two version of R2R are hereHEADmaster

5 files changed, 9732 insertions, 0 deletions

diff --git a/.venv/lib/python3.12/site-packages/regex/__init__.py b/.venv/lib/python3.12/site-packages/regex/__init__.py
new file mode 100644
index 00000000..eb06564a
--- /dev/null
+++ b/.venv/lib/python3.12/site-packages/regex/__init__.py
@@ -0,0 +1,3 @@
+from .regex import *
+from . import regex
+__all__ = regex.__all__
diff --git a/.venv/lib/python3.12/site-packages/regex/_regex.cpython-312-x86_64-linux-gnu.so b/.venv/lib/python3.12/site-packages/regex/_regex.cpython-312-x86_64-linux-gnu.so
new file mode 100755
index 00000000..63eb3ae3
--- /dev/null
+++ b/.venv/lib/python3.12/site-packages/regex/_regex.cpython-312-x86_64-linux-gnu.so
diff --git a/.venv/lib/python3.12/site-packages/regex/_regex_core.py b/.venv/lib/python3.12/site-packages/regex/_regex_core.py
new file mode 100644
index 00000000..b2ffeaea
--- /dev/null
+++ b/.venv/lib/python3.12/site-packages/regex/_regex_core.py
@@ -0,0 +1,4495 @@
+#
+# Secret Labs' Regular Expression Engine core module
+#
+# Copyright (c) 1998-2001 by Secret Labs AB.  All rights reserved.
+#
+# This version of the SRE library can be redistributed under CNRI's
+# Python 1.6 license.  For any other use, please contact Secret Labs
+# AB (info@pythonware.com).
+#
+# Portions of this engine have been developed in cooperation with
+# CNRI.  Hewlett-Packard provided funding for 1.6 integration and
+# other compatibility work.
+#
+# 2010-01-16 mrab Python front-end re-written and extended
+
+import enum
+import string
+import unicodedata
+from collections import defaultdict
+
+import regex._regex as _regex
+
+__all__ = ["A", "ASCII", "B", "BESTMATCH", "D", "DEBUG", "E", "ENHANCEMATCH",
+  "F", "FULLCASE", "I", "IGNORECASE", "L", "LOCALE", "M", "MULTILINE", "P",
+  "POSIX", "R", "REVERSE", "S", "DOTALL", "T", "TEMPLATE", "U", "UNICODE",
+  "V0", "VERSION0", "V1", "VERSION1", "W", "WORD", "X", "VERBOSE", "error",
+  "Scanner", "RegexFlag"]
+
+# The regex exception.
+class error(Exception):
+    """Exception raised for invalid regular expressions.
+
+    Attributes:
+
+        msg: The unformatted error message
+        pattern: The regular expression pattern
+        pos: The position in the pattern where compilation failed, or None
+        lineno: The line number where compilation failed, unless pos is None
+        colno: The column number where compilation failed, unless pos is None
+    """
+
+    def __init__(self, message, pattern=None, pos=None):
+        newline = '\n' if isinstance(pattern, str) else b'\n'
+        self.msg = message
+        self.pattern = pattern
+        self.pos = pos
+        if pattern is not None and pos is not None:
+            self.lineno = pattern.count(newline, 0, pos) + 1
+            self.colno = pos - pattern.rfind(newline, 0, pos)
+
+            message = "{} at position {}".format(message, pos)
+
+            if newline in pattern:
+                message += " (line {}, column {})".format(self.lineno,
+                  self.colno)
+
+        Exception.__init__(self, message)
+
+# The exception for when a positional flag has been turned on in the old
+# behaviour.
+class _UnscopedFlagSet(Exception):
+    pass
+
+# The exception for when parsing fails and we want to try something else.
+class ParseError(Exception):
+    pass
+
+# The exception for when there isn't a valid first set.
+class _FirstSetError(Exception):
+    pass
+
+# Flags.
+class RegexFlag(enum.IntFlag):
+    A = ASCII = 0x80          # Assume ASCII locale.
+    B = BESTMATCH = 0x1000    # Best fuzzy match.
+    D = DEBUG = 0x200         # Print parsed pattern.
+    E = ENHANCEMATCH = 0x8000 # Attempt to improve the fit after finding the first
+                              # fuzzy match.
+    F = FULLCASE = 0x4000     # Unicode full case-folding.
+    I = IGNORECASE = 0x2      # Ignore case.
+    L = LOCALE = 0x4          # Assume current 8-bit locale.
+    M = MULTILINE = 0x8       # Make anchors look for newline.
+    P = POSIX = 0x10000       # POSIX-style matching (leftmost longest).
+    R = REVERSE = 0x400       # Search backwards.
+    S = DOTALL = 0x10         # Make dot match newline.
+    U = UNICODE = 0x20        # Assume Unicode locale.
+    V0 = VERSION0 = 0x2000    # Old legacy behaviour.
+    V1 = VERSION1 = 0x100     # New enhanced behaviour.
+    W = WORD = 0x800          # Default Unicode word breaks.
+    X = VERBOSE = 0x40        # Ignore whitespace and comments.
+    T = TEMPLATE = 0x1        # Template (present because re module has it).
+
+    def __repr__(self):
+        if self._name_ is not None:
+            return 'regex.%s' % self._name_
+
+        value = self._value_
+        members = []
+        negative = value < 0
+
+        if negative:
+            value = ~value
+
+        for m in self.__class__:
+            if value & m._value_:
+                value &= ~m._value_
+                members.append('regex.%s' % m._name_)
+
+        if value:
+            members.append(hex(value))
+
+        res = '|'.join(members)
+
+        if negative:
+            if len(members) > 1:
+                res = '~(%s)' % res
+            else:
+                res = '~%s' % res
+
+        return res
+
+    __str__ = object.__str__
+
+globals().update(RegexFlag.__members__)
+
+DEFAULT_VERSION = VERSION1
+
+_ALL_VERSIONS = VERSION0 | VERSION1
+_ALL_ENCODINGS = ASCII | LOCALE | UNICODE
+
+# The default flags for the various versions.
+DEFAULT_FLAGS = {VERSION0: 0, VERSION1: FULLCASE}
+
+# The mask for the flags.
+GLOBAL_FLAGS = (_ALL_VERSIONS | BESTMATCH | DEBUG | ENHANCEMATCH | POSIX |
+  REVERSE)
+SCOPED_FLAGS = (FULLCASE | IGNORECASE | MULTILINE | DOTALL | WORD | VERBOSE |
+  _ALL_ENCODINGS)
+
+ALPHA = frozenset(string.ascii_letters)
+DIGITS = frozenset(string.digits)
+ALNUM = ALPHA | DIGITS
+OCT_DIGITS = frozenset(string.octdigits)
+HEX_DIGITS = frozenset(string.hexdigits)
+SPECIAL_CHARS = frozenset("()|?*+{^$.[\\#") | frozenset([""])
+NAMED_CHAR_PART = ALNUM | frozenset(" -")
+PROPERTY_NAME_PART = ALNUM | frozenset(" &_-.")
+SET_OPS = ("||", "~~", "&&", "--")
+
+# The width of the code words inside the regex engine.
+BYTES_PER_CODE = _regex.get_code_size()
+BITS_PER_CODE = BYTES_PER_CODE * 8
+
+# The repeat count which represents infinity.
+UNLIMITED = (1 << BITS_PER_CODE) - 1
+
+# The regular expression flags.
+REGEX_FLAGS = {"a": ASCII, "b": BESTMATCH, "e": ENHANCEMATCH, "f": FULLCASE,
+  "i": IGNORECASE, "L": LOCALE, "m": MULTILINE, "p": POSIX, "r": REVERSE,
+  "s": DOTALL, "u": UNICODE, "V0": VERSION0, "V1": VERSION1, "w": WORD, "x":
+  VERBOSE}
+
+# The case flags.
+CASE_FLAGS = FULLCASE | IGNORECASE
+NOCASE = 0
+FULLIGNORECASE = FULLCASE | IGNORECASE
+
+FULL_CASE_FOLDING = UNICODE | FULLIGNORECASE
+
+CASE_FLAGS_COMBINATIONS = {0: 0, FULLCASE: 0, IGNORECASE: IGNORECASE,
+  FULLIGNORECASE: FULLIGNORECASE}
+
+# The number of digits in hexadecimal escapes.
+HEX_ESCAPES = {"x": 2, "u": 4, "U": 8}
+
+# The names of the opcodes.
+OPCODES = """
+FAILURE
+SUCCESS
+ANY
+ANY_ALL
+ANY_ALL_REV
+ANY_REV
+ANY_U
+ANY_U_REV
+ATOMIC
+BOUNDARY
+BRANCH
+CALL_REF
+CHARACTER
+CHARACTER_IGN
+CHARACTER_IGN_REV
+CHARACTER_REV
+CONDITIONAL
+DEFAULT_BOUNDARY
+DEFAULT_END_OF_WORD
+DEFAULT_START_OF_WORD
+END
+END_OF_LINE
+END_OF_LINE_U
+END_OF_STRING
+END_OF_STRING_LINE
+END_OF_STRING_LINE_U
+END_OF_WORD
+FUZZY
+GRAPHEME_BOUNDARY
+GREEDY_REPEAT
+GROUP
+GROUP_CALL
+GROUP_EXISTS
+KEEP
+LAZY_REPEAT
+LOOKAROUND
+NEXT
+PROPERTY
+PROPERTY_IGN
+PROPERTY_IGN_REV
+PROPERTY_REV
+PRUNE
+RANGE
+RANGE_IGN
+RANGE_IGN_REV
+RANGE_REV
+REF_GROUP
+REF_GROUP_FLD
+REF_GROUP_FLD_REV
+REF_GROUP_IGN
+REF_GROUP_IGN_REV
+REF_GROUP_REV
+SEARCH_ANCHOR
+SET_DIFF
+SET_DIFF_IGN
+SET_DIFF_IGN_REV
+SET_DIFF_REV
+SET_INTER
+SET_INTER_IGN
+SET_INTER_IGN_REV
+SET_INTER_REV
+SET_SYM_DIFF
+SET_SYM_DIFF_IGN
+SET_SYM_DIFF_IGN_REV
+SET_SYM_DIFF_REV
+SET_UNION
+SET_UNION_IGN
+SET_UNION_IGN_REV
+SET_UNION_REV
+SKIP
+START_OF_LINE
+START_OF_LINE_U
+START_OF_STRING
+START_OF_WORD
+STRING
+STRING_FLD
+STRING_FLD_REV
+STRING_IGN
+STRING_IGN_REV
+STRING_REV
+FUZZY_EXT
+"""
+
+# Define the opcodes in a namespace.
