', '0', ascii('ac')), + ('a[-b]', 'a-', '0', ascii('a-')), + ('a[b-]', 'a-', '0', ascii('a-')), + ('a[b-a]', '-', '', regex.error, self.BAD_CHAR_RANGE), + ('a[]b', '-', '', regex.error, self.BAD_SET), + + ('a[', '-', '', regex.error, self.BAD_SET), + ('a]', 'a]', '0', ascii('a]')), + ('a[]]b', 'a]b', '0', ascii('a]b')), + ('a[^bc]d', 'aed', '0', ascii('aed')), + ('a[^bc]d', 'abd', '', ascii(None)), + ('a[^-b]c', 'adc', '0', ascii('adc')), + ('a[^-b]c', 'a-c', '', ascii(None)), + ('a[^]b]c', 'a]c', '', ascii(None)), + ('a[^]b]c', 'adc', '0', ascii('adc')), + ('ab|cd', 'abc', '0', ascii('ab')), + + ('ab|cd', 'abcd', '0', ascii('ab')), + ('()ef', 'def', '0,1', ascii(('ef', ''))), + ('*a', '-', '', regex.error, self.NOTHING_TO_REPEAT), + ('(*)b', '-', '', regex.error, self.NOTHING_TO_REPEAT), + ('$b', 'b', '', ascii(None)), + ('a\\', '-', '', regex.error, self.BAD_ESCAPE), + ('a\\(b', 'a(b', '', ascii(('a(b',))), + ('a\\(*b', 'ab', '0', ascii('ab')), + ('a\\(*b', 'a((b', '0', ascii('a((b')), + ('a\\\\b', 'a\\b', '0', ascii('a\\b')), + + ('abc)', '-', '', regex.error, self.TRAILING_CHARS), + ('(abc', '-', '', regex.error, self.MISSING_RPAREN), + ('((a))', 'abc', '0,1,2', ascii(('a', 'a', 'a'))), + ('(a)b(c)', 'abc', '0,1,2', ascii(('abc', 'a', 'c'))), + ('a+b+c', 'aabbabc', '0', ascii('abc')), + ('a{1,}b{1,}c', 'aabbabc', '0', ascii('abc')), + ('a**', '-', '', regex.error, self.MULTIPLE_REPEAT), + ('a.+?c', 'abcabc', '0', ascii('abc')), + ('(a+|b)*', 'ab', '0,1', ascii(('ab', 'b'))), + ('(a+|b){0,}', 'ab', '0,1', ascii(('ab', 'b'))), + + ('(a+|b)+', 'ab', '0,1', ascii(('ab', 'b'))), + ('(a+|b){1,}', 'ab', '0,1', ascii(('ab', 'b'))), + ('(a+|b)?', 'ab', '0,1', ascii(('a', 'a'))), + ('(a+|b){0,1}', 'ab', '0,1', ascii(('a', 'a'))), + (')(', '-', '', regex.error, self.TRAILING_CHARS), + ('[^ab]*', 'cde', '0', ascii('cde')), + ('abc', '', '', ascii(None)), + ('a*', '', '0', ascii('')), + ('([abc])*d', 'abbbcd', '0,1', ascii(('abbbcd', 'c'))), + ('([abc])*bcd', 'abcd', '0,1', ascii(('abcd', 'a'))), + + ('a|b|c|d|e', 'e', '0', ascii('e')), + ('(a|b|c|d|e)f', 'ef', '0,1', ascii(('ef', 'e'))), + ('abcd*efg', 'abcdefg', '0', ascii('abcdefg')), + ('ab*', 'xabyabbbz', '0', ascii('ab')), + ('ab*', 'xayabbbz', '0', ascii('a')), + ('(ab|cd)e', 'abcde', '0,1', ascii(('cde', 'cd'))), + ('[abhgefdc]ij', 'hij', '0', ascii('hij')), + ('^(ab|cd)e', 'abcde', '', ascii(None)), + ('(abc|)ef', 'abcdef', '0,1', ascii(('ef', ''))), + ('(a|b)c*d', 'abcd', '0,1', ascii(('bcd', 'b'))), + + ('(ab|ab*)bc', 'abc', '0,1', ascii(('abc', 'a'))), + ('a([bc]*)c*', 'abc', '0,1', ascii(('abc', 'bc'))), + ('a([bc]*)(c*d)', 'abcd', '0,1,2', ascii(('abcd', 'bc', 'd'))), + ('a([bc]+)(c*d)', 'abcd', '0,1,2', ascii(('abcd', 'bc', 'd'))), + ('a([bc]*)(c+d)', 'abcd', '0,1,2', ascii(('abcd', 'b', 'cd'))), + ('a[bcd]*dcdcde', 'adcdcde', '0', ascii('adcdcde')), + ('a[bcd]+dcdcde', 'adcdcde', '', ascii(None)), + ('(ab|a)b*c', 'abc', '0,1', ascii(('abc', 'ab'))), + ('((a)(b)c)(d)', 'abcd', '1,2,3,4', ascii(('abc', 'a', 'b', 'd'))), + ('[a-zA-Z_][a-zA-Z0-9_]*', 'alpha', '0', ascii('alpha')), + + ('^a(bc+|b[eh])g|.h$', 'abh', '0,1', ascii(('bh', None))), + ('(bc+d$|ef*g.|h?i(j|k))', 'effgz', '0,1,2', ascii(('effgz', + 'effgz', None))), + ('(bc+d$|ef*g.|h?i(j|k))', 'ij', '0,1,2', ascii(('ij', 'ij', + 'j'))), + ('(bc+d$|ef*g.|h?i(j|k))', 'effg', '', ascii(None)), + ('(bc+d$|ef*g.|h?i(j|k))', 'bcdd', '', ascii(None)), + ('(bc+d$|ef*g.|h?i(j|k))', 'reffgz', '0,1,2', ascii(('effgz', + 'effgz', None))), + ('((((((((((a))))))))))', 'a', '10', ascii('a')), + ('((((((((((a))))))))))\\10', 'aa', '0', ascii('aa')), + + # Python does not have the same rules for \\41 so this is a syntax error + # ('((((((((((a))))))))))\\41', 'aa', '', ascii(None)), + # ('((((((((((a))))))))))\\41', 'a!', '0', ascii('a!')), + ('((((((((((a))))))))))\\41', '', '', regex.error, + self.INVALID_GROUP_REF), + ('(?i)((((((((((a))))))))))\\41', '', '', regex.error, + self.INVALID_GROUP_REF), + + ('(((((((((a)))))))))', 'a', '0', ascii('a')), + ('multiple words of text', 'uh-uh', '', ascii(None)), + ('multiple words', 'multiple words, yeah', '0', + ascii('multiple words')), + ('(.*)c(.*)', 'abcde', '0,1,2', ascii(('abcde', 'ab', 'de'))), + ('\\((.*), (.*)\\)', '(a, b)', '2,1', ascii(('b', 'a'))), + ('[k]', 'ab', '', ascii(None)), + ('a[-]?c', 'ac', '0', ascii('ac')), + ('(abc)\\1', 'abcabc', '1', ascii('abc')), + ('([a-c]*)\\1', 'abcabc', '1', ascii('abc')), + ('(?i)abc', 'ABC', '0', ascii('ABC')), + + ('(?i)abc', 'XBC', '', ascii(None)), + ('(?i)abc', 'AXC', '', ascii(None)), + ('(?i)abc', 'ABX', '', ascii(None)), + ('(?i)abc', 'XABCY', '0', ascii('ABC')), + ('(?i)abc', 'ABABC', '0', ascii('ABC')), + ('(?i)ab*c', 'ABC', '0', ascii('ABC')), + ('(?i)ab*bc', 'ABC', '0', ascii('ABC')), + ('(?i)ab*bc', 'ABBC', '0', ascii('ABBC')), + ('(?i)ab*?bc', 'ABBBBC', '0', ascii('ABBBBC')), + ('(?i)ab{0,}?bc', 'ABBBBC', '0', ascii('ABBBBC')), + + ('(?i)ab+?bc', 'ABBC', '0', ascii('ABBC')), + ('(?i)ab+bc', 'ABC', '', ascii(None)), + ('(?i)ab+bc', 'ABQ', '', ascii(None)), + ('(?i)ab{1,}bc', 'ABQ', '', ascii(None)), + ('(?i)ab+bc', 'ABBBBC', '0', ascii('ABBBBC')), + ('(?i)ab{1,}?bc', 'ABBBBC', '0', ascii('ABBBBC')), + ('(?i)ab{1,3}?bc', 'ABBBBC', '0', ascii('ABBBBC')), + ('(?i)ab{3,4}?bc', 'ABBBBC', '0', ascii('ABBBBC')), + ('(?i)ab{4,5}?bc', 'ABBBBC', '', ascii(None)), + ('(?i)ab??bc', 'ABBC', '0', ascii('ABBC')), + + ('(?i)ab??bc', 'ABC', '0', ascii('ABC')), + ('(?i)ab{0,1}?bc', 'ABC', '0', ascii('ABC')), + ('(?i)ab??bc', 'ABBBBC', '', ascii(None)), + ('(?i)ab??c', 'ABC', '0', ascii('ABC')), + ('(?i)ab{0,1}?c', 'ABC', '0', ascii('ABC')), + ('(?i)^abc$', 'ABC', '0', ascii('ABC')), + ('(?i)^abc$', 'ABCC', '', ascii(None)), + ('(?i)^abc', 'ABCC', '0', ascii('ABC')), + ('(?i)^abc$', 'AABC', '', ascii(None)), + ('(?i)abc$', 'AABC', '0', ascii('ABC')), + + ('(?i)^', 'ABC', '0', ascii('')), + ('(?i)$', 'ABC', '0', ascii('')), + ('(?i)a.c', 'ABC', '0', ascii('ABC')), + ('(?i)a.c', 'AXC', '0', ascii('AXC')), + ('(?i)a.*?c', 'AXYZC', '0', ascii('AXYZC')), + ('(?i)a.*c', 'AXYZD', '', ascii(None)), + ('(?i)a[bc]d', 'ABC', '', ascii(None)), + ('(?i)a[bc]d', 'ABD', '0', ascii('ABD')), + ('(?i)a[b-d]e', 'ABD', '', ascii(None)), + ('(?i)a[b-d]e', 'ACE', '0', ascii('ACE')), + + ('(?i)a[b-d]', 'AAC', '0', ascii('AC')), + ('(?i)a[-b]', 'A-', '0', ascii('A-')), + ('(?i)a[b-]', 'A-', '0', ascii('A-')), + ('(?i)a[b-a]', '-', '', regex.error, self.BAD_CHAR_RANGE), + ('(?i)a[]b', '-', '', regex.error, self.BAD_SET), + ('(?i)a[', '-', '', regex.error, self.BAD_SET), + ('(?i)a]', 'A]', '0', ascii('A]')), + ('(?i)a[]]b', 'A]B', '0', ascii('A]B')), + ('(?i)a[^bc]d', 'AED', '0', ascii('AED')), + ('(?i)a[^bc]d', 'ABD', '', ascii(None)), + + ('(?i)a[^-b]c', 'ADC', '0', ascii('ADC')), + ('(?i)a[^-b]c', 'A-C', '', ascii(None)), + ('(?i)a[^]b]c', 'A]C', '', ascii(None)), + ('(?i)a[^]b]c', 'ADC', '0', ascii('ADC')), + ('(?i)ab|cd', 'ABC', '0', ascii('AB')), + ('(?i)ab|cd', 'ABCD', '0', ascii('AB')), + ('(?i)()ef', 'DEF', '0,1', ascii(('EF', ''))), + ('(?i)*a', '-', '', regex.error, self.NOTHING_TO_REPEAT), + ('(?i)(*)b', '-', '', regex.error, self.NOTHING_TO_REPEAT), + ('(?i)$b', 'B', '', ascii(None)), + + ('(?i)a\\', '-', '', regex.error, self.BAD_ESCAPE), + ('(?i)a\\(b', 'A(B', '', ascii(('A(B',))), + ('(?i)a\\(*b', 'AB', '0', ascii('AB')), + ('(?i)a\\(*b', 'A((B', '0', ascii('A((B')), + ('(?i)a\\\\b', 'A\\B', '0', ascii('A\\B')), + ('(?i)abc)', '-', '', regex.error, self.TRAILING_CHARS), + ('(?i)(abc', '-', '', regex.error, self.MISSING_RPAREN), + ('(?i)((a))', 'ABC', '0,1,2', ascii(('A', 'A', 'A'))), + ('(?i)(a)b(c)', 'ABC', '0,1,2', ascii(('ABC', 'A', 'C'))), + ('(?i)a+b+c', 'AABBABC', '0', ascii('ABC')), + + ('(?i)a{1,}b{1,}c', 'AABBABC', '0', ascii('ABC')), + ('(?i)a**', '-', '', regex.error, self.MULTIPLE_REPEAT), + ('(?i)a.+?c', 'ABCABC', '0', ascii('ABC')), + ('(?i)a.*?c', 'ABCABC', '0', ascii('ABC')), + ('(?i)a.{0,5}?c', 'ABCABC', '0', ascii('ABC')), + ('(?i)(a+|b)*', 'AB', '0,1', ascii(('AB', 'B'))), + ('(?i)(a+|b){0,}', 'AB', '0,1', ascii(('AB', 'B'))), + ('(?i)(a+|b)+', 'AB', '0,1', ascii(('AB', 'B'))), + ('(?i)(a+|b){1,}', 'AB', '0,1', ascii(('AB', 'B'))), + ('(?i)(a+|b)?', 'AB', '0,1', ascii(('A', 'A'))), + + ('(?i)(a+|b){0,1}', 'AB', '0,1', ascii(('A', 'A'))), + ('(?i)(a+|b){0,1}?', 'AB', '0,1', ascii(('', None))), + ('(?i))(', '-', '', regex.error, self.TRAILING_CHARS), + ('(?i)[^ab]*', 'CDE', '0', ascii('CDE')), + ('(?i)abc', '', '', ascii(None)), + ('(?i)a*', '', '0', ascii('')), + ('(?i)([abc])*d', 'ABBBCD', '0,1', ascii(('ABBBCD', 'C'))), + ('(?i)([abc])*bcd', 'ABCD', '0,1', ascii(('ABCD', 'A'))), + ('(?i)a|b|c|d|e', 'E', '0', ascii('E')), + ('(?i)(a|b|c|d|e)f', 'EF', '0,1', ascii(('EF', 'E'))), + + ('(?i)abcd*efg', 'ABCDEFG', '0', ascii('ABCDEFG')), + ('(?i)ab*', 'XABYABBBZ', '0', ascii('AB')), + ('(?i)ab*', 'XAYABBBZ', '0', ascii('A')), + ('(?i)(ab|cd)e', 'ABCDE', '0,1', ascii(('CDE', 'CD'))), + ('(?i)[abhgefdc]ij', 'HIJ', '0', ascii('HIJ')), + ('(?i)^(ab|cd)e', 'ABCDE', '', ascii(None)), + ('(?i)(abc|)ef', 'ABCDEF', '0,1', ascii(('EF', ''))), + ('(?i)(a|b)c*d', 'ABCD', '0,1', ascii(('BCD', 'B'))), + ('(?i)(ab|ab*)bc', 'ABC', '0,1', ascii(('ABC', 'A'))), + ('(?i)a([bc]*)c*', 'ABC', '0,1', ascii(('ABC', 'BC'))), + + ('(?i)a([bc]*)(c*d)', 'ABCD', '0,1,2', ascii(('ABCD', 'BC', 'D'))), + ('(?i)a([bc]+)(c*d)', 'ABCD', '0,1,2', ascii(('ABCD', 'BC', 'D'))), + ('(?i)a([bc]*)(c+d)', 'ABCD', '0,1,2', ascii(('ABCD', 'B', 'CD'))), + ('(?i)a[bcd]*dcdcde', 'ADCDCDE', '0', ascii('ADCDCDE')), + ('(?i)a[bcd]+dcdcde', 'ADCDCDE', '', ascii(None)), + ('(?i)(ab|a)b*c', 'ABC', '0,1', ascii(('ABC', 'AB'))), + ('(?i)((a)(b)c)(d)', 'ABCD', '1,2,3,4', ascii(('ABC', 'A', 'B', + 'D'))), + ('(?i)[a-zA-Z_][a-zA-Z0-9_]*', 'ALPHA', '0', ascii('ALPHA')), + ('(?i)^a(bc+|b[eh])g|.h$', 'ABH', '0,1', ascii(('BH', None))), + ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'EFFGZ', '0,1,2', ascii(('EFFGZ', + 'EFFGZ', None))), + + ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'IJ', '0,1,2', ascii(('IJ', 'IJ', + 'J'))), + ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'EFFG', '', ascii(None)), + ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'BCDD', '', ascii(None)), + ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'REFFGZ', '0,1,2', ascii(('EFFGZ', + 'EFFGZ', None))), + ('(?i)((((((((((a))))))))))', 'A', '10', ascii('A')), + ('(?i)((((((((((a))))))))))\\10', 'AA', '0', ascii('AA')), + #('(?i)((((((((((a))))))))))\\41', 'AA', '', ascii(None)), + #('(?i)((((((((((a))))))))))\\41', 'A!', '0', ascii('A!')), + ('(?i)(((((((((a)))))))))', 'A', '0', ascii('A')), + ('(?i)(?:(?:(?:(?:(?:(?:(?:(?:(?:(a))))))))))', 'A', '1', + ascii('A')), + ('(?i)(?:(?:(?:(?:(?:(?:(?:(?:(?:(a|b|c))))))))))', 'C', '1', + ascii('C')), + ('(?i)multiple words of text', 'UH-UH', '', ascii(None)), + + ('(?i)multiple words', 'MULTIPLE WORDS, YEAH', '0', + ascii('MULTIPLE WORDS')), + ('(?i)(.*)c(.*)', 'ABCDE', '0,1,2', ascii(('ABCDE', 'AB', 'DE'))), + ('(?i)\\((.*), (.*)\\)', '(A, B)', '2,1', ascii(('B', 'A'))), + ('(?i)[k]', 'AB', '', ascii(None)), + # ('(?i)abcd', 'ABCD', SUCCEED, 'found+"-"+\\found+"-"+\\\\found', ascii(ABCD-$&-\\ABCD)), + # ('(?i)a(bc)d', 'ABCD', SUCCEED, 'g1+"-"+\\g1+"-"+\\\\g1', ascii(BC-$1-\\BC)), + ('(?i)a[-]?c', 'AC', '0', ascii('AC')), + ('(?i)(abc)\\1', 'ABCABC', '1', ascii('ABC')), + ('(?i)([a-c]*)\\1', 'ABCABC', '1', ascii('ABC')), + ('a(?!b).', 'abad', '0', ascii('ad')), + ('a(?=d).', 'abad', '0', ascii('ad')), + ('a(?=c|d).', 'abad', '0', ascii('ad')), + + ('a(?:b|c|d)(.)', 'ace', '1', ascii('e')), + ('a(?:b|c|d)*(.)', 'ace', '1', ascii('e')), + ('a(?:b|c|d)+?(.)', 'ace', '1', ascii('e')), + ('a(?:b|(c|e){1,2}?|d)+?(.)', 'ace', '1,2', ascii(('c', 'e'))), + + # Lookbehind: split by : but not if it is escaped by -. + ('(?<!-):(.*?)(?<!-):', 'a:bc-:de:f', '1', ascii('bc-:de')), + # Escaping with \ as we know it. + ('(?<!\\\\):(.*?)(?<!\\\\):', 'a:bc\\:de:f', '1', ascii('bc\\:de')), + # Terminating with ' and escaping with ? as in edifact. + ("(?<!\\?)'(.*?)(?<!\\?)'", "a'bc?'de'f", '1', ascii("bc?'de")), + + # Comments using the (?#...) syntax. + + ('w(?# comment', 'w', '', regex.error, self.MISSING_RPAREN), + ('w(?# comment 1)xy(?# comment 2)z', 'wxyz', '0', ascii('wxyz')), + + # Check odd placement of embedded pattern modifiers. + + # Not an error under PCRE/PRE: + # When the new behaviour is turned on positional inline flags affect + # only what follows. + ('w(?i)', 'W', '0', ascii(None)), + ('w(?i)', 'w', '0', ascii('w')), + ('(?i)w', 'W', '0', ascii('W')), + + # Comments using the x embedded pattern modifier. + ("""(?x)w# comment 1 +x y +# comment 2 +z""", 'wxyz', '0', ascii('wxyz')), + + # Using the m embedded pattern modifier. + ('^abc', """jkl +abc +xyz""", '', ascii(None)), + ('(?m)^abc', """jkl +abc +xyz""", '0', ascii('abc')), + + ('(?m)abc$', """jkl +xyzabc +123""", '0', ascii('abc')), + + # Using the s embedded pattern modifier. + ('a.b', 'a\nb', '', ascii(None)), + ('(?s)a.b', 'a\nb', '0', ascii('a\nb')), + + # Test \w, etc. both inside and outside character classes. + ('\\w+', '--ab_cd0123--', '0', ascii('ab_cd0123')), + ('[\\w]+', '--ab_cd0123--', '0', ascii('ab_cd0123')), + ('\\D+', '1234abc5678', '0', ascii('abc')), + ('[\\D]+', '1234abc5678', '0', ascii('abc')), + ('[\\da-fA-F]+', '123abc', '0', ascii('123abc')), + # Not an error under PCRE/PRE: + # ('[\\d-x]', '-', '', regex.error, self.BAD_CHAR_RANGE), + (r'([\s]*)([\S]*)([\s]*)', ' testing!1972', '3,2,1', ascii(('', + 'testing!1972', ' '))), + (r'(\s*)(\S*)(\s*)', ' testing!1972', '3,2,1', ascii(('', + 'testing!1972', ' '))), + + # + # Post-1.5.2 additions. + + # xmllib problem. + (r'(([a-z]+):)?