+class Namespace:
+    pass
+
+OP = Namespace()
+for i, op in enumerate(OPCODES.split()):
+    setattr(OP, op, i)
+
+def _shrink_cache(cache_dict, args_dict, locale_sensitive, max_length, divisor=5):
+    """Make room in the given cache.
+
+    Args:
+        cache_dict: The cache dictionary to modify.
+        args_dict: The dictionary of named list args used by patterns.
+        max_length: Maximum # of entries in cache_dict before it is shrunk.
+        divisor: Cache will shrink to max_length - 1/divisor*max_length items.
+    """
+    # Toss out a fraction of the entries at random to make room for new ones.
+    # A random algorithm was chosen as opposed to simply cache_dict.popitem()
+    # as popitem could penalize the same regular expression repeatedly based
+    # on its internal hash value.  Being random should spread the cache miss
+    # love around.
+    cache_keys = tuple(cache_dict.keys())
+    overage = len(cache_keys) - max_length
+    if overage < 0:
+        # Cache is already within limits.  Normally this should not happen
+        # but it could due to multithreading.
+        return
+
+    number_to_toss = max_length // divisor + overage
+
+    # The import is done here to avoid a circular dependency.
+    import random
+    if not hasattr(random, 'sample'):
+        # Do nothing while resolving the circular dependency:
+        #  re->random->warnings->tokenize->string->re
+        return
+
+    for doomed_key in random.sample(cache_keys, number_to_toss):
+        try:
+            del cache_dict[doomed_key]
+        except KeyError:
+            # Ignore problems if the cache changed from another thread.
+            pass
+
+    # Rebuild the arguments and locale-sensitivity dictionaries.
+    args_dict.clear()
+    sensitivity_dict = {}
+    for pattern, pattern_type, flags, args, default_version, locale in tuple(cache_dict):
+        args_dict[pattern, pattern_type, flags, default_version, locale] = args
+        try:
+            sensitivity_dict[pattern_type, pattern] = locale_sensitive[pattern_type, pattern]
+        except KeyError:
+            pass
+
+    locale_sensitive.clear()
+    locale_sensitive.update(sensitivity_dict)
+
+def _fold_case(info, string):
+    "Folds the case of a string."
+    flags = info.flags
+    if (flags & _ALL_ENCODINGS) == 0:
+        flags |= info.guess_encoding
+
+    return _regex.fold_case(flags, string)
+
+def is_cased_i(info, char):
+    "Checks whether a character is cased."
+    return len(_regex.get_all_cases(info.flags, char)) > 1
+
+def is_cased_f(flags, char):
+    "Checks whether a character is cased."
+    return len(_regex.get_all_cases(flags, char)) > 1
+
+def _compile_firstset(info, fs):
+    "Compiles the firstset for the pattern."
+    reverse = bool(info.flags & REVERSE)
+    fs = _check_firstset(info, reverse, fs)
+    if not fs:
+        return []
+
+    # Compile the firstset.
+    return fs.compile(reverse)
+
+def _check_firstset(info, reverse, fs):
+    "Checks the firstset for the pattern."
+    if not fs or None in fs:
+        return None
+
+    # If we ignore the case, for simplicity we won't build a firstset.
+    members = set()
+    case_flags = NOCASE
+    for i in fs:
+        if isinstance(i, Character) and not i.positive:
+            return None
+
+#        if i.case_flags:
+#            if isinstance(i, Character):
+#                if is_cased_i(info, i.value):
+#                    return []
+#            elif isinstance(i, SetBase):
+#                return []
+        case_flags |= i.case_flags
+        members.add(i.with_flags(case_flags=NOCASE))
+
+    if case_flags == (FULLCASE | IGNORECASE):
+        return None
+
+    # Build the firstset.
+    fs = SetUnion(info, list(members), case_flags=case_flags & ~FULLCASE,
+      zerowidth=True)
+    fs = fs.optimise(info, reverse, in_set=True)
+
+    return fs
+
+def _flatten_code(code):
+    "Flattens the code from a list of tuples."
+    flat_code = []
+    for c in code:
+        flat_code.extend(c)
+
+    return flat_code
+
+def make_case_flags(info):
+    "Makes the case flags."
+    flags = info.flags & CASE_FLAGS
+
+    # Turn off FULLCASE if ASCII is turned on.
+    if info.flags & ASCII:
+        flags &= ~FULLCASE
+
+    return flags
+
+def make_character(info, value, in_set=False):
+    "Makes a character literal."
+    if in_set:
+        # A character set is built case-sensitively.
+        return Character(value)
+
+    return Character(value, case_flags=make_case_flags(info))
+
+def make_ref_group(info, name, position):
+    "Makes a group reference."
+    return RefGroup(info, name, position, case_flags=make_case_flags(info))
+
+def make_string_set(info, name):
+    "Makes a string set."
+    return StringSet(info, name, case_flags=make_case_flags(info))
+
+def make_property(info, prop, in_set):
+    "Makes a property."
+    if in_set:
+        return prop
+
+    return prop.with_flags(case_flags=make_case_flags(info))
+
+def _parse_pattern(source, info):
+    "Parses a pattern, eg. 'a|b|c'."
+    branches = [parse_sequence(source, info)]
+    while source.match("|"):
+        branches.append(parse_sequence(source, info))
+
+    if len(branches) == 1:
+        return branches[0]
+    return Branch(branches)
+
+def parse_sequence(source, info):
+    "Parses a sequence, eg. 'abc'."
+    sequence = [None]
+    case_flags = make_case_flags(info)
+    while True:
+        saved_pos = source.pos
+        ch = source.get()
+        if ch in SPECIAL_CHARS:
+            if ch in ")|":
+                # The end of a sequence. At the end of the pattern ch is "".
+                source.pos = saved_pos
+                break
+            elif ch == "\\":
+                # An escape sequence outside a set.
+                sequence.append(parse_escape(source, info, False))
+            elif ch == "(":
+                # A parenthesised subpattern or a flag.
+                element = parse_paren(source, info)
+                if element is None:
+                    case_flags = make_case_flags(info)
+                else:
+                    sequence.append(element)
+            elif ch == ".":
+                # Any character.
+                if info.flags & DOTALL:
+                    sequence.append(AnyAll())
+                elif info.flags & WORD:
+                    sequence.append(AnyU())
+                else:
+                    sequence.append(Any())
+            elif ch == "[":
+                # A character set.
+                sequence.append(parse_set(source, info))
+            elif ch == "^":
+                # The start of a line or the string.
+                if info.flags & MULTILINE:
+                    if info.flags & WORD:
+                        sequence.append(StartOfLineU())
+                    else:
+                        sequence.append(StartOfLine())
+                else:
+                    sequence.append(StartOfString())
+            elif ch == "$":
+                # The end of a line or the string.
+                if info.flags & MULTILINE:
+                    if info.flags & WORD:
+                        sequence.append(EndOfLineU())
+                    else:
+                        sequence.append(EndOfLine())
+                else:
+                    if info.flags & WORD:
+                        sequence.append(EndOfStringLineU())
+                    else:
+                        sequence.append(EndOfStringLine())
+            elif ch in "?*+{":
+                # Looks like a quantifier.
+                counts = parse_quantifier(source, info, ch)
+                if counts:
+                    # It _is_ a quantifier.
+                    apply_quantifier(source, info, counts, case_flags, ch,
+                      saved_pos, sequence)
+                    sequence.append(None)
+                else:
+                    # It's not a quantifier. Maybe it's a fuzzy constraint.
+                    constraints = parse_fuzzy(source, info, ch, case_flags)
+                    if constraints:
+                        # It _is_ a fuzzy constraint.
+                        apply_constraint(source, info, constraints, case_flags,
+                          saved_pos, sequence)
+                        sequence.append(None)
+                    else:
+                        # The element was just a literal.
+                        sequence.append(Character(ord(ch),
+                          case_flags=case_flags))
+            else:
+                # A literal.
+                sequence.append(Character(ord(ch), case_flags=case_flags))
+        else:
+            # A literal.
+            sequence.append(Character(ord(ch), case_flags=case_flags))
+
+    sequence = [item for item in sequence if item is not None]
+    return Sequence(sequence)
+
+def apply_quantifier(source, info, counts, case_flags, ch, saved_pos,
+  sequence):
+    element = sequence.pop()
+    if element is None:
+        if sequence:
+            raise error("multiple repeat", source.string, saved_pos)
+        raise error("nothing to repeat", source.string, saved_pos)
+
+    if isinstance(element, (GreedyRepeat, LazyRepeat, PossessiveRepeat)):
+        raise error("multiple repeat", source.string, saved_pos)
+
+    min_count, max_count = counts
+    saved_pos = source.pos
+    ch = source.get()
+    if ch == "?":
+        # The "?" suffix that means it's a lazy repeat.
+        repeated = LazyRepeat
+    elif ch == "+":
+        # The "+" suffix that means it's a possessive repeat.
+        repeated = PossessiveRepeat
+    else:
+        # No suffix means that it's a greedy repeat.
+        source.pos = saved_pos
+        repeated = GreedyRepeat
+
+    # Ignore the quantifier if it applies to a zero-width item or the number of
+    # repeats is fixed at 1.
+    if not element.is_empty() and (min_count != 1 or max_count != 1):
+        element = repeated(element, min_count, max_count)
+
+    sequence.append(element)
+
+def apply_constraint(source, info, constraints, case_flags, saved_pos,
+  sequence):
+    element = sequence.pop()
+    if element is None:
+        raise error("nothing for fuzzy constraint", source.string, saved_pos)
+
+    # If a group is marked as fuzzy then put all of the fuzzy part in the
+    # group.
+    if isinstance(element, Group):
+        element.subpattern = Fuzzy(element.subpattern, constraints)
+        sequence.append(element)
+    else:
+        sequence.append(Fuzzy(element, constraints))
+
+_QUANTIFIERS = {"?": (0, 1), "*": (0, None), "+": (1, None)}
+
+def parse_quantifier(source, info, ch):
+    "Parses a quantifier."
+    q = _QUANTIFIERS.get(ch)
+    if q:
+        # It's a quantifier.
+        return q
+
+    if ch == "{":
+        # Looks like a limited repeated element, eg. 'a{2,3}'.
+        counts = parse_limited_quantifier(source)
+        if counts:
+            return counts
+
+    return None
+
+def is_above_limit(count):
+    "Checks whether a count is above the maximum."
+    return count is not None and count >= UNLIMITED
+
+def parse_limited_quantifier(source):
+    "Parses a limited quantifier."
+    saved_pos = source.pos
+    min_count = parse_count(source)
+    if source.match(","):
+        max_count = parse_count(source)
+
+        # No minimum means 0 and no maximum means unlimited.
+        min_count = int(min_count or 0)
+        max_count = int(max_count) if max_count else None
+    else:
+        if not min_count:
+            source.pos = saved_pos
+            return None
+
+        min_count = max_count = int(min_count)
+
+    if not source.match ("}"):
+        source.pos = saved_pos
+        return None
+
+    if is_above_limit(min_count) or is_above_limit(max_count):
+        raise error("repeat count too big", source.string, saved_pos)
+
+    if max_count is not None and min_count > max_count:
+        raise error("min repeat greater than max repeat", source.string,
+          saved_pos)
+
+    return min_count, max_count
+
+def parse_fuzzy(source, info, ch, case_flags):
+    "Parses a fuzzy setting, if present."
+    saved_pos = source.pos
+
+    if ch != "{":
+        return None
+
+    constraints = {}
+    try:
+        parse_fuzzy_item(source, constraints)
+        while source.match(","):
+            parse_fuzzy_item(source, constraints)
+    except ParseError:
+        source.pos = saved_pos
+        return None
+
+    if source.match(":"):
+        constraints["test"] = parse_fuzzy_test(source, info, case_flags)
+
+    if not source.match("}"):
+        raise error("expected }", source.string, source.pos)
+
+    return constraints
+
+def parse_fuzzy_item(source, constraints):
+    "Parses a fuzzy setting item."
+    saved_pos = source.pos
+    try:
+        parse_cost_constraint(source, constraints)
+    except ParseError:
+        source.pos = saved_pos
+
+        parse_cost_equation(source, constraints)
+
+def parse_cost_constraint(source, constraints):
+    "Parses a cost constraint."
+    saved_pos = source.pos
+    ch = source.get()
+    if ch in ALPHA:
+        # Syntax: constraint [("<=" | "<") cost]
+        constraint = parse_constraint(source, constraints, ch)
+
+        max_inc = parse_fuzzy_compare(source)
+
+        if max_inc is None:
+            # No maximum cost.
+            constraints[constraint] = 0, None
+        else:
+            # There's a maximum cost.
+            cost_pos = source.pos
+            max_cost = parse_cost_limit(source)
+
+            # Inclusive or exclusive limit?
+            if not max_inc:
+                max_cost -= 1
+
+            if max_cost < 0:
+                raise error("bad fuzzy cost limit", source.string, cost_pos)
+
+            constraints[constraint] = 0, max_cost
+    elif ch in DIGITS:
+        # Syntax: cost ("<=" | "<") constraint ("<=" | "<") cost
+        source.pos = saved_pos
+
+        # Minimum cost.
+        cost_pos = source.pos
+        min_cost = parse_cost_limit(source)
+
+        min_inc = parse_fuzzy_compare(source)
+        if min_inc is None:
+            raise ParseError()
+
+        constraint = parse_constraint(source, constraints, source.get())
+
+        max_inc = parse_fuzzy_compare(source)
+        if max_inc is None:
+            raise ParseError()
+
+        # Maximum cost.
+        cost_pos = source.pos
+        max_cost = parse_cost_limit(source)
+
+        # Inclusive or exclusive limits?
+        if not min_inc:
+            min_cost += 1
+        if not max_inc:
+            max_cost -= 1
+
+        if not 0 <= min_cost <= max_cost:
+            raise error("bad fuzzy cost limit", source.string, cost_pos)
+
+        constraints[constraint] = min_cost, max_cost
+    else:
+        raise ParseError()
+
+def parse_cost_limit(source):
+    "Parses a cost limit."
+    cost_pos = source.pos
+    digits = parse_count(source)
+
+    try:
+        return int(digits)
+    except ValueError:
+        pass
+
+    raise error("bad fuzzy cost limit", source.string, cost_pos)
+
+def parse_constraint(source, constraints, ch):
+    "Parses a constraint."
+    if ch not in "deis":
+        raise ParseError()
+
+    if ch in constraints:
+        raise ParseError()
+
+    return ch
+
+def parse_fuzzy_compare(source):
+    "Parses a cost comparator."
+    if source.match("<="):
+        return True
+    elif source.match("<"):
+        return False
+    else:
+        return None
+
+def parse_cost_equation(source, constraints):
+    "Parses a cost equation."
+    if "cost" in constraints:
+        raise error("more than one cost equation", source.string, source.pos)
+
+    cost = {}
+
+    parse_cost_term(source, cost)
+    while source.match("+"):
+        parse_cost_term(source, cost)
+
+    max_inc = parse_fuzzy_compare(source)
+    if max_inc is None:
+        raise ParseError()
+
+    max_cost = int(parse_count(source))
+
+    if not max_inc:
+        max_cost -= 1
+
+    if max_cost < 0:
+        raise error("bad fuzzy cost limit", source.string, source.pos)
+
+    cost["max"] = max_cost
+
+    constraints["cost"] = cost
+
+def parse_cost_term(source, cost):
+    "Parses a cost equation term."
+    coeff = parse_count(source)
+    ch = source.get()
+    if ch not in "dis":
+        raise ParseError()
+
+    if ch in cost:
+        raise error("repeated fuzzy cost", source.string, source.pos)
+
+    cost[ch] = int(coeff or 1)
+
+def parse_fuzzy_test(source, info, case_flags):
+    saved_pos = source.pos
+    ch = source.get()
+    if ch in SPECIAL_CHARS:
+        if ch == "\\":
+            # An escape sequence outside a set.
+            return parse_escape(source, info, False)
+        elif ch == ".":
+            # Any character.
+            if info.flags & DOTALL:
+                return AnyAll()
+            elif info.flags & WORD:
+                return AnyU()
+            else:
+                return Any()
+        elif ch == "[":
+            # A character set.
+            return parse_set(source, info)
+        else:
+            raise error("expected character set", source.string, saved_pos)
+    elif ch:
+        # A literal.
+        return Character(ord(ch), case_flags=case_flags)
+    else:
+        raise error("expected character set", source.string, saved_pos)
+
+def parse_count(source):
+    "Parses a quantifier's count, which can be empty."
+    return source.get_while(DIGITS)
+
+def parse_paren(source, info):
+    """Parses a parenthesised subpattern or a flag. Returns FLAGS if it's an
+    inline flag.
+    """
+    saved_pos = source.pos
+    ch = source.get(True)
+    if ch == "?":
+        # (?...
+        saved_pos_2 = source.pos
+        ch = source.get(True)
+        if ch == "<":
+            # (?<...
+            saved_pos_3 = source.pos
+            ch = source.get()
+            if ch in ("=", "!"):
+                # (?<=... or (?<!...: lookbehind.
+                return parse_lookaround(source, info, True, ch == "=")
+
+            # (?<...: a named capture group.
+            source.pos = saved_pos_3
+            name = parse_name(source)
+            group = info.open_group(name)
+            source.expect(">")
+            saved_flags = info.flags
+            try:
+                subpattern = _parse_pattern(source, info)
+                source.expect(")")
+            finally:
+                info.flags = saved_flags
+                source.ignore_space = bool(info.flags & VERBOSE)
+
+            info.close_group()
+            return Group(info, group, subpattern)
+        if ch in ("=", "!"):
+            # (?=... or (?!...: lookahead.
+            return parse_lookaround(source, info, False, ch == "=")
+        if ch == "P":
+            # (?P...: a Python extension.
+            return parse_extension(source, info)
+        if ch == "#":
+            # (?#...: a comment.