([a-z]+)$', 'smil', '1,2,3', ascii((None, None, + 'smil'))), + # Bug 110866: reference to undefined group. + (r'((.)\1+)', '', '', regex.error, self.OPEN_GROUP), + # Bug 111869: search (PRE/PCRE fails on this one, SRE doesn't). + (r'.*d', 'abc\nabd', '0', ascii('abd')), + # Bug 112468: various expected syntax errors. + (r'(', '', '', regex.error, self.MISSING_RPAREN), + (r'[\41]', '!', '0', ascii('!')), + # Bug 114033: nothing to repeat. + (r'(x?)?', 'x', '0', ascii('x')), + # Bug 115040: rescan if flags are modified inside pattern. + # Changed to positional flags in regex 2023.12.23. + (r' (?x)foo ', 'foo', '0', ascii(None)), + (r'(?x) foo ', 'foo', '0', ascii('foo')), + (r'(?x)foo ', 'foo', '0', ascii('foo')), + # Bug 115618: negative lookahead. + (r'(?<!abc)(d.f)', 'abcdefdof', '0', ascii('dof')), + # Bug 116251: character class bug. + (r'[\w-]+', 'laser_beam', '0', ascii('laser_beam')), + # Bug 123769+127259: non-greedy backtracking bug. + (r'.*?\S *:', 'xx:', '0', ascii('xx:')), + (r'a[ ]*?\ (\d+).*', 'a 10', '0', ascii('a 10')), + (r'a[ ]*?\ (\d+).*', 'a 10', '0', ascii('a 10')), + # Bug 127259: \Z shouldn't depend on multiline mode. + (r'(?ms).*?x\s*\Z(.*)','xx\nx\n', '1', ascii('')), + # Bug 128899: uppercase literals under the ignorecase flag. + (r'(?i)M+', 'MMM', '0', ascii('MMM')), + (r'(?i)m+', 'MMM', '0', ascii('MMM')), + (r'(?i)[M]+', 'MMM', '0', ascii('MMM')), + (r'(?i)[m]+', 'MMM', '0', ascii('MMM')), + # Bug 130748: ^* should be an error (nothing to repeat). + # In 'regex' we won't bother to complain about this. + # (r'^*', '', '', regex.error, self.NOTHING_TO_REPEAT), + # Bug 133283: minimizing repeat problem. + (r'"(?:\\"|[^"])*?"', r'"\""', '0', ascii(r'"\""')), + # Bug 477728: minimizing repeat problem. + (r'^.*?$', 'one\ntwo\nthree\n', '', ascii(None)), + # Bug 483789: minimizing repeat problem. + (r'a[^>]*?b', 'a>b', '', ascii(None)), + # Bug 490573: minimizing repeat problem. + (r'^a*?$', 'foo', '', ascii(None)), + # Bug 470582: nested groups problem. + (r'^((a)c)?(ab)$', 'ab', '1,2,3', ascii((None, None, 'ab'))), + # Another minimizing repeat problem (capturing groups in assertions). + ('^([ab]*?)(?=(b)?)c', 'abc', '1,2', ascii(('ab', None))), + ('^([ab]*?)(?!(b))c', 'abc', '1,2', ascii(('ab', None))), + ('^([ab]*?)(?<!(a))c', 'abc', '1,2', ascii(('ab', None))), + # Bug 410271: \b broken under locales. + (r'\b.\b', 'a', '0', ascii('a')), + (r'\b.\b', '\N{LATIN CAPITAL LETTER A WITH DIAERESIS}', '0', + ascii('\xc4')), + (r'\w', '\N{LATIN CAPITAL LETTER A WITH DIAERESIS}', '0', + ascii('\xc4')), + ] + + for t in tests: + excval = None + try: + if len(t) == 4: + pattern, string, groups, expected = t + else: + pattern, string, groups, expected, excval = t + except ValueError: + fields = ", ".join([ascii(f) for f in t[ : 3]] + ["..."]) + self.fail("Incorrect number of test fields: ({})".format(fields)) + else: + group_list = [] + if groups: + for group in groups.split(","): + try: + group_list.append(int(group)) + except ValueError: + group_list.append(group) + + if excval is not None: + with self.subTest(pattern=pattern, string=string): + self.assertRaisesRegex(expected, excval, regex.search, + pattern, string) + else: + m = regex.search(pattern, string) + if m: + if group_list: + actual = ascii(m.group(*group_list)) + else: + actual = ascii(m[:]) + else: + actual = ascii(m) + + self.assertEqual(actual, expected) + + def test_replacement(self): + self.assertEqual(regex.sub(r"test\?", "result\\?\\.\a\n", "test?"), + "result\\?\\.\a\n") + + self.assertEqual(regex.sub('(.)', r"\1\1", 'x'), 'xx') + self.assertEqual(regex.sub('(.)', regex.escape(r"\1\1"), 'x'), r"\1\1") + self.assertEqual(regex.sub('(.)', r"\\1\\1", 'x'), r"\1\1") + self.assertEqual(regex.sub('(.)', lambda m: r"\1\1", 'x'), r"\1\1") + + def test_common_prefix(self): + # Very long common prefix + all = string.ascii_lowercase + string.digits + string.ascii_uppercase + side = all * 4 + regexp = '(' + side + '|' + side + ')' + self.assertEqual(repr(type(regex.compile(regexp))), self.PATTERN_CLASS) + + def test_captures(self): + self.assertEqual(regex.search(r"(\w)+", "abc").captures(1), ['a', 'b', + 'c']) + self.assertEqual(regex.search(r"(\w{3})+", "abcdef").captures(0, 1), + (['abcdef'], ['abc', 'def'])) + self.assertEqual(regex.search(r"^(\d{1,3})(?:\.(\d{1,3})){3}$", + "192.168.0.1").captures(1, 2), (['192', ], ['168', '0', '1'])) + self.assertEqual(regex.match(r"^([0-9A-F]{2}){4} ([a-z]\d){5}$", + "3FB52A0C a2c4g3k9d3").captures(1, 2), (['3F', 'B5', '2A', '0C'], + ['a2', 'c4', 'g3', 'k9', 'd3'])) + self.assertEqual(regex.match("([a-z]W)([a-z]X)+([a-z]Y)", + "aWbXcXdXeXfY").captures(1, 2, 3), (['aW'], ['bX', 'cX', 'dX', 'eX'], + ['fY'])) + + self.assertEqual(regex.search(r".*?(?=(.)+)b", "ab").captures(1), + ['b']) + self.assertEqual(regex.search(r".*?(?>(.){0,2})d", "abcd").captures(1), + ['b', 'c']) + self.assertEqual(regex.search(r"(.)+", "a").captures(1), ['a']) + + def test_guards(self): + m = regex.search(r"(X.*?Y\s*){3}(X\s*)+AB:", + "XY\nX Y\nX Y\nXY\nXX AB:") + self.assertEqual(m.span(0, 1, 2), ((3, 21), (12, 15), (16, 18))) + + m = regex.search(r"(X.*?Y\s*){3,}(X\s*)+AB:", + "XY\nX Y\nX Y\nXY\nXX AB:") + self.assertEqual(m.span(0, 1, 2), ((0, 21), (12, 15), (16, 18))) + + m = regex.search(r'\d{4}(\s*\w)?\W*((?!\d)\w){2}', "9999XX") + self.assertEqual(m.span(0, 1, 2), ((0, 6), (-1, -1), (5, 6))) + + m = regex.search(r'A\s*?.*?(\n+.*?\s*?){0,2}\(X', 'A\n1\nS\n1 (X') + self.assertEqual(m.span(0, 1), ((0, 10), (5, 8))) + + m = regex.search(r'Derde\s*:', 'aaaaaa:\nDerde:') + self.assertEqual(m.span(), (8, 14)) + m = regex.search(r'Derde\s*:', 'aaaaa:\nDerde:') + self.assertEqual(m.span(), (7, 13)) + + def test_turkic(self): + # Turkish has dotted and dotless I/i. + pairs = "I=i;I=\u0131;i=\u0130" + + all_chars = set() + matching = set() + for pair in pairs.split(";"): + ch1, ch2 = pair.split("=") + all_chars.update((ch1, ch2)) + matching.add((ch1, ch1)) + matching.add((ch1, ch2)) + matching.add((ch2, ch1)) + matching.add((ch2, ch2)) + + for ch1 in all_chars: + for ch2 in all_chars: + m = regex.match(r"(?i)\A" + ch1 + r"\Z", ch2) + if m: + if (ch1, ch2) not in matching: + self.fail("{} matching {}".format(ascii(ch1), + ascii(ch2))) + else: + if (ch1, ch2) in matching: + self.fail("{} not matching {}".format(ascii(ch1), + ascii(ch2))) + + def test_named_lists(self): + options = ["one", "two", "three"] + self.assertEqual(regex.match(r"333\L<bar>444", "333one444", + bar=options).group(), "333one444") + self.assertEqual(regex.match(r"(?i)333\L<bar>444", "333TWO444", + bar=options).group(), "333TWO444") + self.assertEqual(regex.match(r"333\L<bar>444", "333four444", + bar=options), None) + + options = [b"one", b"two", b"three"] + self.assertEqual(regex.match(br"333\L<bar>444", b"333one444", + bar=options).group(), b"333one444") + self.assertEqual(regex.match(br"(?i)333\L<bar>444", b"333TWO444", + bar=options).group(), b"333TWO444") + self.assertEqual(regex.match(br"333\L<bar>444", b"333four444", + bar=options), None) + + self.assertEqual(repr(type(regex.compile(r"3\L<bar>4\L<bar>+5", + bar=["one", "two", "three"]))), self.PATTERN_CLASS) + + self.assertEqual(regex.findall(r"^\L<options>", "solid QWERT", + options=set(['good', 'brilliant', '+s\\ol[i}d'])), []) + self.assertEqual(regex.findall(r"^\L<options>", "+solid QWERT", + options=set(['good', 'brilliant', '+solid'])), ['+solid']) + + options = ["STRASSE"] + self.assertEqual(regex.match(r"(?fi)\L<words>", + "stra\N{LATIN SMALL LETTER SHARP S}e", words=options).span(), (0, + 6)) + + options = ["STRASSE", "stress"] + self.assertEqual(regex.match(r"(?fi)\L<words>", + "stra\N{LATIN SMALL LETTER SHARP S}e", words=options).span(), (0, + 6)) + + options = ["stra\N{LATIN SMALL LETTER SHARP S}e"] + self.assertEqual(regex.match(r"(?fi)\L<words>", "STRASSE", + words=options).span(), (0, 7)) + + options = ["kit"] + self.assertEqual(regex.search(r"(?i)\L<words>", "SKITS", + words=options).span(), (1, 4)) + self.assertEqual(regex.search(r"(?i)\L<words>", + "SK\N{LATIN CAPITAL LETTER I WITH DOT ABOVE}TS", + words=options).span(), (1, 4)) + + self.assertEqual(regex.search(r"(?fi)\b(\w+) +\1\b", + " stra\N{LATIN SMALL LETTER SHARP S}e STRASSE ").span(), (1, 15)) + self.assertEqual(regex.search(r"(?fi)\b(\w+) +\1\b", + " STRASSE stra\N{LATIN SMALL LETTER SHARP S}e ").span(), (1, 15)) + + self.assertEqual(regex.search(r"^\L<options>$", "", options=[]).span(), + (0, 0)) + + def test_fuzzy(self): + # Some tests borrowed from TRE library tests. + self.assertEqual(repr(type(regex.compile('(fou){s,e<=1}'))), + self.PATTERN_CLASS) + self.assertEqual(repr(type(regex.compile('(fuu){s}'))), + self.PATTERN_CLASS) + self.assertEqual(repr(type(regex.compile('(fuu){s,e}'))), + self.PATTERN_CLASS) + self.assertEqual(repr(type(regex.compile('(anaconda){1i+1d<1,s<=1}'))), + self.PATTERN_CLASS) + self.assertEqual(repr(type(regex.compile('(anaconda){1i+1d<1,s<=1,e<=10}'))), + self.PATTERN_CLASS) + self.assertEqual(repr(type(regex.compile('(anaconda){s<=1,e<=1,1i+1d<1}'))), + self.PATTERN_CLASS) + + text = 'molasses anaconda foo bar baz smith anderson ' + self.assertEqual(regex.search('(znacnda){s<=1,e<=3,1i+1d<1}', text), + None) + self.assertEqual(regex.search('(znacnda){s<=1,e<=3,1i+1d<2}', + text).span(0, 1), ((9, 17), (9, 17))) + self.assertEqual(regex.search('(ananda){1i+1d<2}', text), None) + self.assertEqual(regex.search(r"(?:\bznacnda){e<=2}", text)[0], + "anaconda") + self.assertEqual(regex.search(r"(?:\bnacnda){e<=2}", text)[0], + "anaconda") + + text = 'anaconda foo bar baz smith anderson' + self.assertEqual(regex.search('(fuu){i<=3,d<=3,e<=5}', text).span(0, + 1), ((0, 0), (0, 0))) + self.assertEqual(regex.search('(?b)(fuu){i<=3,d<=3,e<=5}', + text).span(0, 1), ((9, 10), (9, 10))) + self.assertEqual(regex.search('(fuu){i<=2,d<=2,e<=5}', text).span(0, + 1), ((7, 10), (7, 10))) + self.assertEqual(regex.search('(?e)(fuu){i<=2,d<=2,e<=5}', + text).span(0, 1), ((9, 10), (9, 10))) + self.assertEqual(regex.search('(fuu){i<=3,d<=3,e}', text).span(0, 1), + ((0, 0), (0, 0))) + self.assertEqual(regex.search('(?b)(fuu){i<=3,d<=3,e}', text).span(0, + 1), ((9, 10), (9, 10))) + + self.assertEqual(repr(type(regex.compile('(approximate){s<=3,1i+1d<3}'))), + self.PATTERN_CLASS) + + # No cost limit. + self.assertEqual(regex.search('(foobar){e}', + 'xirefoabralfobarxie').span(0, 1), ((0, 6), (0, 6))) + self.assertEqual(regex.search('(?e)(foobar){e}', + 'xirefoabralfobarxie').span(0, 1), ((0, 3), (0, 3))) + self.assertEqual(regex.search('(?b)(foobar){e}', + 'xirefoabralfobarxie').span(0, 1), ((11, 16), (11, 16))) + + # At most two errors. + self.assertEqual(regex.search('(foobar){e<=2}', + 'xirefoabrzlfd').span(0, 1), ((4, 9), (4, 9))) + self.assertEqual(regex.search('(foobar){e<=2}', 'xirefoabzlfd'), None) + + # At most two inserts or substitutions and max two errors total. + self.assertEqual(regex.search('(foobar){i<=2,s<=2,e<=2}', + 'oobargoobaploowap').span(0, 1), ((5, 11), (5, 11))) + + # Find best whole word match for "foobar". + self.assertEqual(regex.search('\\b(foobar){e}\\b', 'zfoobarz').span(0, + 1), ((0, 8), (0, 8))) + self.assertEqual(regex.search('\\b(foobar){e}\\b', + 'boing zfoobarz goobar woop').span(0, 1), ((0, 6), (0, 6))) + self.assertEqual(regex.search('(?b)\\b(foobar){e}\\b', + 'boing zfoobarz goobar woop').span(0, 1), ((15, 21), (15, 21))) + + # Match whole string, allow only 1 error. + self.assertEqual(regex.search('^(foobar){e<=1}$', 'foobar').span(0, 1), + ((0, 6), (0, 6))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'xfoobar').span(0, + 1), ((0, 7), (0, 7))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'foobarx').span(0, + 1), ((0, 7), (0, 7))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'fooxbar').span(0, + 1), ((0, 7), (0, 7))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'foxbar').span(0, 1), + ((0, 6), (0, 6))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'xoobar').span(0, 1), + ((0, 6), (0, 6))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'foobax').span(0, 1), + ((0, 6), (0, 6))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'oobar').span(0, 1), + ((0, 5), (0, 5))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'fobar').span(0, 1), + ((0, 5), (0, 5))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'fooba').span(0, 1), + ((0, 5), (0, 5))) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'xfoobarx'), None) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'foobarxx'), None) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'xxfoobar'), None) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'xfoxbar'), None) + self.assertEqual(regex.search('^(foobar){e<=1}$', 'foxbarx'), None) + + # At most one insert, two deletes, and three substitutions. + # Additionally, deletes cost two and substitutes one, and total + # cost must be less than 4. + self.assertEqual(regex.search('(foobar){i<=1,d<=2,s<=3,2d+1s<4}', + '3oifaowefbaoraofuiebofasebfaobfaorfeoaro').span(0, 1), ((6, 13), (6, + 13))) + self.assertEqual(regex.search('(?b)(foobar){i<=1,d<=2,s<=3,2d+1s<4}', + '3oifaowefbaoraofuiebofasebfaobfaorfeoaro').span(0, 1), ((34, 39), + (34, 39))) + + # Partially fuzzy matches. + self.assertEqual(regex.search('foo(bar){e<=1}zap', 'foobarzap').span(0, + 1), ((0, 9), (3, 6))) + self.assertEqual(regex.search('foo(bar){e<=1}zap', 'fobarzap'), None) + self.assertEqual(regex.search('foo(bar){e<=1}zap', 'foobrzap').span(0, + 1), ((0, 8), (3, 5))) + + text = ('www.cnn.com 64.236.16.20\nwww.slashdot.org 66.35.250.150\n' + 'For useful information, use www.slashdot.org\nthis is demo data!\n') + self.assertEqual(regex.search(r'(?s)^.*(dot.org){e}.*$', text).span(0, + 1), ((0, 120), (120, 120))) + self.assertEqual(regex.search(r'(?es)^.*(dot.org){e}.*$', text).span(0, + 1), ((0, 120), (93, 100))) + self.assertEqual(regex.search(r'^.*(dot.org){e}.*$', text).span(0, 1), + ((0, 119), (24, 101))) + + # Behaviour is unexpected, but arguably not wrong. It first finds the + # best match, then the best in what follows, etc. + self.assertEqual(regex.findall(r"\b\L<words>{e<=1}\b", + " book cot dog desk ", words="cat dog".split()), ["cot", "dog"]) + self.assertEqual(regex.findall(r"\b\L<words>{e<=1}\b", + " book dog cot desk ", words="cat dog".split()), [" dog", "cot"]) + self.assertEqual(regex.findall(r"(?e)\b\L<words>{e<=1}\b", + " book dog cot desk ", words="cat dog".split()), ["dog", "cot"]) + self.assertEqual(regex.findall(r"(?r)\b\L<words>{e<=1}\b", + " book cot dog desk ", words="cat dog".split()), ["dog ", "cot"]) + self.assertEqual(regex.findall(r"(?er)\b\L<words>{e<=1}\b", + " book cot dog desk ", words="cat dog".split()), ["dog", "cot"]) + self.assertEqual(regex.findall(r"(?r)\b\L<words>{e<=1}\b", + " book dog cot desk ", words="cat dog".split()), ["cot", "dog"]) + self.assertEqual(regex.findall(br"\b\L<words>{e<=1}\b", + b" book cot dog desk ", words=b"cat dog".split()), [b"cot", b"dog"]) + self.assertEqual(regex.findall(br"\b\L<words>{e<=1}\b", + b" book dog cot desk ", words=b"cat dog".split()), [b" dog", b"cot"]) + self.assertEqual(regex.findall(br"(?e)\b\L<words>{e<=1}\b", + b" book dog cot desk ", words=b"cat dog".split()), [b"dog", b"cot"]) + self.assertEqual(regex.findall(br"(?r)\b\L<words>{e<=1}\b", + b" book cot dog desk ", words=b"cat dog".split()), [b"dog ", b"cot"]) + self.assertEqual(regex.findall(br"(?er)\b\L<words>{e<=1}\b", + b" book cot dog desk ", words=b"cat dog".split()), [b"dog", b"cot"]) + self.assertEqual(regex.findall(br"(?r)\b\L<words>{e<=1}\b", + b" book dog cot desk ", words=b"cat dog".split()), [b"cot", b"dog"]) + + self.assertEqual(regex.search(r"(\w+) (\1{e<=1})", "foo fou").groups(), + ("foo", "fou")) + self.assertEqual(regex.search(r"(?r)(\2{e<=1}) (\w+)", + "foo fou").groups(), ("foo", "fou")) + self.assertEqual(regex.search(br"(\w+) (\1{e<=1})", + b"foo fou").groups(), (b"foo", b"fou")) + + self.assertEqual(regex.findall(r"(?:(?:QR)+){e}", "abcde"), ["abcde", + ""]) + self.assertEqual(regex.findall(r"(?:Q+){e}", "abc"), ["abc", ""]) + + # Hg issue 41: = for fuzzy matches + self.assertEqual(regex.match(r"(?:service detection){0<e<5}", + "servic detection").span(), (0, 16)) + self.assertEqual(regex.match(r"(?:service detection){0<e<5}", + "service detect").span(), (0, 14)) + self.assertEqual(regex.match(r"(?:service detection){0<e<5}", + "service detecti").span(), (0, 15)) + self.assertEqual(regex.match(r"(?:service detection){0<e<5}", + "service detection"), None) + self.assertEqual(regex.match(r"(?:service detection){0<e<5}", + "in service detection").span(), (0, 20)) + + # Hg issue 109: Edit distance of fuzzy match + self.assertEqual(regex.fullmatch(r"(?:cats|cat){e<=1}", + "cat").fuzzy_counts, (0, 0, 1)) + self.assertEqual(regex.fullmatch(r"(?e)(?:cats|cat){e<=1}", + "cat").fuzzy_counts, (0, 0, 0)) + + self.assertEqual(regex.fullmatch(r"(?:cat|cats){e<=1}", + "cats").fuzzy_counts, (0, 1, 0)) + self.assertEqual(regex.fullmatch(r"(?e)(?:cat|cats){e<=1}", + "cats").fuzzy_counts, (0, 0, 0)) + + self.assertEqual(regex.fullmatch(r"(?:cat){e<=1} (?:cat){e<=1}", + "cat cot").fuzzy_counts, (1, 0, 0)) + + # Incorrect fuzzy changes + self.assertEqual(regex.search(r"(?e)(GTTTTCATTCCTCATA){i<=4,d<=4,s<=4,i+d+s<=8}", + "ATTATTTATTTTTCATA").fuzzy_changes, ([0, 6, 10, 11], [3], [])) + + # Fuzzy constraints ignored when checking for prefix/suffix in branches + self.assertEqual(bool(regex.match('(?:fo){e<=1}|(?:fo){e<=2}', 'FO')), + True) + + def test_recursive(self): + self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "xx")[ : ], + ("xx", "x", "")) + self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "aba")[ : ], + ("aba", "a", "b")) + self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "abba")[ : ], + ("abba", "a", None)) + self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "kayak")[ : ], + ("kayak", "k", None)) + self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "paper")[ : ], + ("pap", "p", "a")) + self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "dontmatchme"), + None) + + self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "xx")[ : ], + ("xx", "", "x")) + self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "aba")[ : ], + ("aba", "b", "a")) + self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "abba")[ : + ], ("abba", None, "a")) + self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "kayak")[ : + ], ("kayak", None, "k")) + self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "paper")[ : + ], ("pap", "a", "p")) + self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", + "dontmatchme"), None) + + self.assertEqual(regex.search(r"\(((?>[^()]+)|(?R))*\)", "(ab(cd)ef)")[ + : ], ("(ab(cd)ef)", "ef")) + self.assertEqual(regex.search(r"\(((?>[^()]+)|(?R))*\)", + "(ab(cd)ef)").captures(1), ["ab", "cd", "(cd)", "ef"]) + + self.assertEqual(regex.search(r"(?r)\(((?R)|(?>[^()]+))*\)", + "(ab(cd)ef)")[ : ], ("(ab(cd)ef)", "ab")) + self.assertEqual(regex.search(r"(?r)\(((?R)|(?>[^()]+))*\)", + "(ab(cd)ef)").captures(1), ["ef", "cd", "(cd)", "ab"]) + + self.assertEqual(regex.search(r"\(([^()]+|(?R))*\)", + "some text (a(b(c)d)e) more text")[ : ], ("(a(b(c)d)e)", "e")) + + self.assertEqual(regex.search(r"(?r)\(((?R)|[^()]+)*\)", + "some text (a(b(c)d)e) more text")[ : ], ("(a(b(c)d)e)", "a")) + + self.assertEqual(regex.search(r"(foo(\(((?:(?>[^()]+)|(?2))*)\)))", + "foo(bar(baz)+baz(bop))")[ : ], ("foo(bar(baz)+baz(bop))", + "foo(bar(baz)+baz(bop))", "(bar(baz)+baz(bop))", + "bar(baz)+baz(bop)")) + + self.assertEqual(regex.search(r"(?r)(foo(\(((?:(?2)|(?>[^()]+))*)\)))", + "foo(bar(baz)+baz(bop))")[ : ], ("foo(bar(baz)+baz(bop))", + "foo(bar(baz)+baz(bop))", "(bar(baz)+baz(bop))", + "bar(baz)+baz(bop)")) + + rgx = regex.compile(r"""^\s*(<\s*([a-zA-Z:]+)(?:\s*[a-zA-Z:]*\s*=\s*(?:'[^']*'|"[^"]*"))*\s*(/\s*)?>(?:[^<>]*|(?1))*(?(3)|<\s*/\s*\2\s*>))\s*$""") + self.assertEqual(bool(rgx.search('<foo><bar></bar></foo>')), True) + self.assertEqual(bool(rgx.search('<foo><bar></foo></bar>')), False) + self.assertEqual(bool(rgx.search('<foo><bar/></foo>')), True) + self.assertEqual(bool(rgx.search('<foo><bar></foo>')), False) + self.assertEqual(bool(rgx.search('<foo bar=baz/>')), False) + + self.assertEqual(bool(rgx.search('<foo bar="baz">')), False) + self.assertEqual(bool(rgx.search('<foo bar="baz"/>')), True) + self.assertEqual(bool(rgx.search('< fooo / >')), True) + # The next regex should and does match. Perl 5.14 agrees. + #self.assertEqual(bool(rgx.search('<foo/>foo')), False) + self.assertEqual(bool(rgx.search('foo<foo/>')), False) + + self.assertEqual(bool(rgx.search('<foo>foo</foo>')), True) + self.assertEqual(bool(rgx.search('<foo><bar/>foo</foo>')), True) + self.assertEqual(bool(rgx.search('<a><b><c></c></b></a>')), True) + + def test_copy(self): + # PatternObjects are immutable, therefore there's no need to clone them. + r = regex.compile("a") + self.assertTrue(copy.copy(r) is r) + self.assertTrue(copy.deepcopy(r) is r) + + # MatchObjects are normally mutable because the target string can be + # detached. However, after the target string has been detached, a + # MatchObject becomes immutable, so there's no need to clone it. + m = r.match("a") + self.assertTrue(copy.copy(m) is not m) + self.assertTrue(copy.deepcopy(m) is not m) + + self.assertTrue(m.string is not None) + m2 = copy.copy(m) + m2.detach_string() + self.assertTrue(m.string is not None) + self.assertTrue(m2.string is None) + + # The following behaviour matches that of the re module. + it = regex.finditer(".", "ab") + it2 = copy.copy(it) + self.assertEqual(next(it).group(), "a") + self.assertEqual(next(it2).group(), "b") + + # The following behaviour matches that of the re module. + it = regex.finditer(".", "ab") + it2 = copy.deepcopy(it) + self.assertEqual(next(it).group(), "a") + self.assertEqual(next(it2).group(), "b") + + # The following behaviour is designed to match that of copying 'finditer'. + it = regex.splititer(" ", "a b") + it2 = copy.copy(it) + self.assertEqual(next(it), "a") + self.assertEqual(next(it2), "b") + + # The following behaviour is designed to match that of copying 'finditer'. + it = regex.splititer(" ", "a b") + it2 = copy.deepcopy(it) + self.assertEqual(next(it), "a") + self.assertEqual(next(it2), "b") + + def test_format(self): + self.assertEqual(regex.subf(r"(\w+) (\w+)", "{0} => {2} {1}", + "foo bar"), "foo bar => bar foo") + self.assertEqual(regex.subf(r"(?<word1>\w+) (?<word2>\w+)", + "{word2} {word1}", "foo bar"), "bar foo") + + self.assertEqual(regex.subfn(r"(\w+) (\w+)", "{0} => {2} {1}", + "foo bar"), ("foo bar => bar foo", 1)) + self.assertEqual(regex.subfn(r"(?<word1>\w+) (?<word2>\w+)", + "{word2} {word1}", "foo bar"), ("bar foo", 1)) + + self.assertEqual(regex.match(r"(\w+) (\w+)", + "foo bar").expandf("{0} => {2} {1}"), "foo bar => bar foo") + + def test_fullmatch(self): + self.assertEqual(bool(regex.fullmatch(r"abc", "abc")), True) + self.assertEqual(bool(regex.fullmatch(r"abc", "abcx")), False) + self.assertEqual(bool(regex.fullmatch(r"abc", "abcx", endpos=3)), True) + + self.assertEqual(bool(regex.fullmatch(r"abc", "xabc", pos=1)), True) + self.assertEqual(bool(regex.fullmatch(r"abc", "xabcy", pos=1)), False) + self.assertEqual(bool(regex.fullmatch(r"abc", "xabcy", pos=1, + endpos=4)), True) + + self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "abc")), True) + self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "abcx")), False) + self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "abcx", endpos=3)), + True) + + self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "xabc", pos=1)), + True) + self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "xabcy", pos=1)), + False) + self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "xabcy", pos=1, + endpos=4)), True) + + def test_issue_18468(self): + self.assertTypedEqual(regex.sub('y', 'a', 'xyz'), 'xaz') + self.assertTypedEqual(regex.sub('y', StrSubclass('a'), + StrSubclass('xyz')), 'xaz') + self.assertTypedEqual(regex.sub(b'y', b'a', b'xyz'), b'xaz') + self.assertTypedEqual(regex.sub(b'y', BytesSubclass(b'a'), + BytesSubclass(b'xyz')), b'xaz') + self.assertTypedEqual(regex.sub(b'y', bytearray(b'a'), + bytearray(b'xyz')), b'xaz') + self.assertTypedEqual(regex.sub(b'y', memoryview(b'a'), + memoryview(b'xyz')), b'xaz') + + for string in ":a:b::c", StrSubclass(":a:b::c"): + self.assertTypedEqual(regex.split(":", string), ['', 'a', 'b', '', + 'c']) + if sys.version_info >= (3, 7, 0): + self.assertTypedEqual(regex.split(":*", string), ['', '', 'a', + '', 'b', '', 'c', '']) + self.assertTypedEqual(regex.split("(:*)", string), ['', ':', + '', '', 'a', ':', '', '', 'b', '::', '', '', 'c', '', '']) + else: + self.assertTypedEqual(regex.split(":*", string), ['', 'a', 'b', + 'c']) + self.assertTypedEqual(regex.split("(:*)", string), ['', ':', + 'a', ':', 'b', '::', 'c']) + + for string in (b":a:b::c", BytesSubclass(b":a:b::c"), + bytearray(b":a:b::c"), memoryview(b":a:b::c")): + self.assertTypedEqual(regex.split(b":", string), [b'', b'a', b'b', + b'', b'c']) + if sys.version_info >= (3, 7, 0): + self.assertTypedEqual(regex.split(b":*", string), [b'', b'', + b'a', b'', b'b', b'', b'c', b'']) + self.assertTypedEqual(regex.split(b"(:*)", string), [b'', b':', + b'', b'', b'a', b':', b'', b'', b'b', b'::', b'', b'', b'c', + b'', b'']) + else: + self.assertTypedEqual(regex.split(b":*", string), [b'', b'a', + b'b', b'c']) + self.assertTypedEqual(regex.split(b"(:*)", string), [b'', b':', + b'a', b':', b'b', b'::', b'c']) + + for string in "a:b::c:::d", StrSubclass("a:b::c:::d"): + self.assertTypedEqual(regex.findall(":+", string), [":", "::", + ":::"]) + self.assertTypedEqual(regex.findall("(:+)", string), [":", "::", + ":::"]) + self.assertTypedEqual(regex.findall("(:)(:*)", string), [(":", ""), + (":", ":"), (":", "::")]) + + for string in (b"a:b::c:::d", BytesSubclass(b"a:b::c:::d"), + bytearray(b"a:b::c:::d"), memoryview(b"a:b::c:::d")): + self.assertTypedEqual(regex.findall(b":+", string), [b":", b"::", + b":::"]) + self.assertTypedEqual(regex.findall(b"(:+)", string), [b":", b"::", + b":::"]) + self.assertTypedEqual(regex.findall(b"(:)(:*)", string), [(b":", + b""), (b":", b":"), (b":", b"::")]) + + for string in 'a', StrSubclass('a'): + self.assertEqual(regex.match('a', string).groups(), ()) + self.assertEqual(regex.match('(a)', string).groups(), ('a',)) + self.assertEqual(regex.match('(a)', string).group(0), 