+            return parse_comment(source)
+        if ch == "(":
+            # (?(...: a conditional subpattern.
+            return parse_conditional(source, info)
+        if ch == ">":
+            # (?>...: an atomic subpattern.
+            return parse_atomic(source, info)
+        if ch == "|":
+            # (?|...: a common/reset groups branch.
+            return parse_common(source, info)
+        if ch == "R" or "0" <= ch <= "9":
+            # (?R...: probably a call to a group.
+            return parse_call_group(source, info, ch, saved_pos_2)
+        if ch == "&":
+            # (?&...: a call to a named group.
+            return parse_call_named_group(source, info, saved_pos_2)
+
+        # (?...: probably a flags subpattern.
+        source.pos = saved_pos_2
+        return parse_flags_subpattern(source, info)
+
+    if ch == "*":
+        # (*...
+        saved_pos_2 = source.pos
+        word = source.get_while(set(")>"), include=False)
+        if word[ : 1].isalpha():
+            verb = VERBS.get(word)
+            if not verb:
+                raise error("unknown verb", source.string, saved_pos_2)
+
+            source.expect(")")
+
+            return verb
+
+    # (...: an unnamed capture group.
+    source.pos = saved_pos
+    group = info.open_group()
+    saved_flags = info.flags
+    try:
+        subpattern = _parse_pattern(source, info)
+        source.expect(")")
+    finally:
+        info.flags = saved_flags
+        source.ignore_space = bool(info.flags & VERBOSE)
+
+    info.close_group()
+
+    return Group(info, group, subpattern)
+
+def parse_extension(source, info):
+    "Parses a Python extension."
+    saved_pos = source.pos
+    ch = source.get()
+    if ch == "<":
+        # (?P<...: a named capture group.
+        name = parse_name(source)
+        group = info.open_group(name)
+        source.expect(">")
+        saved_flags = info.flags
+        try:
+            subpattern = _parse_pattern(source, info)
+            source.expect(")")
+        finally:
+            info.flags = saved_flags
+            source.ignore_space = bool(info.flags & VERBOSE)
+
+        info.close_group()
+
+        return Group(info, group, subpattern)
+    if ch == "=":
+        # (?P=...: a named group reference.
+        name = parse_name(source, allow_numeric=True)
+        source.expect(")")
+        if info.is_open_group(name):
+            raise error("cannot refer to an open group", source.string,
+              saved_pos)
+
+        return make_ref_group(info, name, saved_pos)
+    if ch == ">" or ch == "&":
+        # (?P>...: a call to a group.
+        return parse_call_named_group(source, info, saved_pos)
+
+    source.pos = saved_pos
+    raise error("unknown extension", source.string, saved_pos)
+
+def parse_comment(source):
+    "Parses a comment."
+    while True:
+        saved_pos = source.pos
+        c = source.get(True)
+
+        if not c or c == ")":
+            break
+
+        if c == "\\":
+            c = source.get(True)
+
+    source.pos = saved_pos
+    source.expect(")")
+
+    return None
+
+def parse_lookaround(source, info, behind, positive):
+    "Parses a lookaround."
+    saved_flags = info.flags
+    try:
+        subpattern = _parse_pattern(source, info)
+        source.expect(")")
+    finally:
+        info.flags = saved_flags
+        source.ignore_space = bool(info.flags & VERBOSE)
+
+    return LookAround(behind, positive, subpattern)
+
+def parse_conditional(source, info):
+    "Parses a conditional subpattern."
+    saved_flags = info.flags
+    saved_pos = source.pos
+    ch = source.get()
+    if ch == "?":
+        # (?(?...
+        ch = source.get()
+        if ch in ("=", "!"):
+            # (?(?=... or (?(?!...: lookahead conditional.
+            return parse_lookaround_conditional(source, info, False, ch == "=")
+        if ch == "<":
+            # (?(?<...
+            ch = source.get()
+            if ch in ("=", "!"):
+                # (?(?<=... or (?(?<!...: lookbehind conditional.
+                return parse_lookaround_conditional(source, info, True, ch ==
+                  "=")
+
+        source.pos = saved_pos
+        raise error("expected lookaround conditional", source.string,
+          source.pos)
+
+    source.pos = saved_pos
+    try:
+        group = parse_name(source, True)
+        source.expect(")")
+        yes_branch = parse_sequence(source, info)
+        if source.match("|"):
+            no_branch = parse_sequence(source, info)
+        else:
+            no_branch = Sequence()
+
+        source.expect(")")
+    finally:
+        info.flags = saved_flags
+        source.ignore_space = bool(info.flags & VERBOSE)
+
+    if yes_branch.is_empty() and no_branch.is_empty():
+        return Sequence()
+
+    return Conditional(info, group, yes_branch, no_branch, saved_pos)
+
+def parse_lookaround_conditional(source, info, behind, positive):
+    saved_flags = info.flags
+    try:
+        subpattern = _parse_pattern(source, info)
+        source.expect(")")
+    finally:
+        info.flags = saved_flags
+        source.ignore_space = bool(info.flags & VERBOSE)
+
+    yes_branch = parse_sequence(source, info)
+    if source.match("|"):
+        no_branch = parse_sequence(source, info)
+    else:
+        no_branch = Sequence()
+
+    source.expect(")")
+
+    return LookAroundConditional(behind, positive, subpattern, yes_branch,
+      no_branch)
+
+def parse_atomic(source, info):
+    "Parses an atomic subpattern."
+    saved_flags = info.flags
+    try:
+        subpattern = _parse_pattern(source, info)
+        source.expect(")")
+    finally:
+        info.flags = saved_flags
+        source.ignore_space = bool(info.flags & VERBOSE)
+
+    return Atomic(subpattern)
+
+def parse_common(source, info):
+    "Parses a common groups branch."
+    # Capture group numbers in different branches can reuse the group numbers.
+    initial_group_count = info.group_count
+    branches = [parse_sequence(source, info)]
+    final_group_count = info.group_count
+    while source.match("|"):
+        info.group_count = initial_group_count
+        branches.append(parse_sequence(source, info))
+        final_group_count = max(final_group_count, info.group_count)
+
+    info.group_count = final_group_count
+    source.expect(")")
+
+    if len(branches) == 1:
+        return branches[0]
+    return Branch(branches)
+
+def parse_call_group(source, info, ch, pos):
+    "Parses a call to a group."
+    if ch == "R":
+        group = "0"
+    else:
+        group = ch + source.get_while(DIGITS)
+
+    source.expect(")")
+
+    return CallGroup(info, group, pos)
+
+def parse_call_named_group(source, info, pos):
+    "Parses a call to a named group."
+    group = parse_name(source)
+    source.expect(")")
+
+    return CallGroup(info, group, pos)
+
+def parse_flag_set(source):
+    "Parses a set of inline flags."
+    flags = 0
+
+    try:
+        while True:
+            saved_pos = source.pos
+            ch = source.get()
+            if ch == "V":
+                ch += source.get()
+            flags |= REGEX_FLAGS[ch]
+    except KeyError:
+        source.pos = saved_pos
+
+    return flags
+
+def parse_flags(source, info):
+    "Parses flags being turned on/off."
+    flags_on = parse_flag_set(source)
+    if source.match("-"):
+        flags_off = parse_flag_set(source)
+        if not flags_off:
+            raise error("bad inline flags: no flags after '-'", source.string,
+              source.pos)
+    else:
+        flags_off = 0
+
+    if flags_on & LOCALE:
+        # Remember that this pattern as an inline locale flag.
+        info.inline_locale = True
+
+    return flags_on, flags_off
+
+def parse_subpattern(source, info, flags_on, flags_off):
+    "Parses a subpattern with scoped flags."
+    saved_flags = info.flags
+    info.flags = (info.flags | flags_on) & ~flags_off
+    source.ignore_space = bool(info.flags & VERBOSE)
+    try:
+        subpattern = _parse_pattern(source, info)
+        source.expect(")")
+    finally:
+        info.flags = saved_flags
+        source.ignore_space = bool(info.flags & VERBOSE)
+
+    return subpattern
+
+def parse_flags_subpattern(source, info):
+    """Parses a flags subpattern. It could be inline flags or a subpattern
+    possibly with local flags. If it's a subpattern, then that's returned;
+    if it's a inline flags, then None is returned.
+    """
+    flags_on, flags_off = parse_flags(source, info)
+
+    if flags_off & GLOBAL_FLAGS:
+        raise error("bad inline flags: cannot turn off global flag",
+          source.string, source.pos)
+
+    if flags_on & flags_off:
+        raise error("bad inline flags: flag turned on and off", source.string,
+          source.pos)
+
+    # Handle flags which are global in all regex behaviours.
+    new_global_flags = (flags_on & ~info.global_flags) & GLOBAL_FLAGS
+    if new_global_flags:
+        info.global_flags |= new_global_flags
+
+        # A global has been turned on, so reparse the pattern.
+        raise _UnscopedFlagSet(info.global_flags)
+
+    # Ensure that from now on we have only scoped flags.
+    flags_on &= ~GLOBAL_FLAGS
+
+    if source.match(":"):
+        return parse_subpattern(source, info, flags_on, flags_off)
+
+    if source.match(")"):
+        parse_positional_flags(source, info, flags_on, flags_off)
+        return None
+
+    raise error("unknown extension", source.string, source.pos)
+
+def parse_positional_flags(source, info, flags_on, flags_off):
+    "Parses positional flags."
+    info.flags = (info.flags | flags_on) & ~flags_off
+    source.ignore_space = bool(info.flags & VERBOSE)
+
+def parse_name(source, allow_numeric=False, allow_group_0=False):
+    "Parses a name."