'a') + self.assertEqual(regex.match('(a)', string).group(1), 'a') + self.assertEqual(regex.match('(a)', string).group(1, 1), ('a', + 'a')) + + for string in (b'a', BytesSubclass(b'a'), bytearray(b'a'), + memoryview(b'a')): + self.assertEqual(regex.match(b'a', string).groups(), ()) + self.assertEqual(regex.match(b'(a)', string).groups(), (b'a',)) + self.assertEqual(regex.match(b'(a)', string).group(0), b'a') + self.assertEqual(regex.match(b'(a)', string).group(1), b'a') + self.assertEqual(regex.match(b'(a)', string).group(1, 1), (b'a', + b'a')) + + def test_partial(self): + self.assertEqual(regex.match('ab', 'a', partial=True).partial, True) + self.assertEqual(regex.match('ab', 'a', partial=True).span(), (0, 1)) + self.assertEqual(regex.match(r'cats', 'cat', partial=True).partial, + True) + self.assertEqual(regex.match(r'cats', 'cat', partial=True).span(), (0, + 3)) + self.assertEqual(regex.match(r'cats', 'catch', partial=True), None) + self.assertEqual(regex.match(r'abc\w{3}', 'abcdef', + partial=True).partial, False) + self.assertEqual(regex.match(r'abc\w{3}', 'abcdef', + partial=True).span(), (0, 6)) + self.assertEqual(regex.match(r'abc\w{3}', 'abcde', + partial=True).partial, True) + self.assertEqual(regex.match(r'abc\w{3}', 'abcde', + partial=True).span(), (0, 5)) + + self.assertEqual(regex.match(r'\d{4}$', '1234', partial=True).partial, + False) + + self.assertEqual(regex.match(r'\L<words>', 'post', partial=True, + words=['post']).partial, False) + self.assertEqual(regex.match(r'\L<words>', 'post', partial=True, + words=['post']).span(), (0, 4)) + self.assertEqual(regex.match(r'\L<words>', 'pos', partial=True, + words=['post']).partial, True) + self.assertEqual(regex.match(r'\L<words>', 'pos', partial=True, + words=['post']).span(), (0, 3)) + + self.assertEqual(regex.match(r'(?fi)\L<words>', 'POST', partial=True, + words=['po\uFB06']).partial, False) + self.assertEqual(regex.match(r'(?fi)\L<words>', 'POST', partial=True, + words=['po\uFB06']).span(), (0, 4)) + self.assertEqual(regex.match(r'(?fi)\L<words>', 'POS', partial=True, + words=['po\uFB06']).partial, True) + self.assertEqual(regex.match(r'(?fi)\L<words>', 'POS', partial=True, + words=['po\uFB06']).span(), (0, 3)) + self.assertEqual(regex.match(r'(?fi)\L<words>', 'po\uFB06', + partial=True, words=['POS']), None) + + self.assertEqual(regex.match(r'[a-z]*4R$', 'a', partial=True).span(), + (0, 1)) + self.assertEqual(regex.match(r'[a-z]*4R$', 'ab', partial=True).span(), + (0, 2)) + self.assertEqual(regex.match(r'[a-z]*4R$', 'ab4', partial=True).span(), + (0, 3)) + self.assertEqual(regex.match(r'[a-z]*4R$', 'a4', partial=True).span(), + (0, 2)) + self.assertEqual(regex.match(r'[a-z]*4R$', 'a4R', partial=True).span(), + (0, 3)) + self.assertEqual(regex.match(r'[a-z]*4R$', '4a', partial=True), None) + self.assertEqual(regex.match(r'[a-z]*4R$', 'a44', partial=True), None) + + def test_hg_bugs(self): + # Hg issue 28: regex.compile("(?>b)") causes "TypeError: 'Character' + # object is not subscriptable" + self.assertEqual(bool(regex.compile("(?>b)", flags=regex.V1)), True) + + # Hg issue 29: regex.compile("^((?>\w+)|(?>\s+))*$") causes + # "TypeError: 'GreedyRepeat' object is not iterable" + self.assertEqual(bool(regex.compile(r"^((?>\w+)|(?>\s+))*$", + flags=regex.V1)), True) + + # Hg issue 31: atomic and normal groups in recursive patterns + self.assertEqual(regex.findall(r"\((?:(?>[^()]+)|(?R))*\)", + "a(bcd(e)f)g(h)"), ['(bcd(e)f)', '(h)']) + self.assertEqual(regex.findall(r"\((?:(?:[^()]+)|(?R))*\)", + "a(bcd(e)f)g(h)"), ['(bcd(e)f)', '(h)']) + self.assertEqual(regex.findall(r"\((?:(?>[^()]+)|(?R))*\)", + "a(b(cd)e)f)g)h"), ['(b(cd)e)']) + self.assertEqual(regex.findall(r"\((?:(?>[^()]+)|(?R))*\)", + "a(bc(d(e)f)gh"), ['(d(e)f)']) + self.assertEqual(regex.findall(r"(?r)\((?:(?>[^()]+)|(?R))*\)", + "a(bc(d(e)f)gh"), ['(d(e)f)']) + self.assertEqual([m.group() for m in + regex.finditer(r"\((?:[^()]*+|(?0))*\)", "a(b(c(de)fg)h")], + ['(c(de)fg)']) + + # Hg issue 32: regex.search("a(bc)d", "abcd", regex.I|regex.V1) returns + # None + self.assertEqual(regex.search("a(bc)d", "abcd", regex.I | + regex.V1).group(0), "abcd") + + # Hg issue 33: regex.search("([\da-f:]+)$", "E", regex.I|regex.V1) + # returns None + self.assertEqual(regex.search(r"([\da-f:]+)$", "E", regex.I | + regex.V1).group(0), "E") + self.assertEqual(regex.search(r"([\da-f:]+)$", "e", regex.I | + regex.V1).group(0), "e") + + # Hg issue 34: regex.search("^(?=ab(de))(abd)(e)", "abde").groups() + # returns (None, 'abd', 'e') instead of ('de', 'abd', 'e') + self.assertEqual(regex.search("^(?=ab(de))(abd)(e)", "abde").groups(), + ('de', 'abd', 'e')) + + # Hg issue 35: regex.compile("\ ", regex.X) causes "_regex_core.error: + # bad escape" + self.assertEqual(bool(regex.match(r"\ ", " ", flags=regex.X)), True) + + # Hg issue 36: regex.search("^(a|)\1{2}b", "b") returns None + self.assertEqual(regex.search(r"^(a|)\1{2}b", "b").group(0, 1), ('b', + '')) + + # Hg issue 37: regex.search("^(a){0,0}", "abc").group(0,1) returns + # ('a', 'a') instead of ('', None) + self.assertEqual(regex.search("^(a){0,0}", "abc").group(0, 1), ('', + None)) + + # Hg issue 38: regex.search("(?>.*/)b", "a/b") returns None + self.assertEqual(regex.search("(?>.*/)b", "a/b").group(0), "a/b") + + # Hg issue 39: regex.search("((?i)blah)\\s+\\1", "blah BLAH") doesn't + # return None + # Changed to positional flags in regex 2023.12.23. + self.assertEqual(regex.search(r"((?i)blah)\s+\1", "blah BLAH"), None) + + # Hg issue 40: regex.search("(\()?[^()]+(?(1)\)|)", "(abcd").group(0) + # returns "bcd" instead of "abcd" + self.assertEqual(regex.search(r"(\()?[^()]+(?(1)\)|)", + "(abcd").group(0), "abcd") + + # Hg issue 42: regex.search("(a*)*", "a", flags=regex.V1).span(1) + # returns (0, 1) instead of (1, 1) + self.assertEqual(regex.search("(a*)*", "a").span(1), (1, 1)) + self.assertEqual(regex.search("(a*)*", "aa").span(1), (2, 2)) + self.assertEqual(regex.search("(a*)*", "aaa").span(1), (3, 3)) + + # Hg issue 43: regex.compile("a(?#xxx)*") causes "_regex_core.error: + # nothing to repeat" + self.assertEqual(regex.search("a(?#xxx)*", "aaa").group(), "aaa") + + # Hg issue 44: regex.compile("(?=abc){3}abc") causes + # "_regex_core.error: nothing to repeat" + self.assertEqual(regex.search("(?=abc){3}abc", "abcabcabc").span(), (0, + 3)) + + # Hg issue 45: regex.compile("^(?:a(?:(?:))+)+") causes + # "_regex_core.error: nothing to repeat" + self.assertEqual(regex.search("^(?:a(?:(?:))+)+", "a").span(), (0, 1)) + self.assertEqual(regex.search("^(?:a(?:(?:))+)+", "aa").span(), (0, 2)) + + # Hg issue 46: regex.compile("a(?x: b c )d") causes + # "_regex_core.error: missing )" + self.assertEqual(regex.search("a(?x: b c )d", "abcd").group(0), "abcd") + + # Hg issue 47: regex.compile("a#comment\n*", flags=regex.X) causes + # "_regex_core.error: nothing to repeat" + self.assertEqual(regex.search("a#comment\n*", "aaa", + flags=regex.X).group(0), "aaa") + + # Hg issue 48: regex.search("(a(?(1)\\1)){4}", "a"*10, + # flags=regex.V1).group(0,1) returns ('aaaaa', 'a') instead of ('aaaaaaaaaa', 'aaaa') + self.assertEqual(regex.search(r"(?V1)(a(?(1)\1)){1}", + "aaaaaaaaaa").span(0, 1), ((0, 1), (0, 1))) + self.assertEqual(regex.search(r"(?V1)(a(?(1)\1)){2}", + "aaaaaaaaaa").span(0, 1), ((0, 3), (1, 3))) + self.assertEqual(regex.search(r"(?V1)(a(?(1)\1)){3}", + "aaaaaaaaaa").span(0, 1), ((0, 6), (3, 6))) + self.assertEqual(regex.search(r"(?V1)(a(?(1)\1)){4}", + "aaaaaaaaaa").span(0, 1), ((0, 10), (6, 10))) + + # Hg issue 49: regex.search("(a)(?<=b(?1))", "baz", regex.V1) returns + # None incorrectly + self.assertEqual(regex.search("(?V1)(a)(?<=b(?1))", "baz").group(0), + "a") + + # Hg issue 50: not all keywords are found by named list with + # overlapping keywords when full Unicode casefolding is required + self.assertEqual(regex.findall(r'(?fi)\L<keywords>', + 'POST, Post, post, po\u017Ft, po\uFB06, and po\uFB05', + keywords=['post','pos']), ['POST', 'Post', 'post', 'po\u017Ft', + 'po\uFB06', 'po\uFB05']) + self.assertEqual(regex.findall(r'(?fi)pos|post', + 'POST, Post, post, po\u017Ft, po\uFB06, and po\uFB05'), ['POS', + 'Pos', 'pos', 'po\u017F', 'po\uFB06', 'po\uFB05']) + self.assertEqual(regex.findall(r'(?fi)post|pos', + 'POST, Post, post, po\u017Ft, po\uFB06, and po\uFB05'), ['POST', + 'Post', 'post', 'po\u017Ft', 'po\uFB06', 'po\uFB05']) + self.assertEqual(regex.findall(r'(?fi)post|another', + 'POST, Post, post, po\u017Ft, po\uFB06, and po\uFB05'), ['POST', + 'Post', 'post', 'po\u017Ft', 'po\uFB06', 'po\uFB05']) + + # Hg issue 51: regex.search("((a)(?1)|(?2))", "a", flags=regex.V1) + # returns None incorrectly + self.assertEqual(regex.search("(?V1)((a)(?1)|(?2))", "a").group(0, 1, + 2), ('a', 'a', None)) + + # Hg issue 52: regex.search("(\\1xx|){6}", "xx", + # flags=regex.V1).span(0,1) returns incorrect value + self.assertEqual(regex.search(r"(?V1)(\1xx|){6}", "xx").span(0, 1), + ((0, 2), (2, 2))) + + # Hg issue 53: regex.search("(a|)+", "a") causes MemoryError + self.assertEqual(regex.search("(a|)+", "a").group(0, 1), ("a", "")) + + # Hg issue 54: regex.search("(a|)*\\d", "a"*80) causes MemoryError + self.assertEqual(regex.search(r"(a|)*\d", "a" * 80), None) + + # Hg issue 55: regex.search("^(?:a?b?)*$", "ac") take a very long time. + self.assertEqual(regex.search("^(?:a?b?)*$", "ac"), None) + + # Hg issue 58: bad named character escape sequences like "\\N{1}" + # treats as "N" + self.assertRaisesRegex(regex.error, self.UNDEF_CHAR_NAME, lambda: + regex.compile("\\N{1}")) + + # Hg issue 59: regex.search("\\Z", "a\na\n") returns None incorrectly + self.assertEqual(regex.search("\\Z", "a\na\n").span(0), (4, 4)) + + # Hg issue 60: regex.search("(q1|.)*(q2|.)*(x(a|bc)*y){2,}", "xayxay") + # returns None incorrectly + self.assertEqual(regex.search("(q1|.)*(q2|.)*(x(a|bc)*y){2,}", + "xayxay").group(0), "xayxay") + + # Hg issue 61: regex.search("[^a]", "A", regex.I).group(0) returns '' + # incorrectly + self.assertEqual(regex.search("(?i)[^a]", "A"), None) + + # Hg issue 63: regex.search("[[:ascii:]]", "\N{KELVIN SIGN}", + # flags=regex.I|regex.V1) doesn't return None + self.assertEqual(regex.search("(?i)[[:ascii:]]", "\N{KELVIN SIGN}"), + None) + + # Hg issue 66: regex.search("((a|b(?1)c){3,5})", "baaaaca", + # flags=regex.V1).groups() returns ('baaaac', 'baaaac') instead of ('aaaa', 'a') + self.assertEqual(regex.search("((a|b(?1)c){3,5})", "baaaaca").group(0, + 1, 2), ('aaaa', 'aaaa', 'a')) + + # Hg issue 71: non-greedy quantifier in lookbehind + self.assertEqual(regex.findall(r"(?<=:\S+ )\w+", ":9 abc :10 def"), + ['abc', 'def']) + self.assertEqual(regex.findall(r"(?<=:\S* )\w+", ":9 abc :10 def"), + ['abc', 'def']) + self.assertEqual(regex.findall(r"(?<=:\S+? )\w+", ":9 abc :10 def"), + ['abc', 'def']) + self.assertEqual(regex.findall(r"(?<=:\S*? )\w+", ":9 abc :10 def"), + ['abc', 'def']) + + # Hg issue 73: conditional patterns + self.assertEqual(regex.search(r"(?:fe)?male", "female").group(), + "female") + self.assertEqual([m.group() for m in + regex.finditer(r"(fe)?male: h(?(1)(er)|(is)) (\w+)", + "female: her dog; male: his cat. asdsasda")], ['female: her dog', + 'male: his cat']) + + # Hg issue 78: "Captures" doesn't work for recursive calls + self.assertEqual(regex.search(r'(?<rec>\((?:[^()]++|(?&rec))*\))', + 'aaa(((1+0)+1)+1)bbb').captures('rec'), ['(1+0)', '((1+0)+1)', + '(((1+0)+1)+1)']) + + # Hg issue 80: Escape characters throws an exception + self.assertRaisesRegex(regex.error, self.BAD_ESCAPE, lambda: + regex.sub('x', '\\', 'x'), ) + + # Hg issue 82: error range does not work + fz = "(CAGCCTCCCATTTCAGAATATACATCC){1<e<=2}" + seq = "tcagacgagtgcgttgtaaaacgacggccagtCAGCCTCCCATTCAGAATATACATCCcgacggccagttaaaaacaatgccaaggaggtcatagctgtttcctgccagttaaaaacaatgccaaggaggtcatagctgtttcctgacgcactcgtctgagcgggctggcaagg" + self.assertEqual(regex.search(fz, seq, regex.BESTMATCH)[0], + "tCAGCCTCCCATTCAGAATATACATCC") + + # Hg issue 83: slash handling in presence of a quantifier + self.assertEqual(regex.findall(r"c..+/c", "cA/c\ncAb/c"), ['cAb/c']) + + # Hg issue 85: Non-conformance to Unicode UAX#29 re: ZWJ / ZWNJ + self.assertEqual(ascii(regex.sub(r"(\w+)", r"[\1]", + '\u0905\u0928\u094d\u200d\u0928 \u0d28\u0d4d\u200d \u0915\u093f\u0928', + regex.WORD)), + ascii('[\u0905\u0928\u094d\u200d\u0928] [\u0d28\u0d4d\u200d] [\u0915\u093f\u0928]')) + + # Hg issue 88: regex.match() hangs + self.assertEqual(regex.match(r".*a.*ba.*aa", "ababba"), None) + + # Hg issue 87: Allow duplicate names of groups + self.assertEqual(regex.match(r'(?<x>a(?<x>b))', "ab").spans("x"), [(1, + 2), (0, 2)]) + + # Hg issue 91: match.expand is extremely slow + # Check that the replacement cache works. + self.assertEqual(regex.sub(r'(-)', lambda m: m.expand(r'x'), 'a-b-c'), + 'axbxc') + + # Hg issue 94: Python crashes when executing regex updates + # pattern.findall + rx = regex.compile(r'\bt(est){i<2}', flags=regex.V1) + self.assertEqual(rx.search("Some text"), None) + self.assertEqual(rx.findall("Some text"), []) + + # Hg issue 95: 'pos' for regex.error + self.assertRaisesRegex(regex.error, self.MULTIPLE_REPEAT, lambda: + regex.compile(r'.???')) + + # Hg issue 97: behaviour of regex.escape's special_only is wrong + # + # Hg issue 244: Make `special_only=True` the default in + # `regex.escape()` + self.assertEqual(regex.escape('foo!?', special_only=False), 'foo\\!\\?') + self.assertEqual(regex.escape('foo!?', special_only=True), 'foo!\\?') + self.assertEqual(regex.escape('foo!?'), 'foo!\\?') + + self.assertEqual(regex.escape(b'foo!?', special_only=False), b'foo\\!\\?') + self.assertEqual(regex.escape(b'foo!?', special_only=True), + b'foo!\\?') + self.assertEqual(regex.escape(b'foo!?'), b'foo!\\?') + + # Hg issue 100: strange results from regex.search + self.assertEqual(regex.search('^([^z]*(?:WWWi|W))?$', + 'WWWi').groups(), ('WWWi', )) + self.assertEqual(regex.search('^([^z]*(?:WWWi|w))?$', + 'WWWi').groups(), ('WWWi', )) + self.assertEqual(regex.search('^([^z]*?(?:WWWi|W))?$', + 'WWWi').groups(), ('WWWi', )) + + # Hg issue 101: findall() broken (seems like memory corruption) + pat = regex.compile(r'xxx', flags=regex.FULLCASE | regex.UNICODE) + self.assertEqual([x.group() for x in pat.finditer('yxxx')], ['xxx']) + self.assertEqual(pat.findall('yxxx'), ['xxx']) + + raw = 'yxxx' + self.assertEqual([x.group() for x in pat.finditer(raw)], ['xxx']) + self.assertEqual(pat.findall(raw), ['xxx']) + + pat = regex.compile(r'xxx', flags=regex.FULLCASE | regex.IGNORECASE | + regex.UNICODE) + self.assertEqual([x.group() for x in pat.finditer('yxxx')], ['xxx']) + self.assertEqual(pat.findall('yxxx'), ['xxx']) + + raw = 'yxxx' + self.assertEqual([x.group() for x in pat.finditer(raw)], ['xxx']) + self.assertEqual(pat.findall(raw), ['xxx']) + + # Hg issue 106: * operator not working correctly with sub() + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.sub('(?V0).*', 'x', 'test'), 'xx') + else: + self.assertEqual(regex.sub('(?V0).*', 'x', 'test'), 'x') + self.assertEqual(regex.sub('(?V1).*', 'x', 'test'), 'xx') + + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.sub('(?V0).*?', '|', 'test'), '|||||||||') + else: + self.assertEqual(regex.sub('(?V0).*?', '|', 'test'), '|t|e|s|t|') + self.assertEqual(regex.sub('(?V1).*?', '|', 'test'), '|||||||||') + + # Hg issue 112: re: OK, but regex: SystemError + self.assertEqual(regex.sub(r'^(@)\n(?!.*?@)(.*)', + r'\1\n==========\n\2', '@\n', flags=regex.DOTALL), '@\n==========\n') + + # Hg issue 109: Edit distance of fuzzy match + self.assertEqual(regex.match(r'(?:cats|cat){e<=1}', + 'caz').fuzzy_counts, (1, 0, 0)) + self.assertEqual(regex.match(r'(?e)(?:cats|cat){e<=1}', + 'caz').fuzzy_counts, (1, 0, 0)) + self.assertEqual(regex.match(r'(?b)(?:cats|cat){e<=1}', + 'caz').fuzzy_counts, (1, 0, 0)) + + self.assertEqual(regex.match(r'(?:cat){e<=1}', 'caz').fuzzy_counts, + (1, 0, 0)) + self.assertEqual(regex.match(r'(?e)(?:cat){e<=1}', + 'caz').fuzzy_counts, (1, 0, 0)) + self.assertEqual(regex.match(r'(?b)(?:cat){e<=1}', + 'caz').fuzzy_counts, (1, 0, 0)) + + self.assertEqual(regex.match(r'(?:cats){e<=2}', 'c ats').fuzzy_counts, + (1, 1, 0)) + self.assertEqual(regex.match(r'(?e)(?:cats){e<=2}', + 'c ats').fuzzy_counts, (0, 1, 0)) + self.assertEqual(regex.match(r'(?b)(?:cats){e<=2}', + 'c ats').fuzzy_counts, (0, 1, 0)) + + self.assertEqual(regex.match(r'(?:cats){e<=2}', + 'c a ts').fuzzy_counts, (0, 2, 0)) + self.assertEqual(regex.match(r'(?e)(?:cats){e<=2}', + 'c a ts').fuzzy_counts, (0, 2, 0)) + self.assertEqual(regex.match(r'(?b)(?:cats){e<=2}', + 'c a ts').fuzzy_counts, (0, 2, 0)) + + self.assertEqual(regex.match(r'(?:cats){e<=1}', 'c ats').fuzzy_counts, + (0, 1, 0)) + self.assertEqual(regex.match(r'(?e)(?:cats){e<=1}', + 'c ats').fuzzy_counts, (0, 1, 0)) + self.assertEqual(regex.match(r'(?b)(?:cats){e<=1}', + 'c ats').fuzzy_counts, (0, 1, 0)) + + # Hg issue 115: Infinite loop when processing backreferences + self.assertEqual(regex.findall(r'\bof ([a-z]+) of \1\b', + 'To make use of one of these modules'), []) + + # Hg issue 125: Reference to entire match (\g<0>) in + # Pattern.sub() doesn't work as of 2014.09.22 release. + self.assertEqual(regex.sub(r'x', r'\g<0>', 'x'), 'x') + + # Unreported issue: no such builtin as 'ascii' in Python 2. + self.assertEqual(bool(regex.match(r'a', 'a', regex.DEBUG)), True) + + # Hg issue 131: nested sets behaviour + self.assertEqual(regex.findall(r'(?V1)[[b-e]--cd]', 'abcdef'), ['b', + 'e']) + self.assertEqual(regex.findall(r'(?V1)[b-e--cd]', 'abcdef'), ['b', + 'e']) + self.assertEqual(regex.findall(r'(?V1)[[bcde]--cd]', 'abcdef'), ['b', + 'e']) + self.assertEqual(regex.findall(r'(?V1)[bcde--cd]', 'abcdef'), ['b', + 'e']) + + # Hg issue 132: index out of range on null property \p{} + self.assertRaisesRegex(regex.error, '^unknown property at position 4$', + lambda: regex.compile(r'\p{}')) + + # Issue 23692. + self.assertEqual(regex.match('(?:()|(?(1)()|z)){2}(?(2)a|z)', + 'a').group(0, 1, 2), ('a', '', '')) + self.assertEqual(regex.match('(?:()|(?(1)()|z)){0,2}(?(2)a|z)', + 'a').group(0, 1, 2), ('a', '', '')) + + # Hg issue 137: Posix character class :punct: does not seem to be + # supported. + + # Posix compatibility as recommended here: + # http://www.unicode.org/reports/tr18/#Compatibility_Properties + + # Posix in Unicode. + chars = ''.join(chr(c) for c in range(0x10000)) + + self.assertEqual(ascii(''.join(regex.findall(r'''[[:alnum:]]+''', + chars))), ascii(''.join(regex.findall(r'''[\p{Alpha}\p{PosixDigit}]+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:alpha:]]+''', + chars))), ascii(''.join(regex.findall(r'''\p{Alpha}+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:ascii:]]+''', + chars))), ascii(''.join(regex.findall(r'''[\p{InBasicLatin}]+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:blank:]]+''', + chars))), ascii(''.join(regex.findall(r'''[\p{gc=Space_Separator}\t]+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:cntrl:]]+''', + chars))), ascii(''.join(regex.findall(r'''\p{gc=Control}+''', chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:digit:]]+''', + chars))), ascii(''.join(regex.findall(r'''[0-9]+''', chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:graph:]]+''', + chars))), ascii(''.join(regex.findall(r'''[^\p{Space}\p{gc=Control}\p{gc=Surrogate}\p{gc=Unassigned}]+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:lower:]]+''', + chars))), ascii(''.join(regex.findall(r'''\p{Lower}+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:print:]]+''', + chars))), ascii(''.join(regex.findall(r'''(?V1)[\p{Graph}\p{Blank}--\p{Cntrl}]+''', chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:punct:]]+''', + chars))), + ascii(''.join(regex.findall(r'''(?V1)[\p{gc=Punctuation}\p{gc=Symbol}--\p{Alpha}]+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:space:]]+''', + chars))), ascii(''.join(regex.findall(r'''\p{Whitespace}+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:upper:]]+''', + chars))), ascii(''.join(regex.findall(r'''\p{Upper}+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:word:]]+''', + chars))), ascii(''.join(regex.findall(r'''[\p{Alpha}\p{gc=Mark}\p{Digit}\p{gc=Connector_Punctuation}\p{Join_Control}]+''', + chars)))) + self.assertEqual(ascii(''.join(regex.findall(r'''[[:xdigit:]]+''', + chars))), ascii(''.join(regex.findall(r'''[0-9A-Fa-f]+''', + chars)))) + + # Posix in ASCII. + chars = bytes(range(0x100)) + + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:alnum:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)[\p{Alpha}\p{PosixDigit}]+''', + chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:alpha:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)\p{Alpha}+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:ascii:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)[\x00-\x7F]+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:blank:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)[\p{gc=Space_Separator}\t]+''', + chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:cntrl:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)\p{gc=Control}+''', + chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:digit:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)[0-9]+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:graph:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)[^\p{Space}\p{gc=Control}\p{gc=Surrogate}\p{gc=Unassigned}]+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:lower:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)\p{Lower}+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:print:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?aV1)[\p{Graph}\p{Blank}--\p{Cntrl}]+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:punct:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?aV1)[\p{gc=Punctuation}\p{gc=Symbol}--\p{Alpha}]+''', + chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:space:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)\p{Whitespace}+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:upper:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)\p{Upper}+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:word:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)[\p{Alpha}\p{gc=Mark}\p{Digit}\p{gc=Connector_Punctuation}\p{Join_Control}]+''', chars)))) + self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:xdigit:]]+''', + chars))), ascii(b''.join(regex.findall(br'''(?a)[0-9A-Fa-f]+''', chars)))) + + # Hg issue 138: grapheme anchored search not working properly. + self.assertEqual(ascii(regex.search(r'\X$', 'ab\u2103').group()), + ascii('\u2103')) + + # Hg issue 139: Regular expression with multiple wildcards where first + # should match empty string does not always work. + self.assertEqual(regex.search("([^L]*)([^R]*R)", "LtR").groups(), ('', + 'LtR')) + + # Hg issue 140: Replace with REVERSE and groups has unexpected + # behavior. + self.assertEqual(regex.sub(r'(.)', r'x\1y', 'ab'), 'xayxby') + self.assertEqual(regex.sub(r'(?r)(.)', r'x\1y', 'ab'), 'xayxby') + self.assertEqual(regex.subf(r'(.)', 'x{1}y', 'ab'), 'xayxby') + self.assertEqual(regex.subf(r'(?r)(.)', 'x{1}y', 'ab'), 'xayxby') + + # Hg issue 141: Crash on a certain partial match. + self.assertEqual(regex.fullmatch('(a)*abc', 'ab', + partial=True).span(), (0, 2)) + self.assertEqual(regex.fullmatch('(a)*abc', 'ab', + partial=True).partial, True) + + # Hg issue 143: Partial matches have incorrect span if prefix is '.' + # wildcard. + self.assertEqual(regex.search('OXRG', 'OOGOX', partial=True).span(), + (3, 5)) + self.assertEqual(regex.search('.XRG', 'OOGOX', partial=True).span(), + (3, 5)) + self.assertEqual(regex.search('.{1,3}XRG', 'OOGOX', + partial=True).span(), (1, 5)) + + # Hg issue 144: Latest version problem with matching 'R|R'. + self.assertEqual(regex.match('R|R', 'R').span(), (0, 1)) + + # Hg issue 146: Forced-fail (?!) works improperly in conditional. + self.assertEqual(regex.match(r'(.)(?(1)(?!))', 'xy'), None) + + # Groups cleared after failure. + self.assertEqual(regex.findall(r'(y)?(\d)(?(1)\b\B)', 'ax1y2z3b'), + [('', '1'), ('', '2'), ('', '3')]) + self.assertEqual(regex.findall(r'(y)?+(\d)(?(1)\b\B)', 'ax1y2z3b'), + [('', '1'), ('', '2'), ('', '3')]) + + # Hg issue 147: Fuzzy match can return match points beyond buffer end. + self.assertEqual([m.span() for m in regex.finditer(r'(?i)(?:error){e}', + 'regex failure')], [(0, 5), (5, 10), (10, 13), (13, 13)]) + self.assertEqual([m.span() for m in + regex.finditer(r'(?fi)(?:error){e}', 'regex failure')], [(0, 5), (5, + 10), (10, 13), (13, 13)]) + + # Hg issue 150: Have an option for POSIX-compatible longest match of + # alternates. + self.assertEqual(regex.search(r'(?p)\d+(\w(\d*)?|[eE]([+-]\d+))', + '10b12')[0], '10b12') + self.assertEqual(regex.search(r'(?p)\d+(\w(\d*)?|[eE]([+-]\d+))', + '10E+12')[0], '10E+12') + + self.assertEqual(regex.search(r'(?p)(\w|ae|oe|ue|ss)', 'ae')[0], 'ae') + self.assertEqual(regex.search(r'(?p)one(self)?(selfsufficient)?', + 'oneselfsufficient')[0], 'oneselfsufficient') + + # Hg issue 151: Request: \K. + self.assertEqual(regex.search(r'(ab\Kcd)', 'abcd').group(0, 1), ('cd', + 'abcd')) + self.assertEqual(regex.findall(r'\w\w\K\w\w', 'abcdefgh'), ['cd', + 'gh']) + self.assertEqual(regex.findall(r'(\w\w\K\w\w)', 'abcdefgh'), ['abcd', + 'efgh']) + + self.assertEqual(regex.search(r'(?r)(ab\Kcd)', 'abcd').group(0, 1), + ('ab', 'abcd')) + self.assertEqual(regex.findall(r'(?r)\w\w\K\w\w', 'abcdefgh'), ['ef', + 'ab']) + self.assertEqual(regex.findall(r'(?r)(\w\w\K\w\w)', 'abcdefgh'), + ['efgh', 'abcd']) + + # Hg issue 152: Request: Request: (?(DEFINE)...). + self.assertEqual(regex.search(r'(?(DEFINE)(?<quant>\d+)(?<item>\w+))(?&quant) (?&item)', + '5 elephants')[0], '5 elephants') + + self.assertEqual(regex.search(r'(?&routine)(?(DEFINE)(?<routine>.))', 'a').group('routine'), None) + self.assertEqual(regex.search(r'(?&routine)(?(DEFINE)(?<routine>.))', 'a').captures('routine'), ['a']) + + # Hg issue 153: Request: (*SKIP). + self.assertEqual(regex.search(r'12(*FAIL)|3', '123')[0], '3') + self.assertEqual(regex.search(r'(?r)12(*FAIL)|3', '123')[0], '3') + + self.assertEqual(regex.search(r'\d+(*PRUNE)\d', '123'), None) + self.assertEqual(regex.search(r'\d+(?=(*PRUNE))\d', '123')[0], '123') + self.assertEqual(regex.search(r'\d+(*PRUNE)bcd|[3d]', '123bcd')[0], + '123bcd') + self.assertEqual(regex.search(r'\d+(*PRUNE)bcd|[3d]', '123zzd')[0], + 'd') + self.assertEqual(regex.search(r'\d+?(*PRUNE)bcd|[3d]', '123bcd')[0], + '3bcd') + self.assertEqual(regex.search(r'\d+?(*PRUNE)bcd|[3d]', '123zzd')[0], + 'd') + self.assertEqual(regex.search(r'\d++(?<=3(*PRUNE))zzd|[4d]$', + '123zzd')[0], '123zzd') + self.assertEqual(regex.search(r'\d++(?<=3(*PRUNE))zzd|[4d]$', + '124zzd')[0], 'd') + self.assertEqual(regex.search(r'\d++(?