+    name = source.get_while(set(")>"), include=False)
+
+    if not name:
+        raise error("missing group name", source.string, source.pos)
+
+    if name.isdigit():
+        min_group = 0 if allow_group_0 else 1
+        if not allow_numeric or int(name) < min_group:
+            raise error("bad character in group name", source.string,
+              source.pos)
+    else:
+        if not name.isidentifier():
+            raise error("bad character in group name", source.string,
+              source.pos)
+
+    return name
+
+def is_octal(string):
+    "Checks whether a string is octal."
+    return all(ch in OCT_DIGITS for ch in string)
+
+def is_decimal(string):
+    "Checks whether a string is decimal."
+    return all(ch in DIGITS for ch in string)
+
+def is_hexadecimal(string):
+    "Checks whether a string is hexadecimal."
+    return all(ch in HEX_DIGITS for ch in string)
+
+def parse_escape(source, info, in_set):
+    "Parses an escape sequence."
+    saved_ignore = source.ignore_space
+    source.ignore_space = False
+    ch = source.get()
+    source.ignore_space = saved_ignore
+    if not ch:
+        # A backslash at the end of the pattern.
+        raise error("bad escape (end of pattern)", source.string, source.pos)
+    if ch in HEX_ESCAPES:
+        # A hexadecimal escape sequence.
+        return parse_hex_escape(source, info, ch, HEX_ESCAPES[ch], in_set, ch)
+    elif ch == "g" and not in_set:
+        # A group reference.
+        saved_pos = source.pos
+        try:
+            return parse_group_ref(source, info)
+        except error:
+            # Invalid as a group reference, so assume it's a literal.
+            source.pos = saved_pos
+
+        return make_character(info, ord(ch), in_set)
+    elif ch == "G" and not in_set:
+        # A search anchor.
+        return SearchAnchor()
+    elif ch == "L" and not in_set:
+        # A string set.
+        return parse_string_set(source, info)
+    elif ch == "N":
+        # A named codepoint.
+        return parse_named_char(source, info, in_set)
+    elif ch in "pP":
+        # A Unicode property, positive or negative.
+        return parse_property(source, info, ch == "p", in_set)
+    elif ch == "R" and not in_set:
+        # A line ending.
+        charset = [0x0A, 0x0B, 0x0C, 0x0D]
+        if info.guess_encoding == UNICODE:
+            charset.extend([0x85, 0x2028, 0x2029])
+
+        return Atomic(Branch([String([0x0D, 0x0A]), SetUnion(info, [Character(c)
+          for c in charset])]))
+    elif ch == "X" and not in_set:
+        # A grapheme cluster.
+        return Grapheme()
+    elif ch in ALPHA:
+        # An alphabetic escape sequence.
+        # Positional escapes aren't allowed inside a character set.
+        if not in_set:
+            if info.flags & WORD:
+                value = WORD_POSITION_ESCAPES.get(ch)
+            else:
+                value = POSITION_ESCAPES.get(ch)
+
+            if value:
+                return value
+
+        value = CHARSET_ESCAPES.get(ch)
+        if value:
+            return value
+
+        value = CHARACTER_ESCAPES.get(ch)
+        if value:
+            return Character(ord(value))
+
+        raise error("bad escape \\%s" % ch, source.string, source.pos)
+    elif ch in DIGITS:
+        # A numeric escape sequence.
+        return parse_numeric_escape(source, info, ch, in_set)
+    else:
+        # A literal.
+        return make_character(info, ord(ch), in_set)
+
+def parse_numeric_escape(source, info, ch, in_set):
+    "Parses a numeric escape sequence."
+    if in_set or ch == "0":
+        # Octal escape sequence, max 3 digits.
+        return parse_octal_escape(source, info, [ch], in_set)
+
+    # At least 1 digit, so either octal escape or group.
+    digits = ch
+    saved_pos = source.pos
+    ch = source.get()
+    if ch in DIGITS:
+        # At least 2 digits, so either octal escape or group.
+        digits += ch
+        saved_pos = source.pos
+        ch = source.get()
+        if is_octal(digits) and ch in OCT_DIGITS:
+            # 3 octal digits, so octal escape sequence.
+            encoding = info.flags & _ALL_ENCODINGS
+            if encoding == ASCII or encoding == LOCALE:
+                octal_mask = 0xFF
+            else:
+                octal_mask = 0x1FF
+
+            value = int(digits + ch, 8) & octal_mask
+            return make_character(info, value)
+
+    # Group reference.
+    source.pos = saved_pos
+    if info.is_open_group(digits):
+        raise error("cannot refer to an open group", source.string, source.pos)
+
+    return make_ref_group(info, digits, source.pos)
+
+def parse_octal_escape(source, info, digits, in_set):
+    "Parses an octal escape sequence."
+    saved_pos = source.pos
+    ch = source.get()
+    while len(digits) < 3 and ch in OCT_DIGITS:
+        digits.append(ch)
+        saved_pos = source.pos
+        ch = source.get()
+
+    source.pos = saved_pos
+    try:
+        value = int("".join(digits), 8)
+        return make_character(info, value, in_set)
+    except ValueError:
+        if digits[0] in OCT_DIGITS:
+            raise error("incomplete escape \\%s" % ''.join(digits),
+              source.string, source.pos)
+        else:
+            raise error("bad escape \\%s" % digits[0], source.string,
+              source.pos)
+
+def parse_hex_escape(source, info, esc, expected_len, in_set, type):
+    "Parses a hex escape sequence."
+    saved_pos = source.pos
+    digits = []
+    for i in range(expected_len):
+        ch = source.get()
+        if ch not in HEX_DIGITS:
+            raise error("incomplete escape \\%s%s" % (type, ''.join(digits)),
+              source.string, saved_pos)
+        digits.append(ch)
+
+    try:
+        value = int("".join(digits), 16)
+    except ValueError:
+        pass
+    else:
+        if value < 0x110000:
+            return make_character(info, value, in_set)
+
+    # Bad hex escape.
+    raise error("bad hex escape \\%s%s" % (esc, ''.join(digits)),
+      source.string, saved_pos)
+
+def parse_group_ref(source, info):
+    "Parses a group reference."
+    source.expect("<")
+    saved_pos = source.pos
+    name = parse_name(source, True)
+    source.expect(">")
+    if info.is_open_group(name):
+        raise error("cannot refer to an open group", source.string, source.pos)
+
+    return make_ref_group(info, name, saved_pos)
+
+def parse_string_set(source, info):
+    "Parses a string set reference."
+    source.expect("<")
+    name = parse_name(source, True)
+    source.expect(">")
+    if name is None or name not in info.kwargs:
+        raise error("undefined named list", source.string, source.pos)
+
+    return make_string_set(info, name)
+
+def parse_named_char(source, info, in_set):
+    "Parses a named character."
+    saved_pos = source.pos
+    if source.match("{"):
+        name = source.get_while(NAMED_CHAR_PART, keep_spaces=True)
+        if source.match("}"):
+            try:
+                value = unicodedata.lookup(name)
+                return make_character(info, ord(value), in_set)
+            except KeyError:
+                raise error("undefined character name", source.string,
+                  source.pos)
+
+    source.pos = saved_pos
+    return make_character(info, ord("N"), in_set)
+
+def parse_property(source, info, positive, in_set):
+    "Parses a Unicode property."
+    saved_pos = source.pos
+    ch = source.get()
+    if ch == "{":
+        negate = source.match("^")
+        prop_name, name = parse_property_name(source)
+        if source.match("}"):
+            # It's correctly delimited.
+            prop = lookup_property(prop_name, name, positive != negate, source)
+            return make_property(info, prop, in_set)
+    elif ch and ch in "CLMNPSZ":
+        # An abbreviated property, eg \pL.
+        prop = lookup_property(None, ch, positive, source)
+        return make_property(info, prop, in_set)
+
+    # Not a property, so treat as a literal "p" or "P".
+    source.pos = saved_pos
+    ch = "p" if positive else "P"
+    return make_character(info, ord(ch), in_set)
+
+def parse_property_name(source):
+    "Parses a property name, which may be qualified."
+    name = source.get_while(PROPERTY_NAME_PART)
+    saved_pos = source.pos
+
+    ch = source.get()
+    if ch and ch in ":=":
+        prop_name = name
+        name = source.get_while(ALNUM | set(" &_-./")).strip()
+
+        if name:
+            # Name after the ":" or "=", so it's a qualified name.
+            saved_pos = source.pos
+        else:
+            # No name after the ":" or "=", so assume it's an unqualified name.
+            prop_name, name = None, prop_name
+    else:
+        prop_name = None
+
+    source.pos = saved_pos
+    return prop_name, name
+
+def parse_set(source, info):
+    "Parses a character set."
+    version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION
+
+    saved_ignore = source.ignore_space
+    source.ignore_space = False
+    # Negative set?
+    negate = source.match("^")
+    try:
+        if version == VERSION0:
+            item = parse_set_imp_union(source, info)
+        else:
+            item = parse_set_union(source, info)
+
+        if not source.match("]"):
+            raise error("missing ]", source.string, source.pos)
+    finally:
+        source.ignore_space = saved_ignore
+
+    if negate:
+        item = item.with_flags(positive=not item.positive)
+
+    item = item.with_flags(case_flags=make_case_flags(info))
+
+    return item
+
+def parse_set_union(source, info):
+    "Parses a set union ([x||y])."
+    items = [parse_set_symm_diff(source, info)]
+    while source.match("||"):
+        items.append(parse_set_symm_diff(source, info))
+
+    if len(items) == 1:
+        return items[0]
+    return SetUnion(info, items)
+
+def parse_set_symm_diff(source, info):
+    "Parses a set symmetric difference ([x~~y])."