<=(*PRUNE)3)zzd|[4d]$', + '124zzd')[0], 'd') + self.assertEqual(regex.search(r'\d++(?<=2(*PRUNE)3)zzd|[3d]$', + '124zzd')[0], 'd') + + self.assertEqual(regex.search(r'(?r)\d(*PRUNE)\d+', '123'), None) + self.assertEqual(regex.search(r'(?r)\d(?<=(*PRUNE))\d+', '123')[0], + '123') + self.assertEqual(regex.search(r'(?r)\d+(*PRUNE)bcd|[3d]', + '123bcd')[0], '123bcd') + self.assertEqual(regex.search(r'(?r)\d+(*PRUNE)bcd|[3d]', + '123zzd')[0], 'd') + self.assertEqual(regex.search(r'(?r)\d++(?<=3(*PRUNE))zzd|[4d]$', + '123zzd')[0], '123zzd') + self.assertEqual(regex.search(r'(?r)\d++(?<=3(*PRUNE))zzd|[4d]$', + '124zzd')[0], 'd') + self.assertEqual(regex.search(r'(?r)\d++(?<=(*PRUNE)3)zzd|[4d]$', + '124zzd')[0], 'd') + self.assertEqual(regex.search(r'(?r)\d++(?<=2(*PRUNE)3)zzd|[3d]$', + '124zzd')[0], 'd') + + self.assertEqual(regex.search(r'\d+(*SKIP)bcd|[3d]', '123bcd')[0], + '123bcd') + self.assertEqual(regex.search(r'\d+(*SKIP)bcd|[3d]', '123zzd')[0], + 'd') + self.assertEqual(regex.search(r'\d+?(*SKIP)bcd|[3d]', '123bcd')[0], + '3bcd') + self.assertEqual(regex.search(r'\d+?(*SKIP)bcd|[3d]', '123zzd')[0], + 'd') + self.assertEqual(regex.search(r'\d++(?<=3(*SKIP))zzd|[4d]$', + '123zzd')[0], '123zzd') + self.assertEqual(regex.search(r'\d++(?<=3(*SKIP))zzd|[4d]$', + '124zzd')[0], 'd') + self.assertEqual(regex.search(r'\d++(?<=(*SKIP)3)zzd|[4d]$', + '124zzd')[0], 'd') + self.assertEqual(regex.search(r'\d++(?<=2(*SKIP)3)zzd|[3d]$', + '124zzd')[0], 'd') + + self.assertEqual(regex.search(r'(?r)\d+(*SKIP)bcd|[3d]', '123bcd')[0], + '123bcd') + self.assertEqual(regex.search(r'(?r)\d+(*SKIP)bcd|[3d]', '123zzd')[0], + 'd') + self.assertEqual(regex.search(r'(?r)\d++(?<=3(*SKIP))zzd|[4d]$', + '123zzd')[0], '123zzd') + self.assertEqual(regex.search(r'(?r)\d++(?<=3(*SKIP))zzd|[4d]$', + '124zzd')[0], 'd') + self.assertEqual(regex.search(r'(?r)\d++(?<=(*SKIP)3)zzd|[4d]$', + '124zzd')[0], 'd') + self.assertEqual(regex.search(r'(?r)\d++(?<=2(*SKIP)3)zzd|[3d]$', + '124zzd')[0], 'd') + + # Hg issue 154: Segmentation fault 11 when working with an atomic group + text = """June 30, December 31, 2013 2012 +some words follow: +more words and numbers 1,234,567 9,876,542 +more words and numbers 1,234,567 9,876,542""" + self.assertEqual(len(regex.findall(r'(?<!\d)(?>2014|2013 ?2012)', text)), 1) + + # Hg issue 156: regression on atomic grouping + self.assertEqual(regex.match('1(?>2)', '12').span(), (0, 2)) + + # Hg issue 157: regression: segfault on complex lookaround + self.assertEqual(regex.match(r'(?V1w)(?=(?=[^A-Z]*+[A-Z])(?=[^a-z]*+[a-z]))(?=\D*+\d)(?=\p{Alphanumeric}*+\P{Alphanumeric})\A(?s:.){8,255}+\Z', + 'AAaa11!!')[0], 'AAaa11!!') + + # Hg issue 158: Group issue with (?(DEFINE)...) + TEST_REGEX = regex.compile(r'''(?smx) +(?(DEFINE) + (?<subcat> + ^,[^,]+, + ) +) + +# Group 2 is defined on this line +^,([^,]+), + +(?:(?!(?&subcat)[\r\n]+(?&subcat)).)+ +''') + + TEST_DATA = ''' +,Cat 1, +,Brand 1, +some +thing +,Brand 2, +other +things +,Cat 2, +,Brand, +Some +thing +''' + + self.assertEqual([m.span(1, 2) for m in + TEST_REGEX.finditer(TEST_DATA)], [((-1, -1), (2, 7)), ((-1, -1), (54, + 59))]) + + # Hg issue 161: Unexpected fuzzy match results + self.assertEqual(regex.search('(abcdefgh){e}', + '******abcdefghijklmnopqrtuvwxyz', regex.BESTMATCH).span(), (6, 14)) + self.assertEqual(regex.search('(abcdefghi){e}', + '******abcdefghijklmnopqrtuvwxyz', regex.BESTMATCH).span(), (6, 15)) + + # Hg issue 163: allow lookarounds in conditionals. + self.assertEqual(regex.match(r'(?:(?=\d)\d+\b|\w+)', '123abc').span(), + (0, 6)) + self.assertEqual(regex.match(r'(?(?=\d)\d+\b|\w+)', '123abc'), None) + self.assertEqual(regex.search(r'(?(?<=love\s)you|(?<=hate\s)her)', + "I love you").span(), (7, 10)) + self.assertEqual(regex.findall(r'(?(?<=love\s)you|(?<=hate\s)her)', + "I love you but I don't hate her either"), ['you', 'her']) + + # Hg issue 180: bug of POSIX matching. + self.assertEqual(regex.search(r'(?p)a*(.*?)', 'aaabbb').group(0, 1), + ('aaabbb', 'bbb')) + self.assertEqual(regex.search(r'(?p)a*(.*)', 'aaabbb').group(0, 1), + ('aaabbb', 'bbb')) + self.assertEqual(regex.sub(r'(?p)a*(.*?)', r'\1', 'aaabbb'), 'bbb') + self.assertEqual(regex.sub(r'(?p)a*(.*)', r'\1', 'aaabbb'), 'bbb') + + # Hg issue 192: Named lists reverse matching doesn't work with + # IGNORECASE and V1 + self.assertEqual(regex.match(r'(?irV0)\L<kw>', '21', kw=['1']).span(), + (1, 2)) + self.assertEqual(regex.match(r'(?irV1)\L<kw>', '21', kw=['1']).span(), + (1, 2)) + + # Hg issue 193: Alternation and .REVERSE flag. + self.assertEqual(regex.search('a|b', '111a222').span(), (3, 4)) + self.assertEqual(regex.search('(?r)a|b', '111a222').span(), (3, 4)) + + # Hg issue 194: .FULLCASE and Backreference + self.assertEqual(regex.search(r'(?if)<(CLI)><\1>', + '<cli><cli>').span(), (0, 10)) + self.assertEqual(regex.search(r'(?if)<(CLI)><\1>', + '<cli><clI>').span(), (0, 10)) + self.assertEqual(regex.search(r'(?ifr)<\1><(CLI)>', + '<cli><clI>').span(), (0, 10)) + + # Hg issue 195: Pickle (or otherwise serial) the compiled regex + r = regex.compile(r'\L<options>', options=['foo', 'bar']) + p = pickle.dumps(r) + r = pickle.loads(p) + self.assertEqual(r.match('foo').span(), (0, 3)) + + # Hg issue 196: Fuzzy matching on repeated regex not working as + # expected + self.assertEqual(regex.match('(x{6}){e<=1}', 'xxxxxx', + flags=regex.BESTMATCH).span(), (0, 6)) + self.assertEqual(regex.match('(x{6}){e<=1}', 'xxxxx', + flags=regex.BESTMATCH).span(), (0, 5)) + self.assertEqual(regex.match('(x{6}){e<=1}', 'x', + flags=regex.BESTMATCH), None) + self.assertEqual(regex.match('(?r)(x{6}){e<=1}', 'xxxxxx', + flags=regex.BESTMATCH).span(), (0, 6)) + self.assertEqual(regex.match('(?r)(x{6}){e<=1}', 'xxxxx', + flags=regex.BESTMATCH).span(), (0, 5)) + self.assertEqual(regex.match('(?r)(x{6}){e<=1}', 'x', + flags=regex.BESTMATCH), None) + + # Hg issue 197: ValueError in regex.compile + self.assertRaises(regex.error, lambda: + regex.compile(b'00000\\0\\00\\^\50\\00\\U05000000')) + + # Hg issue 198: ValueError in regex.compile + self.assertRaises(regex.error, lambda: regex.compile(b"{e<l")) + + # Hg issue 199: Segfault in re.compile + self.assertEqual(bool(regex.compile('((?0)){e}')), True) + + # Hg issue 200: AttributeError in regex.compile with latest regex + self.assertEqual(bool(regex.compile('\x00?(?0){e}')), True) + + # Hg issue 201: ENHANCEMATCH crashes interpreter + self.assertEqual(regex.findall(r'((brown)|(lazy)){1<=e<=3} ((dog)|(fox)){1<=e<=3}', + 'The quick borwn fax jumped over the lzy hog', regex.ENHANCEMATCH), + [('borwn', 'borwn', '', 'fax', '', 'fax'), ('lzy', '', 'lzy', 'hog', + 'hog', '')]) + + # Hg issue 203: partial matching bug + self.assertEqual(regex.search(r'\d\d\d-\d\d-\d\d\d\d', + "My SSN is 999-89-76, but don't tell.", partial=True).span(), (36, + 36)) + + # Hg issue 204: confusion of (?aif) flags + upper_i = '\N{CYRILLIC CAPITAL LETTER SHORT I}' + lower_i = '\N{CYRILLIC SMALL LETTER SHORT I}' + + self.assertEqual(bool(regex.match(r'(?ui)' + upper_i, + lower_i)), True) + self.assertEqual(bool(regex.match(r'(?ui)' + lower_i, + upper_i)), True) + + self.assertEqual(bool(regex.match(r'(?ai)' + upper_i, + lower_i)), False) + self.assertEqual(bool(regex.match(r'(?ai)' + lower_i, + upper_i)), False) + + self.assertEqual(bool(regex.match(r'(?afi)' + upper_i, + lower_i)), False) + self.assertEqual(bool(regex.match(r'(?afi)' + lower_i, + upper_i)), False) + + # Hg issue 205: Named list and (?ri) flags + self.assertEqual(bool(regex.search(r'(?i)\L<aa>', '22', aa=['121', + '22'])), True) + self.assertEqual(bool(regex.search(r'(?ri)\L<aa>', '22', aa=['121', + '22'])), True) + self.assertEqual(bool(regex.search(r'(?fi)\L<aa>', '22', aa=['121', + '22'])), True) + self.assertEqual(bool(regex.search(r'(?fri)\L<aa>', '22', aa=['121', + '22'])), True) + + # Hg issue 208: Named list, (?ri) flags, Backreference + self.assertEqual(regex.search(r'(?r)\1dog..(?<=(\L<aa>))$', 'ccdogcc', + aa=['bcb', 'cc']). span(), (0, 7)) + self.assertEqual(regex.search(r'(?ir)\1dog..(?<=(\L<aa>))$', + 'ccdogcc', aa=['bcb', 'cc']). span(), (0, 7)) + + # Hg issue 210: Fuzzy matching and Backreference + self.assertEqual(regex.search(r'(2)(?:\1{5}){e<=1}', + '3222212').span(), (1, 7)) + self.assertEqual(regex.search(r'(\d)(?:\1{5}){e<=1}', + '3222212').span(), (1, 7)) + + # Hg issue 211: Segmentation fault with recursive matches and atomic + # groups + self.assertEqual(regex.match(r'''\A(?P<whole>(?>\((?&whole)\)|[+\-]))\Z''', + '((-))').span(), (0, 5)) + self.assertEqual(regex.match(r'''\A(?P<whole>(?>\((?&whole)\)|[+\-]))\Z''', + '((-)+)'), None) + + # Hg issue 212: Unexpected matching difference with .*? between re and + # regex + self.assertEqual(regex.match(r"x.*? (.).*\1(.*)\1", + 'x |y| z|').span(), (0, 9)) + self.assertEqual(regex.match(r"\.sr (.*?) (.)(.*)\2(.*)\2(.*)", + r'.sr h |<nw>|<span class="locked">|').span(), (0, 35)) + + # Hg issue 213: Segmentation Fault + a = '"\\xF9\\x80\\xAEqdz\\x95L\\xA7\\x89[\\xFE \\x91)\\xF9]\\xDB\'\\x99\\x09=\\x00\\xFD\\x98\\x22\\xDD\\xF1\\xB6\\xC3 Z\\xB6gv\\xA5x\\x93P\\xE1r\\x14\\x8Cv\\x0C\\xC0w\\x15r\\xFFc%" ' + py_regex_pattern = r'''(?P<http_referer>((?>(?<!\\)(?>"(?>\\.|[^\\"]+)+"|""|(?>'(?>\\.|[^\\']+)+')|''|(?>`(?>\\.|[^\\`]+)+`)|``)))) (?P<useragent>((?>(?<!\\)(?>"(?>\\.|[^\\"]+)+"|""|(?>'(?>\\.|[^\\']+)+')|''|(?>`(?>\\.|[^\\`]+)+`)|``))))''' + self.assertEqual(bool(regex.search(py_regex_pattern, a)), False) + + # Hg Issue 216: Invalid match when using negative lookbehind and pipe + self.assertEqual(bool(regex.match('foo(?<=foo)', 'foo')), True) + self.assertEqual(bool(regex.match('foo(?<!foo)', 'foo')), False) + self.assertEqual(bool(regex.match('foo(?<=foo|x)', 'foo')), True) + self.assertEqual(bool(regex.match('foo(?<!foo|x)', 'foo')), False) + + # Hg issue 217: Core dump in conditional ahead match and matching \! + # character + self.assertEqual(bool(regex.match(r'(?(?=.*\!.*)(?P<true>.*\!\w*\:.*)|(?P<false>.*))', + '!')), False) + + # Hg issue 220: Misbehavior of group capture with OR operand + self.assertEqual(regex.match(r'\w*(ea)\w*|\w*e(?!a)\w*', + 'easier').groups(), ('ea', )) + + # Hg issue 225: BESTMATCH in fuzzy match not working + self.assertEqual(regex.search('(^1234$){i,d}', '12234', + regex.BESTMATCH).span(), (0, 5)) + self.assertEqual(regex.search('(^1234$){i,d}', '12234', + regex.BESTMATCH).fuzzy_counts, (0, 1, 0)) + + self.assertEqual(regex.search('(^1234$){s,i,d}', '12234', + regex.BESTMATCH).span(), (0, 5)) + self.assertEqual(regex.search('(^1234$){s,i,d}', '12234', + regex.BESTMATCH).fuzzy_counts, (0, 1, 0)) + + # Hg issue 226: Error matching at start of string + self.assertEqual(regex.search('(^123$){s,i,d}', 'xxxxxxxx123', + regex.BESTMATCH).span(), (0, 11)) + self.assertEqual(regex.search('(^123$){s,i,d}', 'xxxxxxxx123', + regex.BESTMATCH).fuzzy_counts, (0, 8, 0)) + + # Hg issue 227: Incorrect behavior for ? operator with UNICODE + + # IGNORECASE + self.assertEqual(regex.search(r'a?yz', 'xxxxyz', flags=regex.FULLCASE | + regex.IGNORECASE).span(), (4, 6)) + + # Hg issue 230: Is it a bug of (?(DEFINE)...) + self.assertEqual(regex.findall(r'(?:(?![a-d]).)+', 'abcdefgh'), + ['efgh']) + self.assertEqual(regex.findall(r'''(?(DEFINE)(?P<mydef>(?:(?![a-d]).)))(?&mydef)+''', + 'abcdefgh'), ['efgh']) + + # Hg issue 238: Not fully re backward compatible + self.assertEqual(regex.findall(r'((\w{1,3})(\.{2,10})){1,3}', + '"Erm....yes. T..T...Thank you for that."'), [('Erm....', 'Erm', + '....'), ('T...', 'T', '...')]) + self.assertEqual(regex.findall(r'((\w{1,3})(\.{2,10})){3}', + '"Erm....yes. T..T...Thank you for that."'), []) + self.assertEqual(regex.findall(r'((\w{1,3})(\.{2,10})){2}', + '"Erm....yes. T..T...Thank you for that."'), [('T...', 'T', '...')]) + self.assertEqual(regex.findall(r'((\w{1,3})(\.{2,10})){1}', + '"Erm....yes. T..T...Thank you for that."'), [('Erm....', 'Erm', + '....'), ('T..', 'T', '..'), ('T...', 'T', '...')]) + + # Hg issue 247: Unexpected result with fuzzy matching and lookahead + # expression + self.assertEqual(regex.search(r'(?:ESTONIA(?!\w)){e<=1}', + 'ESTONIAN WORKERS').group(), 'ESTONIAN') + self.assertEqual(regex.search(r'(?:ESTONIA(?=\W)){e<=1}', + 'ESTONIAN WORKERS').group(), 'ESTONIAN') + + self.assertEqual(regex.search(r'(?:(?<!\w)ESTONIA){e<=1}', + 'BLUB NESTONIA').group(), 'NESTONIA') + self.assertEqual(regex.search(r'(?:(?<=\W)ESTONIA){e<=1}', + 'BLUB NESTONIA').group(), 'NESTONIA') + + self.assertEqual(regex.search(r'(?r)(?:ESTONIA(?!\w)){e<=1}', + 'ESTONIAN WORKERS').group(), 'ESTONIAN') + self.assertEqual(regex.search(r'(?r)(?:ESTONIA(?=\W)){e<=1}', + 'ESTONIAN WORKERS').group(), 'ESTONIAN') + + self.assertEqual(regex.search(r'(?r)(?:(?<!\w)ESTONIA){e<=1}', + 'BLUB NESTONIA').group(), 'NESTONIA') + self.assertEqual(regex.search(r'(?r)(?:(?<=\W)ESTONIA){e<=1}', + 'BLUB NESTONIA').group(), 'NESTONIA') + + # Hg issue 248: Unexpected result with fuzzy matching and more than one + # non-greedy quantifier + self.assertEqual(regex.search(r'(?:A.*B.*CDE){e<=2}', + 'A B CYZ').group(), 'A B CYZ') + self.assertEqual(regex.search(r'(?:A.*B.*?CDE){e<=2}', + 'A B CYZ').group(), 'A B CYZ') + self.assertEqual(regex.search(r'(?:A.*?B.*CDE){e<=2}', + 'A B CYZ').group(), 'A B CYZ') + self.assertEqual(regex.search(r'(?:A.*?B.*?CDE){e<=2}', + 'A B CYZ').group(), 'A B CYZ') + + # Hg issue 249: Add an option to regex.escape() to not escape spaces + self.assertEqual(regex.escape(' ,0A[', special_only=False, literal_spaces=False), '\\ \\,0A\\[') + self.assertEqual(regex.escape(' ,0A[', special_only=False, literal_spaces=True), ' \\,0A\\[') + self.assertEqual(regex.escape(' ,0A[', special_only=True, literal_spaces=False), '\\ ,0A\\[') + self.assertEqual(regex.escape(' ,0A[', special_only=True, literal_spaces=True), ' ,0A\\[') + + self.assertEqual(regex.escape(' ,0A['), '\\ ,0A\\[') + + # Hg issue 251: Segfault with a particular expression + self.assertEqual(regex.search(r'(?(?=A)A|B)', 'A').span(), (0, 1)) + self.assertEqual(regex.search(r'(?(?=A)A|B)', 'B').span(), (0, 1)) + self.assertEqual(regex.search(r'(?(?=A)A|)', 'B').span(), (0, 0)) + self.assertEqual(regex.search(r'(?(?=X)X|)', '').span(), (0, 0)) + self.assertEqual(regex.search(r'(?(?=X))', '').span(), (0, 0)) + + # Hg issue 252: Empty capture strings when using DEFINE group reference + # within look-behind expression + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?&func)', + 'abc').groups(), (None, )) + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?&func)', + 'abc').groupdict(), {'func': None}) + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?&func)', + 'abc').capturesdict(), {'func': ['a']}) + + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?=(?&func))', + 'abc').groups(), (None, )) + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?=(?&func))', + 'abc').groupdict(), {'func': None}) + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?=(?&func))', + 'abc').capturesdict(), {'func': ['a']}) + + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.)).(?<=(?&func))', + 'abc').groups(), (None, )) + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.)).(?<=(?&func))', + 'abc').groupdict(), {'func': None}) + self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.)).(?<=(?&func))', + 'abc').capturesdict(), {'func': ['a']}) + + # Hg issue 271: Comment logic different between Re and Regex + self.assertEqual(bool(regex.match(r'ab(?#comment\))cd', 'abcd')), True) + + # Hg issue 276: Partial Matches yield incorrect matches and bounds + self.assertEqual(regex.search(r'[a-z]+ [a-z]*?:', 'foo bar', + partial=True).span(), (0, 7)) + self.assertEqual(regex.search(r'(?r):[a-z]*? [a-z]+', 'foo bar', + partial=True).span(), (0, 7)) + + # Hg issue 291: Include Script Extensions as a supported Unicode property + self.assertEqual(bool(regex.match(r'(?u)\p{Script:Beng}', + '\u09EF')), True) + self.assertEqual(bool(regex.match(r'(?u)\p{Script:Bengali}', + '\u09EF')), True) + self.assertEqual(bool(regex.match(r'(?u)\p{Script_Extensions:Bengali}', + '\u09EF')), True) + self.assertEqual(bool(regex.match(r'(?u)\p{Script_Extensions:Beng}', + '\u09EF')), True) + self.assertEqual(bool(regex.match(r'(?u)\p{Script_Extensions:Cakm}', + '\u09EF')), True) + self.assertEqual(bool(regex.match(r'(?u)\p{Script_Extensions:Sylo}', + '\u09EF')), True) + + # Hg issue #293: scx (Script Extensions) property currently matches + # incorrectly + self.assertEqual(bool(regex.match(r'(?u)\p{scx:Latin}', 'P')), True) + self.assertEqual(bool(regex.match(r'(?u)\p{scx:Ahom}', 'P')), False) + self.assertEqual(bool(regex.match(r'(?u)\p{scx:Common}', '4')), True) + self.assertEqual(bool(regex.match(r'(?u)\p{scx:Caucasian_Albanian}', '4')), + False) + self.assertEqual(bool(regex.match(r'(?u)\p{scx:Arabic}', '\u062A')), True) + self.assertEqual(bool(regex.match(r'(?u)\p{scx:Balinese}', '\u062A')), + False) + self.assertEqual(bool(regex.match(r'(?u)\p{scx:Devanagari}', '\u091C')), + True) + self.assertEqual(bool(regex.match(r'(?u)\p{scx:Batak}', '\u091C')), False) + + # Hg issue 296: Group references are not taken into account when group is reporting the last match + self.assertEqual(regex.fullmatch('(?P<x>.)*(?&x)', 'abc').captures('x'), + ['a', 'b', 'c']) + self.assertEqual(regex.fullmatch('(?P<x>.)*(?&x)', 'abc').group('x'), + 'b') + + self.assertEqual(regex.fullmatch('(?P<x>.)(?P<x>.)(?P<x>.)', + 'abc').captures('x'), ['a', 'b', 'c']) + self.assertEqual(regex.fullmatch('(?P<x>.)(?P<x>.)(?P<x>.)', + 'abc').group('x'), 'c') + + # Hg issue 299: Partial gives misleading results with "open ended" regexp + self.assertEqual(regex.match('(?:ab)*', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)*', 'abab', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)*?', '', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)*+', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)*+', 'abab', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)+', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)+', 'abab', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)+?', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)++', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?:ab)++', 'abab', partial=True).partial, + False) + + self.assertEqual(regex.match('(?r)(?:ab)*', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)*', 'abab', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)*?', '', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)*+', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)*+', 'abab', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)+', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)+', 'abab', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)+?', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)++', 'ab', partial=True).partial, + False) + self.assertEqual(regex.match('(?r)(?:ab)++', 'abab', partial=True).partial, + False) + + self.assertEqual(regex.match('a*', '', partial=True).partial, False) + self.assertEqual(regex.match('a*?', '', partial=True).partial, False) + self.assertEqual(regex.match('a*+', '', partial=True).partial, False) + self.assertEqual(regex.match('a+', '', partial=True).partial, True) + self.assertEqual(regex.match('a+?', '', partial=True).partial, True) + self.assertEqual(regex.match('a++', '', partial=True).partial, True) + self.assertEqual(regex.match('a+', 'a', partial=True).partial, False) + self.assertEqual(regex.match('a+?', 'a', partial=True).partial, False) + self.assertEqual(regex.match('a++', 'a', partial=True).partial, False) + + self.assertEqual(regex.match('(?r)a*', '', partial=True).partial, False) + self.assertEqual(regex.match('(?r)a*?', '', partial=True).partial, False) + self.assertEqual(regex.match('(?r)a*+', '', partial=True).partial, False) + self.assertEqual(regex.match('(?r)a+', '', partial=True).partial, True) + self.assertEqual(regex.match('(?r)a+?', '', partial=True).partial, True) + self.assertEqual(regex.match('(?r)a++', '', partial=True).partial, True) + self.assertEqual(regex.match('(?r)a+', 'a', partial=True).partial, False) + self.assertEqual(regex.match('(?r)a+?', 'a', partial=True).partial, False) + self.assertEqual(regex.match('(?r)a++', 'a', partial=True).partial, False) + + self.assertEqual(regex.match(r"(?:\s*\w+'*)+", 'whatever', partial=True).partial, + False) + + # Hg issue 300: segmentation fault + pattern = ('(?P<termini5>GGCGTCACACTTTGCTATGCCATAGCAT[AG]TTTATCCATAAGA' + 'TTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATAACAGAACATATTGA' + 'CTATCCGGTATTACCCGGCATGACAGGAGTAAAA){e<=1}' + '(?P<gene>[ACGT]{1059}){e<=2}' + '(?P<spacer>TAATCGTCTTGTTTGATACACAAGGGTCGCATCTGCGGCCCTTTTGCTTTTTTAAG' + 'TTGTAAGGATATGCCATTCTAGA){e<=0}' + '(?P<barcode>[ACGT]{18}){e<=0}' + '(?P<termini3>AGATCGG[CT]AGAGCGTCGTGTAGGGAAAGAGTGTGG){e<=1}') + + text = ('GCACGGCGTCACACTTTGCTATGCCATAGCATATTTATCCATAAGATTAGCGGATCCTACC' + 'TGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATAACAGAACATATTGACTATCCGGTATTACC' + 'CGGCATGACAGGAGTAAAAATGGCTATCGACGAAAACAAACAGAAAGCGTTGGCGGCAGCACTGGGC' + 'CAGATTGAGAAACAATTTGGTAAAGGCTCCATCATGCGCCTGGGTGAAGACCGTTCCATGGATGTGG' + 'AAACCATCTCTACCGGTTCGCTTTCACTGGATATCGCGCTTGGGGCAGGTGGTCTGCCGATGGGCCG' + 'TATCGTCGAAATCTACGGACCGGAATCTTCCGGTAAAACCACGCTGACGCTGCAGGTGATCGCCGCA' + 'GCGCAGCGTGAAGGTAAAACCTGTGCGTTTATCGATGCTGAACACGCGCTGGACCCAATCTACGCAC' + 'GTAAACTGGGCGTCGATATCGACAACCTGCTGTGCTCCCAGCCGGACACCGGCGAGCAGGCACTGGA' + 'AATCTGTGACGCCCTGGCGCGTTCTGGCGCAGTAGACGTTATCGTCGTTGACTCCGTGGCGGCACTG' + 'ACGCCGAAAGCGGAAATCGAAGGCGAAATCGGCGACTCTCATATGGGCCTTGCGGCACGTATGATGA' + 'GCCAGGCGATGCGTAAGCTGGCGGGTAACCTGAAGCAGTCCAACACGCTGCTGATCTTCATCAACCC' + 'CATCCGTATGAAAATTGGTGTGATGTTCGGCAACCCGGAAACCACTTACCGGTGGTAACGCGCTGAA' + 'ATTCTACGCCTCTGTTCGTCTCGACATCCGTTAAATCGGCGCGGTGAAAGAGGGCGAAAACGTGGTG' + 'GGTAGCGAAACCCGCGTGAAAGTGGTGAAGAACAAAATCGCTGCGCCGTTTAAACAGGCTGAATTCC' + 'AGATCCTCTACGGCGAAGGTATCAACTTCTACCCCGAACTGGTTGACCTGGGCGTAAAAGAGAAGCT' + 'GATCGAGAAAGCAGGCGCGTGGTACAGCTACAAAGGTGAGAAGATCGGTCAGGGTAAAGCGAATGCG' + 'ACTGCCTGGCTGAAATTTAACCCGGAAACCGCGAAAGAGATCGAGTGAAAAGTACGTGAGTTGCTGC' + 'TGAGCAACCCGAACTCAACGCCGGATTTCTCTGTAGATGATAGCGAAGGCGTAGCAGAAACTAACGA' + 'AGATTTTTAATCGTCTTGTTTGATACACAAGGGTCGCATCTGCGGCCCTTTTGCTTTTTTAAGTTGT' + 'AAGGATATGCCATTCTAGACAGTTAACACACCAACAAAGATCGGTAGAGCGTCGTGTAGGGAAAGAG' + 'TGTGGTACC') + + m = regex.search(pattern, text, flags=regex.BESTMATCH) + self.assertEqual(m.fuzzy_counts, (0, 1, 0)) + self.assertEqual(m.fuzzy_changes, ([], [1206], [])) + + # Hg issue 306: Fuzzy match parameters not respecting quantifier scope + self.assertEqual(regex.search(r'(?e)(dogf(((oo){e<1})|((00){e<1}))d){e<2}', + 'dogfood').fuzzy_counts, (0, 0, 0)) + self.assertEqual(regex.search(r'(?e)(dogf(((oo){e<1})|((00){e<1}))d){e<2}', + 'dogfoot').fuzzy_counts, (1, 0, 0)) + + # Hg issue 312: \X not matching graphemes with zero-width-joins + self.assertEqual(regex.findall(r'\X', + '\U0001F468\u200D\U0001F469\u200D\U0001F467\u200D\U0001F466'), + ['\U0001F468\u200D\U0001F469\u200D\U0001F467\u200D\U0001F466']) + + # Hg issue 320: Abnormal performance + self.assertEqual(bool(regex.search(r'(?=a)a', 'a')), True) + self.assertEqual(bool(regex.search(r'(?!b)a', 'a')), True) + + # Hg issue 327: .fullmatch() causes MemoryError + self.assertEqual(regex.fullmatch(r'((\d)*?)*?', '123').span(), (0, 3)) + + # Hg issue 329: Wrong group matches when question mark quantifier is used within a look behind + self.assertEqual(regex.search(r'''(?(DEFINE)(?<mydef>(?<wrong>THIS_SHOULD_NOT_MATCHx?)|(?<right>right))).*(?<=(?&mydef).*)''', + 'x right').capturesdict(), {'mydef': ['right'], 'wrong': [], 'right': + ['right']}) + + # Hg issue 338: specifying allowed characters when fuzzy-matching + self.assertEqual(bool(regex.match(r'(?:cat){e<=1:[u]}', 'cut')), True) + self.assertEqual(bool(regex.match(r'(?:cat){e<=1:u}', 'cut')), True) + + # Hg issue 353: fuzzy changes negative indexes + self.assertEqual(regex.search(r'(?be)(AGTGTTCCCCGCGCCAGCGGGGATAAACCG){s<=5,i<=5,d<=5,s+i+d<=10}', + 'TTCCCCGCGCCAGCGGGGATAAACCG').fuzzy_changes, ([], [], [0, 1, 3, 5])) + + # Git issue 364: Contradictory values in fuzzy_counts and fuzzy_changes + self.assertEqual(regex.match(r'(?:bc){e}', 'c').fuzzy_counts, (1, 0, + 1)) + self.assertEqual(regex.match(r'(?:bc){e}', 'c').fuzzy_changes, ([0], + [], [1])) + self.assertEqual(regex.match(r'(?e)(?:bc){e}', 'c').fuzzy_counts, (0, + 0, 1)) + self.assertEqual(regex.match(r'(?e)(?:bc){e}', 'c').fuzzy_changes, + ([], [], [0])) + self.assertEqual(regex.match(r'(?b)(?:bc){e}', 'c').fuzzy_counts, (0, + 0, 1)) + self.assertEqual(regex.match(r'(?b)(?:bc){e}', 'c').fuzzy_changes, + ([], [], [0])) + + # Git issue 370: Confusions about Fuzzy matching behavior + self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){e}', + '$ 10,112.111.12').fuzzy_counts, (6, 0, 5)) + self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){s<=1}', + '$ 10,112.111.12').fuzzy_counts, (1, 0, 0)) + self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){s<=1,i<=1,d<=1}', + '$ 10,112.111.12').fuzzy_counts, (1, 0, 0)) + self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){s<=3}', + '$ 10,1a2.111.12').fuzzy_counts, (2, 0, 0)) + self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){s<=2}', + '$ 10,1a2.111.12').fuzzy_counts, (2, 0, 0)) + + self.assertEqual(regex.fullmatch(r'(?e)(?:0?,0(?:,0)?){s<=1,d<=1}', + ',0;0').fuzzy_counts, (1, 0, 0)) + self.assertEqual(regex.fullmatch(r'(?e)(?:0??,0(?:,0)?){s<=1,d<=1}', + ',0;0').fuzzy_counts, (1, 0, 0)) + + # Git issue 371: Specifying character set when fuzzy-matching allows characters not in the set + self.assertEqual(regex.search(r"\b(?e)(?:\d{6,20}){i<=5:[\-\\\/]}\b", + "cat dog starting at 00:01132.000. hello world"), None) + + # Git issue 385: Comments in expressions + self.assertEqual(bool(regex.compile('(?#)')), True) + self.assertEqual(bool(regex.compile('(?x)(?#)')), True) + + # Git issue 394: Unexpected behaviour in fuzzy matching with limited character set with IGNORECASE flag + self.assertEqual(regex.findall(r'(\d+){i<=2:[ab]}', '123X4Y5'), + ['123', '4', '5']) + self.assertEqual(regex.findall(r'(?i)(\d+){i<=2:[ab]}', '123X4Y5'), + ['123', '4', '5']) + + # Git issue 403: Fuzzy matching with wrong distance (unnecessary substitutions) + self.assertEqual(regex.match(r'^(test){e<=5}$', 'terstin', + flags=regex.B).fuzzy_counts, (0, 3, 0)) + + # Git issue 408: regex fails with a quantified backreference but succeeds with repeated backref + self.assertEqual(bool(regex.match(r"(?:(x*)\1\1\1)*x$", "x" * 5)), True) + self.assertEqual(bool(regex.match(r"(?:(x*)\1{3})*x$", "x" * 5)), True) + + # Git issue 415: Fuzzy character restrictions don't apply to insertions at "right edge" + self.assertEqual(regex.match(r't(?:es){s<=1:\d}t', 'te5t').group(), + 'te5t') + self.assertEqual(regex.match(r't(?:es){s<=1:\d}t', 'tezt'), None) + self.assertEqual(regex.match(r't(?:es){i<=1:\d}t', 'tes5t').group(), + 'tes5t') + self.assertEqual(regex.match(r't(?:es){i<=1:\d}t', 'teszt'), None) + self.assertEqual(regex.match(r't(?:es){i<=1:\d}t', + 'tes5t').fuzzy_changes, ([], [3], [])) + self.assertEqual(regex.match(r't(es){i<=1,0<e<=1}t', 'tes5t').group(), + 'tes5t') + self.assertEqual(regex.match(r't(?:es){i<=1,0<e<=1:\d}t', + 'tes5t').fuzzy_changes, ([], [3], [])) + + # Git issue 421: Fatal Python error: Segmentation fault + self.assertEqual(regex.compile(r"(\d+ week|\d+ days)").split("7 days"), ['', '7 days', '']) + self.assertEqual(regex.compile(r"(\d+ week|\d+ days)").split("10 days"), ['', '10 days', '']) + + self.assertEqual(regex.compile(r"[ ]* Name[ ]*\* ").search(" Name *"), None) + + self.assertEqual(regex.compile('a|\\.