+    items = [parse_set_inter(source, info)]
+    while source.match("~~"):
+        items.append(parse_set_inter(source, info))
+
+    if len(items) == 1:
+        return items[0]
+    return SetSymDiff(info, items)
+
+def parse_set_inter(source, info):
+    "Parses a set intersection ([x&&y])."
+    items = [parse_set_diff(source, info)]
+    while source.match("&&"):
+        items.append(parse_set_diff(source, info))
+
+    if len(items) == 1:
+        return items[0]
+    return SetInter(info, items)
+
+def parse_set_diff(source, info):
+    "Parses a set difference ([x--y])."
+    items = [parse_set_imp_union(source, info)]
+    while source.match("--"):
+        items.append(parse_set_imp_union(source, info))
+
+    if len(items) == 1:
+        return items[0]
+    return SetDiff(info, items)
+
+def parse_set_imp_union(source, info):
+    "Parses a set implicit union ([xy])."
+    version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION
+
+    items = [parse_set_member(source, info)]
+    while True:
+        saved_pos = source.pos
+        if source.match("]"):
+            # End of the set.
+            source.pos = saved_pos
+            break
+
+        if version == VERSION1 and any(source.match(op) for op in SET_OPS):
+            # The new behaviour has set operators.
+            source.pos = saved_pos
+            break
+
+        items.append(parse_set_member(source, info))
+
+    if len(items) == 1:
+        return items[0]
+    return SetUnion(info, items)
+
+def parse_set_member(source, info):
+    "Parses a member in a character set."
+    # Parse a set item.
+    start = parse_set_item(source, info)
+    saved_pos1 = source.pos
+    if (not isinstance(start, Character) or not start.positive or not
+      source.match("-")):
+        # It's not the start of a range.
+        return start
+
+    version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION
+
+    # It looks like the start of a range of characters.
+    saved_pos2 = source.pos
+    if version == VERSION1 and source.match("-"):
+        # It's actually the set difference operator '--', so return the
+        # character.
+        source.pos = saved_pos1
+        return start
+
+    if source.match("]"):
+        # We've reached the end of the set, so return both the character and
+        # hyphen.
+        source.pos = saved_pos2
+        return SetUnion(info, [start, Character(ord("-"))])
+
+    # Parse a set item.
+    end = parse_set_item(source, info)
+    if not isinstance(end, Character) or not end.positive:
+        # It's not a range, so return the character, hyphen and property.
+        return SetUnion(info, [start, Character(ord("-")), end])
+
+    # It _is_ a range.
+    if start.value > end.value:
+        raise error("bad character range", source.string, source.pos)
+
+    if start.value == end.value:
+        return start
+
+    return Range(start.value, end.value)
+
+def parse_set_item(source, info):
+    "Parses an item in a character set."
+    version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION
+
+    if source.match("\\"):
+        # An escape sequence in a set.
+        return parse_escape(source, info, True)
+
+    saved_pos = source.pos
+    if source.match("[:"):
+        # Looks like a POSIX character class.
+        try:
+            return parse_posix_class(source, info)
+        except ParseError:
+            # Not a POSIX character class.
+            source.pos = saved_pos
+
+    if version == VERSION1 and source.match("["):
+        # It's the start of a nested set.
+
+        # Negative set?
+        negate = source.match("^")
+        item = parse_set_union(source, info)
+
+        if not source.match("]"):
+            raise error("missing ]", source.string, source.pos)
+
+        if negate:
+            item = item.with_flags(positive=not item.positive)
+
+        return item
+
+    ch = source.get()
+    if not ch:
+        raise error("unterminated character set", source.string, source.pos)
+
+    return Character(ord(ch))
+
+def parse_posix_class(source, info):
+    "Parses a POSIX character class."
+    negate = source.match("^")
+    prop_name, name = parse_property_name(source)
+    if not source.match(":]"):
+        raise ParseError()
+
+    return lookup_property(prop_name, name, not negate, source, posix=True)
+
+def float_to_rational(flt):
+    "Converts a float to a rational pair."
+    int_part = int(flt)
+    error = flt - int_part
+    if abs(error) < 0.0001:
+        return int_part, 1
+
+    den, num = float_to_rational(1.0 / error)
+
+    return int_part * den + num, den
+
+def numeric_to_rational(numeric):
+    "Converts a numeric string to a rational string, if possible."
+    if numeric[ : 1] == "-":
+        sign, numeric = numeric[0], numeric[1 : ]
+    else:
+        sign = ""
+
+    parts = numeric.split("/")
+    if len(parts) == 2:
+        num, den = float_to_rational(float(parts[0]) / float(parts[1]))
+    elif len(parts) == 1:
+        num, den = float_to_rational(float(parts[0]))
+    else:
+        raise ValueError()
+
+    result = "{}{}/{}".format(sign, num, den)
+    if result.endswith("/1"):
+        return result[ : -2]
+
+    return result
+
+def standardise_name(name):
+    "Standardises a property or value name."
+    try:
+        return numeric_to_rational("".join(name))
+    except (ValueError, ZeroDivisionError):
+        return "".join(ch for ch in name if ch not in "_- ").upper()
+
+_POSIX_CLASSES = set('ALNUM DIGIT PUNCT XDIGIT'.split())
+
+_BINARY_VALUES = set('YES Y NO N TRUE T FALSE F'.split())
+
+def lookup_property(property, value, positive, source=None, posix=False):
+    "Looks up a property."
+    # Normalise the names (which may still be lists).
+    property = standardise_name(property) if property else None
+    value = standardise_name(value)
+
+    if (property, value) == ("GENERALCATEGORY", "ASSIGNED"):
+        property, value, positive = "GENERALCATEGORY", "UNASSIGNED", not positive
+
+    if posix and not property and value.upper() in _POSIX_CLASSES:
+        value = 'POSIX' + value
+
+    if property:
+        # Both the property and the value are provided.
+        prop = PROPERTIES.get(property)
+        if not prop:
+            if not source:
+                raise error("unknown property")
+
+            raise error("unknown property", source.string, source.pos)
+
+        prop_id, value_dict = prop
+        val_id = value_dict.get(value)
+        if val_id is None:
+            if not source:
+                raise error("unknown property value")
+
+            raise error("unknown property value", source.string, source.pos)
+
+        return Property((prop_id << 16) | val_id, positive)
+
+    # Only the value is provided.
+    # It might be the name of a GC, script or block value.
+    for property in ("GC", "SCRIPT", "BLOCK"):
+        prop_id, value_dict = PROPERTIES.get(property)
+        val_id = value_dict.get(value)
+        if val_id is not None:
+            return Property((prop_id << 16) | val_id, positive)
+
+    # It might be the name of a binary property.
+    prop = PROPERTIES.get(value)
+    if prop:
+        prop_id, value_dict = prop
+        if set(value_dict) == _BINARY_VALUES:
+            return Property((prop_id << 16) | 1, positive)
+
+        return Property(prop_id << 16, not positive)
+
+    # It might be the name of a binary property starting with a prefix.
+    if value.startswith("IS"):
+        prop = PROPERTIES.get(value[2 : ])
+        if prop:
+            prop_id, value_dict = prop
+            if "YES" in value_dict:
+                return Property((prop_id << 16) | 1, positive)
+
+    # It might be the name of a script or block starting with a prefix.
+    for prefix, property in (("IS", "SCRIPT"), ("IN", "BLOCK")):
+        if value.startswith(prefix):
+            prop_id, value_dict = PROPERTIES.get(property)
+            val_id = value_dict.get(value[2 : ])
+            if val_id is not None:
+                return Property((prop_id << 16) | val_id, positive)
+
+    # Unknown property.
+    if not source:
+        raise error("unknown property")
+
+    raise error("unknown property", source.string, source.pos)
+
+def _compile_replacement(source, pattern, is_unicode):
+    "Compiles a replacement template escape sequence."
+    ch = source.get()
+    if ch in ALPHA:
+        # An alphabetic escape sequence.
+        value = CHARACTER_ESCAPES.get(ch)
+        if value:
+            return False, [ord(value)]
+
+        if ch in HEX_ESCAPES and (ch == "x" or is_unicode):
+            # A hexadecimal escape sequence.
+            return False, [parse_repl_hex_escape(source, HEX_ESCAPES[ch], ch)]
+
+        if ch == "g":
+            # A group preference.
+            return True, [compile_repl_group(source, pattern)]
+
+        if ch == "N" and is_unicode:
+            # A named character.
+            value = parse_repl_named_char(source)
+            if value is not None:
+                return False, [value]
+
+        raise error("bad escape \\%s" % ch, source.string, source.pos)
+
+    if isinstance(source.sep, bytes):
+        octal_mask = 0xFF
+    else:
+        octal_mask = 0x1FF
+
+    if ch == "0":
+        # An octal escape sequence.
+        digits = ch
+        while len(digits) < 3:
+            saved_pos = source.pos
+            ch = source.get()
+            if ch not in OCT_DIGITS:
+                source.pos = saved_pos
+                break
+            digits += ch
+
+        return False, [int(digits, 8) & octal_mask]
+
+    if ch in DIGITS:
+        # Either an octal escape sequence (3 digits) or a group reference (max
+        # 2 digits).
+        digits = ch
+        saved_pos = source.pos
+        ch = source.get()
+        if ch in DIGITS:
+            digits += ch
+            saved_pos = source.pos
+            ch = source.get()
+            if ch and is_octal(digits + ch):
+                # An octal escape sequence.
+                return False, [int(digits + ch, 8) & octal_mask]
+
+        # A group reference.
+        source.pos = saved_pos
+        return True, [int(digits)]
+
+    if ch == "\\":
+        # An escaped backslash is a backslash.
+        return False, [ord("\\")]
+
+    if not ch:
+        # A trailing backslash.
+        raise error("bad escape (end of pattern)", source.string, source.pos)
+
+    # An escaped non-backslash is a backslash followed by the literal.
+    return False, [ord("\\"), ord(ch)]
+
+def parse_repl_hex_escape(source, expected_len, type):
+    "Parses a hex escape sequence in a replacement string."
+    digits = []
+    for i in range(expected_len):
+        ch = source.get()
+        if ch not in HEX_DIGITS:
+            raise error("incomplete escape \\%s%s" % (type, ''.join(digits)),
+              source.string, source.pos)
+        digits.append(ch)
+
+    return int("".join(digits), 16)
+
+def parse_repl_named_char(source):
+    "Parses a named character in a replacement string."
+    saved_pos = source.pos
+    if source.match("{"):
+        name = source.get_while(ALPHA | set(" "))
+
+        if source.match("}"):
+            try:
+                value = unicodedata.lookup(name)
+                return ord(value)
+            except KeyError:
+                raise error("undefined character name", source.string,
+                  source.pos)
+
+    source.pos = saved_pos
+    return None
+
+def compile_repl_group(source, pattern):
+    "Compiles a replacement template group reference."
+    source.expect("<")
+    name = parse_name(source, True, True)
+
+    source.expect(">")
+    if name.isdigit():
+        index = int(name)
+        if not 0 <= index <= pattern.groups:
+            raise error("invalid group reference", source.string, source.pos)
+
+        return index
+
+    try:
+        return pattern.groupindex[name]
+    except KeyError:
+        raise IndexError("unknown group")
+
+# The regular expression is parsed into a syntax tree. The different types of
+# node are defined below.
+
+INDENT = "  "
+POSITIVE_OP = 0x1
+ZEROWIDTH_OP = 0x2
+FUZZY_OP = 0x4
+REVERSE_OP = 0x8
+REQUIRED_OP = 0x10
+
+POS_TEXT = {False: "NON-MATCH", True: "MATCH"}
+CASE_TEXT = {NOCASE: "", IGNORECASE: " SIMPLE_IGNORE_CASE", FULLCASE: "",
+  FULLIGNORECASE: " FULL_IGNORE_CASE"}
+
+def make_sequence(items):
+    if len(items) == 1:
+        return items[0]
+    return Sequence(items)
+
+# Common base class for all nodes.
+class RegexBase:
+    def __init__(self):
+        self._key = self.__class__
+
+    def with_flags(self, positive=None, case_flags=None, zerowidth=None):
+        if positive is None:
+            positive = self.positive
+        else:
+            positive = bool(positive)
+        if case_flags is None:
+            case_flags = self.case_flags
+        else:
+            case_flags = CASE_FLAGS_COMBINATIONS[case_flags & CASE_FLAGS]
+        if zerowidth is None:
+            zerowidth = self.zerowidth
+        else:
+            zerowidth = bool(zerowidth)
+
+        if (positive == self.positive and case_flags == self.case_flags and
+          zerowidth == self.zerowidth):
+            return self
+
+        return self.rebuild(positive, case_flags, zerowidth)
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        pass
+
+    def optimise(self, info, reverse):
+        return self
+
+    def pack_characters(self, info):
+        return self
+
+    def remove_captures(self):
+        return self
+
+    def is_atomic(self):
+        return True
+
+    def can_be_affix(self):
+        return True
+
+    def contains_group(self):
+        return False
+
+    def get_firstset(self, reverse):
+        raise _FirstSetError()
+
+    def has_simple_start(self):
+        return False
+
+    def compile(self, reverse=False, fuzzy=False):
+        return self._compile(reverse, fuzzy)
+
+    def is_empty(self):
+        return False
+
+    def __hash__(self):
+        return hash(self._key)
+
+    def __eq__(self, other):
+        return type(self) is type(other) and self._key == other._key
+
+    def __ne__(self, other):
+        return not self.__eq__(other)
+
+    def get_required_string(self, reverse):
+        return self.max_width(), None
+
+# Base class for zero-width nodes.
+class ZeroWidthBase(RegexBase):
+    def __init__(self, positive=True):
+        RegexBase.__init__(self)
+        self.positive = bool(positive)
+
+        self._key = self.__class__, self.positive
+
+    def get_firstset(self, reverse):
+        return set([None])
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if self.positive:
+            flags |= POSITIVE_OP
+        if fuzzy:
+            flags |= FUZZY_OP
+        if reverse:
+            flags |= REVERSE_OP
+        return [(self._opcode, flags)]
+
+    def dump(self, indent, reverse):
+        print("{}{} {}".format(INDENT * indent, self._op_name,
+          POS_TEXT[self.positive]))
+
+    def max_width(self):
+        return 0
+
+class Any(RegexBase):
+    _opcode = {False: OP.ANY, True: OP.ANY_REV}
+    _op_name = "ANY"
+
+    def has_simple_start(self):
+        return True
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if fuzzy:
+            flags |= FUZZY_OP
+        return [(self._opcode[reverse], flags)]
+
+    def dump(self, indent, reverse):
+        print("{}{}".format(INDENT * indent, self._op_name))
+
+    def max_width(self):
+        return 1
+
+class AnyAll(Any):
+    _opcode = {False: OP.ANY_ALL, True: OP.ANY_ALL_REV}
+    _op_name = "ANY_ALL"
+
+class AnyU(Any):
+    _opcode = {False: OP.ANY_U, True: OP.ANY_U_REV}
+    _op_name = "ANY_U"
+
+class Atomic(RegexBase):
+    def __init__(self, subpattern):
+        RegexBase.__init__(self)
+        self.subpattern = subpattern
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        self.subpattern.fix_groups(pattern, reverse, fuzzy)
+
+    def optimise(self, info, reverse):
+        self.subpattern = self.subpattern.optimise(info, reverse)
+
+        if self.subpattern.is_empty():
+            return self.subpattern
+        return self
+
+    def pack_characters(self, info):
+        self.subpattern = self.subpattern.pack_characters(info)
+        return self
+
+    def remove_captures(self):
+        self.subpattern = self.subpattern.remove_captures()
+        return self
+
+    def can_be_affix(self):
+        return self.subpattern.can_be_affix()
+
+    def contains_group(self):
+        return self.subpattern.contains_group()
+
+    def get_firstset(self, reverse):
+        return self.subpattern.get_firstset(reverse)
+
+    def has_simple_start(self):
+        return self.subpattern.has_simple_start()
+
+    def _compile(self, reverse, fuzzy):
+        return ([(OP.ATOMIC, )] + self.subpattern.compile(reverse, fuzzy) +
+          [(OP.END, )])
+
+    def dump(self, indent, reverse):
+        print("{}ATOMIC".format(INDENT * indent))
+        self.subpattern.dump(indent + 1, reverse)
+
+    def is_empty(self):
+        return self.subpattern.is_empty()
+
+    def __eq__(self, other):
+        return (type(self) is type(other) and self.subpattern ==
+          other.subpattern)
+
+    def max_width(self):
+        return self.subpattern.max_width()
+
+    def get_required_string(self, reverse):
+        return self.subpattern.get_required_string(reverse)
+
+class Boundary(ZeroWidthBase):
+    _opcode = OP.BOUNDARY
+    _op_name = "BOUNDARY"
+
+class Branch(RegexBase):
+    def __init__(self, branches):
+        RegexBase.__init__(self)
+        self.branches = branches
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        for b in self.branches:
+            b.fix_groups(pattern, reverse, fuzzy)
+
+    def optimise(self, info, reverse):
+        if not self.branches:
+            return Sequence([])
+
+        # Flatten branches within branches.
+        branches = Branch._flatten_branches(info, reverse, self.branches)
+
+        # Move any common prefix or suffix out of the branches.
+        if reverse:
+            suffix, branches = Branch._split_common_suffix(info, branches)
+            prefix = []
+        else:
+            prefix, branches = Branch._split_common_prefix(info, branches)
+            suffix = []
+
+        # Try to reduce adjacent single-character branches to sets.
+        branches = Branch._reduce_to_set(info, reverse, branches)
+
+        if len(branches) > 1:
+            sequence = [Branch(branches)]
+
+            if not prefix or not suffix:
+                # We might be able to add a quick precheck before the branches.
+                firstset = self._add_precheck(info, reverse, branches)
+
+                if firstset:
+                    if reverse:
+                        sequence.append(firstset)
+                    else:
+                        sequence.insert(0, firstset)
+        else:
+            sequence = branches
+
+        return make_sequence(prefix + sequence + suffix)
+
+    def _add_precheck(self, info, reverse, branches):
+        charset = set()
+        pos = -1 if reverse else 0
+
+        for branch in branches:
+            if type(branch) is Literal and branch.case_flags == NOCASE:
+                charset.add(branch.characters[pos])
+            else:
+                return
+
+        if not charset:
+            return None
+
+        return _check_firstset(info, reverse, [Character(c) for c in charset])
+
+    def pack_characters(self, info):
+        self.branches = [b.pack_characters(info) for b in self.branches]
+        return self
+
+    def remove_captures(self):
+        self.branches = [b.remove_captures() for b in self.branches]
+        return self
+
+    def is_atomic(self):
+        return all(b.is_atomic() for b in self.branches)
+
+    def can_be_affix(self):
+        return all(b.can_be_affix() for b in self.branches)
+
+    def contains_group(self):
+        return any(b.contains_group() for b in self.branches)
+
+    def get_firstset(self, reverse):
+        fs = set()
+        for b in self.branches:
+            fs |= b.get_firstset(reverse)
+
+        return fs or set([None])
+
+    def _compile(self, reverse, fuzzy):
+        if not self.branches:
+            return []
+
+        code = [(OP.BRANCH, )]
+        for b in self.branches:
+            code.extend(b.compile(reverse, fuzzy))
+            code.append((OP.NEXT, ))
+
+        code[-1] = (OP.END, )
+
+        return code
+
+    def dump(self, indent, reverse):
+        print("{}BRANCH".format(INDENT * indent))
+        self.branches[0].dump(indent + 1, reverse)
+        for b in self.branches[1 : ]:
+            print("{}OR".format(INDENT * indent))
+            b.dump(indent + 1, reverse)
+
+    @staticmethod
+    def _flatten_branches(info, reverse, branches):
+        # Flatten the branches so that there aren't branches of branches.