*pb\\.py').search('.geojs'), None) + + p = regex.compile('(?<=(?:\\A|\\W|_))(\\d+ decades? ago|\\d+ minutes ago|\\d+ seconds ago|in \\d+ decades?|\\d+ months ago|in \\d+ minutes|\\d+ minute ago|in \\d+ seconds|\\d+ second ago|\\d+ years ago|in \\d+ months|\\d+ month ago|\\d+ weeks ago|\\d+ hours ago|in \\d+ minute|in \\d+ second|in \\d+ years|\\d+ year ago|in \\d+ month|in \\d+ weeks|\\d+ week ago|\\d+ days ago|in \\d+ hours|\\d+ hour ago|in \\d+ year|in \\d+ week|in \\d+ days|\\d+ day ago|in \\d+ hour|\\d+ min ago|\\d+ sec ago|\\d+ yr ago|\\d+ mo ago|\\d+ wk ago|in \\d+ day|\\d+ hr ago|in \\d+ min|in \\d+ sec|in \\d+ yr|in \\d+ mo|in \\d+ wk|in \\d+ hr)(?=(?:\\Z|\\W|_))', flags=regex.I | regex.V0) + self.assertEqual(p.search('1 month ago').group(), '1 month ago') + self.assertEqual(p.search('9 hours 1 minute ago').group(), '1 minute ago') + self.assertEqual(p.search('10 months 1 hour ago').group(), '1 hour ago') + self.assertEqual(p.search('1 month 10 hours ago').group(), '10 hours ago') + + # Git issue 427: Possible bug with BESTMATCH + sequence = 'TTCAGACGTGTGCTCTTCCGATCTCAATACCGACTCCTCACTGTGTGTCT' + pattern = r'(?P<insert>.*)(?P<anchor>CTTCC){e<=1}(?P<umi>([ACGT]){4,6})(?P<sid>CAATACCGACTCCTCACTGTGT){e<=2}(?P<end>([ACGT]){0,6}$)' + + m = regex.match(pattern, sequence, flags=regex.BESTMATCH) + self.assertEqual(m.span(), (0, 50)) + self.assertEqual(m.groupdict(), {'insert': 'TTCAGACGTGTGCT', 'anchor': 'CTTCC', 'umi': 'GATCT', 'sid': 'CAATACCGACTCCTCACTGTGT', 'end': 'GTCT'}) + + m = regex.match(pattern, sequence, flags=regex.ENHANCEMATCH) + self.assertEqual(m.span(), (0, 50)) + self.assertEqual(m.groupdict(), {'insert': 'TTCAGACGTGTGCT', 'anchor': 'CTTCC', 'umi': 'GATCT', 'sid': 'CAATACCGACTCCTCACTGTGT', 'end': 'GTCT'}) + + # Git issue 433: Disagreement between fuzzy_counts and fuzzy_changes + pattern = r'(?P<insert>.*)(?P<anchor>AACACTGG){e<=1}(?P<umi>([AT][CG]){5}){e<=2}(?P<sid>GTAACCGAAG){e<=2}(?P<end>([ACGT]){0,6}$)' + + sequence = 'GGAAAACACTGGTCTCAGTCTCGTAACCGAAGTGGTCG' + m = regex.match(pattern, sequence, flags=regex.BESTMATCH) + self.assertEqual(m.fuzzy_counts, (0, 0, 0)) + self.assertEqual(m.fuzzy_changes, ([], [], [])) + + sequence = 'GGAAAACACTGGTCTCAGTCTCGTCCCCGAAGTGGTCG' + m = regex.match(pattern, sequence, flags=regex.BESTMATCH) + self.assertEqual(m.fuzzy_counts, (2, 0, 0)) + self.assertEqual(m.fuzzy_changes, ([24, 25], [], [])) + + # Git issue 439: Unmatched groups: sub vs subf + self.assertEqual(regex.sub(r'(test1)|(test2)', r'matched: \1\2', 'test1'), 'matched: test1') + self.assertEqual(regex.subf(r'(test1)|(test2)', r'matched: {1}{2}', 'test1'), 'matched: test1') + self.assertEqual(regex.search(r'(test1)|(test2)', 'matched: test1').expand(r'matched: \1\2'), 'matched: test1'), + self.assertEqual(regex.search(r'(test1)|(test2)', 'matched: test1').expandf(r'matched: {1}{2}'), 'matched: test1') + + # Git issue 442: Fuzzy regex matching doesn't seem to test insertions correctly + self.assertEqual(regex.search(r"(?:\bha\b){i:[ ]}", "having"), None) + self.assertEqual(regex.search(r"(?:\bha\b){i:[ ]}", "having", flags=regex.I), None) + + # Git issue 467: Scoped inline flags 'a', 'u' and 'L' affect global flags + self.assertEqual(regex.match(r'(?a:\w)\w', 'd\N{CYRILLIC SMALL LETTER ZHE}').span(), (0, 2)) + self.assertEqual(regex.match(r'(?a:\w)(?u:\w)', 'd\N{CYRILLIC SMALL LETTER ZHE}').span(), (0, 2)) + + # Git issue 473: Emoji classified as letter + self.assertEqual(regex.match(r'^\p{LC}+$', '\N{SMILING CAT FACE WITH OPEN MOUTH}'), None) + self.assertEqual(regex.match(r'^\p{So}+$', '\N{SMILING CAT FACE WITH OPEN MOUTH}').span(), (0, 1)) + + # Git issue 474: regex has no equivalent to `re.Match.groups()` for captures + self.assertEqual(regex.match(r'(.)+', 'abc').allcaptures(), (['abc'], ['a', 'b', 'c'])) + self.assertEqual(regex.match(r'(.)+', 'abc').allspans(), ([(0, 3)], [(0, 1), (1, 2), (2, 3)])) + + # Git issue 477: \v for vertical spacing + self.assertEqual(bool(regex.fullmatch(r'\p{HorizSpace}+', '\t \xA0\u1680\u180E\u2000\u2001\u2002\u2003\u2004\u2005\u2006\u2007\u2008\u2009\u200A\u202F\u205F\u3000')), True) + self.assertEqual(bool(regex.fullmatch(r'\p{VertSpace}+', '\n\v\f\r\x85\u2028\u2029')), True) + + # Git issue 479: Segmentation fault when using conditional pattern + self.assertEqual(regex.match(r'(?(?<=A)|(?(?![^B])C|D))', 'A'), None) + self.assertEqual(regex.search(r'(?(?<=A)|(?(?![^B])C|D))', 'A').span(), (1, 1)) + + # Git issue 494: Backtracking failure matching regex ^a?(a?)b?c\1$ against string abca + self.assertEqual(regex.search(r"^a?(a?)b?c\1$", "abca").span(), (0, 4)) + + # Git issue 498: Conditional negative lookahead inside positive lookahead fails to match + self.assertEqual(regex.match(r'(?(?=a).|..)', 'ab').span(), (0, 1)) + self.assertEqual(regex.match(r'(?(?=b).|..)', 'ab').span(), (0, 2)) + self.assertEqual(regex.match(r'(?(?!a).|..)', 'ab').span(), (0, 2)) + self.assertEqual(regex.match(r'(?(?!b).|..)', 'ab').span(), (0, 1)) + + # Git issue 525: segfault when fuzzy matching empty list + self.assertEqual(regex.match(r"(\L<foo>){e<=5}", "blah", foo=[]).span(), (0, 0)) + + # Git issue 527: `VERBOSE`/`X` flag breaks `\N` escapes + self.assertEqual(regex.compile(r'\N{LATIN SMALL LETTER A}').match('a').span(), (0, 1)) + self.assertEqual(regex.compile(r'\N{LATIN SMALL LETTER A}', flags=regex.X).match('a').span(), (0, 1)) + + # Git issue 539: Bug: Partial matching fails on a simple example + self.assertEqual(regex.match(r"[^/]*b/ccc", "b/ccc", partial=True).span(), (0, 5)) + self.assertEqual(regex.match(r"[^/]*b/ccc", "b/ccb", partial=True), None) + self.assertEqual(regex.match(r"[^/]*b/ccc", "b/cc", partial=True).span(), (0, 4)) + self.assertEqual(regex.match(r"[^/]*b/xyz", "b/xy", partial=True).span(), (0, 4)) + self.assertEqual(regex.match(r"[^/]*b/xyz", "b/yz", partial=True), None) + + self.assertEqual(regex.match(r"(?i)[^/]*b/ccc", "b/ccc", partial=True).span(), (0, 5)) + self.assertEqual(regex.match(r"(?i)[^/]*b/ccc", "b/ccb", partial=True), None) + self.assertEqual(regex.match(r"(?i)[^/]*b/ccc", "b/cc", partial=True).span(), (0, 4)) + self.assertEqual(regex.match(r"(?i)[^/]*b/xyz", "b/xy", partial=True).span(), (0, 4)) + self.assertEqual(regex.match(r"(?i)[^/]*b/xyz", "b/yz", partial=True), None) + + # Git issue 546: Partial match not working in some instances with non-greedy capture + self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<', partial=True)), True) + self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking', partial=True)), True) + self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>', partial=True)), True) + self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>x', partial=True)), True) + self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>xyz abc', partial=True)), True) + self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>xyz abc foo', partial=True)), True) + self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>xyz abc foo ', partial=True)), True) + self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>xyz abc foo bar', partial=True)), True) + + def test_fuzzy_ext(self): + self.assertEqual(bool(regex.fullmatch(r'(?r)(?:a){e<=1:[a-z]}', 'e')), + True) + self.assertEqual(bool(regex.fullmatch(r'(?:a){e<=1:[a-z]}', 'e')), + True) + self.assertEqual(bool(regex.fullmatch(r'(?:a){e<=1:[a-z]}', '-')), + False) + self.assertEqual(bool(regex.fullmatch(r'(?r)(?:a){e<=1:[a-z]}', '-')), + False) + + self.assertEqual(bool(regex.fullmatch(r'(?:a){e<=1:[a-z]}', 'ae')), + True) + self.assertEqual(bool(regex.fullmatch(r'(?r)(?:a){e<=1:[a-z]}', + 'ae')), True) + self.assertEqual(bool(regex.fullmatch(r'(?:a){e<=1:[a-z]}', 'a-')), + False) + self.assertEqual(bool(regex.fullmatch(r'(?r)(?:a){e<=1:[a-z]}', + 'a-')), False) + + self.assertEqual(bool(regex.fullmatch(r'(?:ab){e<=1:[a-z]}', 'ae')), + True) + self.assertEqual(bool(regex.fullmatch(r'(?r)(?:ab){e<=1:[a-z]}', + 'ae')), True) + self.assertEqual(bool(regex.fullmatch(r'(?:ab){e<=1:[a-z]}', 'a-')), + False) + self.assertEqual(bool(regex.fullmatch(r'(?r)(?:ab){e<=1:[a-z]}', + 'a-')), False) + + self.assertEqual(bool(regex.fullmatch(r'(a)\1{e<=1:[a-z]}', 'ae')), + True) + self.assertEqual(bool(regex.fullmatch(r'(?r)\1{e<=1:[a-z]}(a)', + 'ea')), True) + self.assertEqual(bool(regex.fullmatch(r'(a)\1{e<=1:[a-z]}', 'a-')), + False) + self.assertEqual(bool(regex.fullmatch(r'(?r)\1{e<=1:[a-z]}(a)', + '-a')), False) + + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}', + 'ts')), True) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}', + 'st')), True) + self.assertEqual(bool(regex.fullmatch(r'(?firu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}', + 'st')), True) + self.assertEqual(bool(regex.fullmatch(r'(?firu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}', + 'ts')), True) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}', + '-s')), False) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}', + 's-')), False) + self.assertEqual(bool(regex.fullmatch(r'(?firu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}', + 's-')), False) + self.assertEqual(bool(regex.fullmatch(r'(?firu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}', + '-s')), False) + + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}', + 'ssst')), True) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}', + 'ssts')), True) + self.assertEqual(bool(regex.fullmatch(r'(?firu)\1{e<=1:[a-z]}(\N{LATIN SMALL LETTER SHARP S})', + 'stss')), True) + self.assertEqual(bool(regex.fullmatch(r'(?firu)\1{e<=1:[a-z]}(\N{LATIN SMALL LETTER SHARP S})', + 'tsss')), True) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}', + 'ss-s')), False) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}', + 'sss-')), False) + self.assertEqual(bool(regex.fullmatch(r'(?firu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}', + '-s')), False) + self.assertEqual(bool(regex.fullmatch(r'(?firu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}', + 's-')), False) + + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(ss)\1{e<=1:[a-z]}', + '\N{LATIN SMALL LETTER SHARP S}ts')), True) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(ss)\1{e<=1:[a-z]}', + '\N{LATIN SMALL LETTER SHARP S}st')), True) + self.assertEqual(bool(regex.fullmatch(r'(?firu)\1{e<=1:[a-z]}(ss)', + 'st\N{LATIN SMALL LETTER SHARP S}')), True) + self.assertEqual(bool(regex.fullmatch(r'(?firu)\1{e<=1:[a-z]}(ss)', + 'ts\N{LATIN SMALL LETTER SHARP S}')), True) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(ss)\1{e<=1:[a-z]}', + '\N{LATIN SMALL LETTER SHARP S}-s')), False) + self.assertEqual(bool(regex.fullmatch(r'(?fiu)(ss)\1{e<=1:[a-z]}', + '\N{LATIN SMALL LETTER SHARP S}s-')), False) + self.assertEqual(bool(regex.fullmatch(r'(?firu)(ss)\1{e<=1:[a-z]}', + 's-\N{LATIN SMALL LETTER SHARP S}')), False) + self.assertEqual(bool(regex.fullmatch(r'(?firu)(ss)\1{e<=1:[a-z]}', + '-s\N{LATIN SMALL LETTER SHARP S}')), False) + + def test_subscripted_captures(self): + self.assertEqual(regex.match(r'(?P<x>.)+', + 'abc').expandf('{0} {0[0]} {0[-1]}'), 'abc abc abc') + self.assertEqual(regex.match(r'(?P<x>.)+', + 'abc').expandf('{1} {1[0]} {1[1]} {1[2]} {1[-1]} {1[-2]} {1[-3]}'), + 'c a b c c b a') + self.assertEqual(regex.match(r'(?P<x>.)+', + 'abc').expandf('{x} {x[0]} {x[1]} {x[2]} {x[-1]} {x[-2]} {x[-3]}'), + 'c a b c c b a') + + self.assertEqual(regex.subf(r'(?P<x>.)+', r'{0} {0[0]} {0[-1]}', + 'abc'), 'abc abc abc') + self.assertEqual(regex.subf(r'(?P<x>.)+', + '{1} {1[0]} {1[1]} {1[2]} {1[-1]} {1[-2]} {1[-3]}', 'abc'), + 'c a b c c b a') + self.assertEqual(regex.subf(r'(?P<x>.)+', + '{x} {x[0]} {x[1]} {x[2]} {x[-1]} {x[-2]} {x[-3]}', 'abc'), + 'c a b c c b a') + + def test_more_zerowidth(self): + if sys.version_info >= (3, 7, 0): + self.assertEqual(regex.split(r'\b|:+', 'a::bc'), ['', 'a', '', '', + 'bc', '']) + self.assertEqual(regex.sub(r'\b|:+', '-', 'a::bc'), '-a---bc-') + self.assertEqual(regex.findall(r'\b|:+', 'a::bc'), ['', '', '::', + '', '']) + self.assertEqual([m.span() for m in regex.finditer(r'\b|:+', + 'a::bc')], [(0, 0), (1, 1), (1, 3), (3, 3), (5, 5)]) + self.assertEqual([m.span() for m in regex.finditer(r'(?m)^\s*?$', + 'foo\n\n\nbar')], [(4, 4), (4, 5), (5, 5)]) + + def test_line_ending(self): + self.assertEqual(regex.findall(r'\R', '\r\n\n\x0B\f\r\x85\u2028\u2029'), + ['\r\n', '\n', '\x0B', '\f', '\r', '\x85', '\u2028', '\u2029']) + self.assertEqual(regex.findall(br'\R', b'\r\n\n\x0B\f\r\x85'), [b'\r\n', + b'\n', b'\x0B', b'\f', b'\r']) + +def test_main(): + unittest.main(verbosity=2) + +if __name__ == "__main__": + test_main() |