+        new_branches = []
+        for b in branches:
+            b = b.optimise(info, reverse)
+            if isinstance(b, Branch):
+                new_branches.extend(b.branches)
+            else:
+                new_branches.append(b)
+
+        return new_branches
+
+    @staticmethod
+    def _split_common_prefix(info, branches):
+        # Common leading items can be moved out of the branches.
+        # Get the items in the branches.
+        alternatives = []
+        for b in branches:
+            if isinstance(b, Sequence):
+                alternatives.append(b.items)
+            else:
+                alternatives.append([b])
+
+        # What is the maximum possible length of the prefix?
+        max_count = min(len(a) for a in alternatives)
+
+        # What is the longest common prefix?
+        prefix = alternatives[0]
+        pos = 0
+        end_pos = max_count
+        while pos < end_pos and prefix[pos].can_be_affix() and all(a[pos] ==
+          prefix[pos] for a in alternatives):
+            pos += 1
+        count = pos
+
+        if info.flags & UNICODE:
+            # We need to check that we're not splitting a sequence of
+            # characters which could form part of full case-folding.
+            count = pos
+            while count > 0 and not all(Branch._can_split(a, count) for a in
+              alternatives):
+                count -= 1
+
+        # No common prefix is possible.
+        if count == 0:
+            return [], branches
+
+        # Rebuild the branches.
+        new_branches = []
+        for a in alternatives:
+            new_branches.append(make_sequence(a[count : ]))
+
+        return prefix[ : count], new_branches
+
+    @staticmethod
+    def _split_common_suffix(info, branches):
+        # Common trailing items can be moved out of the branches.
+        # Get the items in the branches.
+        alternatives = []
+        for b in branches:
+            if isinstance(b, Sequence):
+                alternatives.append(b.items)
+            else:
+                alternatives.append([b])
+
+        # What is the maximum possible length of the suffix?
+        max_count = min(len(a) for a in alternatives)
+
+        # What is the longest common suffix?
+        suffix = alternatives[0]
+        pos = -1
+        end_pos = -1 - max_count
+        while pos > end_pos and suffix[pos].can_be_affix() and all(a[pos] ==
+          suffix[pos] for a in alternatives):
+            pos -= 1
+        count = -1 - pos
+
+        if info.flags & UNICODE:
+            # We need to check that we're not splitting a sequence of
+            # characters which could form part of full case-folding.
+            while count > 0 and not all(Branch._can_split_rev(a, count) for a
+              in alternatives):
+                count -= 1
+
+        # No common suffix is possible.
+        if count == 0:
+            return [], branches
+
+        # Rebuild the branches.
+        new_branches = []
+        for a in alternatives:
+            new_branches.append(make_sequence(a[ : -count]))
+
+        return suffix[-count : ], new_branches
+
+    @staticmethod
+    def _can_split(items, count):
+        # Check the characters either side of the proposed split.
+        if not Branch._is_full_case(items, count - 1):
+            return True
+
+        if not Branch._is_full_case(items, count):
+            return True
+
+        # Check whether a 1-1 split would be OK.
+        if Branch._is_folded(items[count - 1 : count + 1]):
+            return False
+
+        # Check whether a 1-2 split would be OK.
+        if (Branch._is_full_case(items, count + 2) and
+          Branch._is_folded(items[count - 1 : count + 2])):
+            return False
+
+        # Check whether a 2-1 split would be OK.
+        if (Branch._is_full_case(items, count - 2) and
+          Branch._is_folded(items[count - 2 : count + 1])):
+            return False
+
+        return True
+
+    @staticmethod
+    def _can_split_rev(items, count):
+        end = len(items)
+
+        # Check the characters either side of the proposed split.
+        if not Branch._is_full_case(items, end - count):
+            return True
+
+        if not Branch._is_full_case(items, end - count - 1):
+            return True
+
+        # Check whether a 1-1 split would be OK.
+        if Branch._is_folded(items[end - count - 1 : end - count + 1]):
+            return False
+
+        # Check whether a 1-2 split would be OK.
+        if (Branch._is_full_case(items, end - count + 2) and
+          Branch._is_folded(items[end - count - 1 : end - count + 2])):
+            return False
+
+        # Check whether a 2-1 split would be OK.
+        if (Branch._is_full_case(items, end - count - 2) and
+          Branch._is_folded(items[end - count - 2 : end - count + 1])):
+            return False
+
+        return True
+
+    @staticmethod
+    def _merge_common_prefixes(info, reverse, branches):
+        # Branches with the same case-sensitive character prefix can be grouped
+        # together if they are separated only by other branches with a
+        # character prefix.
+        prefixed = defaultdict(list)
+        order = {}
+        new_branches = []
+        for b in branches:
+            if Branch._is_simple_character(b):
+                # Branch starts with a simple character.
+                prefixed[b.value].append([b])
+                order.setdefault(b.value, len(order))
+            elif (isinstance(b, Sequence) and b.items and
+              Branch._is_simple_character(b.items[0])):
+                # Branch starts with a simple character.
+                prefixed[b.items[0].value].append(b.items)
+                order.setdefault(b.items[0].value, len(order))
+            else:
+                Branch._flush_char_prefix(info, reverse, prefixed, order,
+                  new_branches)
+
+                new_branches.append(b)
+
+        Branch._flush_char_prefix(info, prefixed, order, new_branches)
+
+        return new_branches
+
+    @staticmethod
+    def _is_simple_character(c):
+        return isinstance(c, Character) and c.positive and not c.case_flags
+
+    @staticmethod
+    def _reduce_to_set(info, reverse, branches):
+        # Can the branches be reduced to a set?
+        new_branches = []
+        items = set()
+        case_flags = NOCASE
+        for b in branches:
+            if isinstance(b, (Character, Property, SetBase)):
+                # Branch starts with a single character.
+                if b.case_flags != case_flags:
+                    # Different case sensitivity, so flush.
+                    Branch._flush_set_members(info, reverse, items, case_flags,
+                      new_branches)
+
+                    case_flags = b.case_flags
+
+                items.add(b.with_flags(case_flags=NOCASE))
+            else:
+                Branch._flush_set_members(info, reverse, items, case_flags,
+                  new_branches)
+
+                new_branches.append(b)
+
+        Branch._flush_set_members(info, reverse, items, case_flags,
+          new_branches)
+
+        return new_branches
+
+    @staticmethod
+    def _flush_char_prefix(info, reverse, prefixed, order, new_branches):
+        # Flush the prefixed branches.
+        if not prefixed:
+            return
+
+        for value, branches in sorted(prefixed.items(), key=lambda pair:
+          order[pair[0]]):
+            if len(branches) == 1:
+                new_branches.append(make_sequence(branches[0]))
+            else:
+                subbranches = []
+                optional = False
+                for b in branches:
+                    if len(b) > 1:
+                        subbranches.append(make_sequence(b[1 : ]))
+                    elif not optional:
+                        subbranches.append(Sequence())
+                        optional = True
+
+                sequence = Sequence([Character(value), Branch(subbranches)])
+                new_branches.append(sequence.optimise(info, reverse))
+
+        prefixed.clear()
+        order.clear()
+
+    @staticmethod
+    def _flush_set_members(info, reverse, items, case_flags, new_branches):
+        # Flush the set members.
+        if not items:
+            return
+
+        if len(items) == 1:
+            item = list(items)[0]
+        else:
+            item = SetUnion(info, list(items)).optimise(info, reverse)
+
+        new_branches.append(item.with_flags(case_flags=case_flags))
+
+        items.clear()
+
+    @staticmethod
+    def _is_full_case(items, i):
+        if not 0 <= i < len(items):
+            return False
+
+        item = items[i]
+        return (isinstance(item, Character) and item.positive and
+          (item.case_flags & FULLIGNORECASE) == FULLIGNORECASE)
+
+    @staticmethod
+    def _is_folded(items):
+        if len(items) < 2:
+            return False
+
+        for i in items:
+            if (not isinstance(i, Character) or not i.positive or not
+              i.case_flags):
+                return False
+
+        folded = "".join(chr(i.value) for i in items)
+        folded = _regex.fold_case(FULL_CASE_FOLDING, folded)
+
+        # Get the characters which expand to multiple codepoints on folding.
+        expanding_chars = _regex.get_expand_on_folding()
+
+        for c in expanding_chars:
+            if folded == _regex.fold_case(FULL_CASE_FOLDING, c):
+                return True
+
+        return False
+
+    def is_empty(self):
+        return all(b.is_empty() for b in self.branches)
+
+    def __eq__(self, other):
+        return type(self) is type(other) and self.branches == other.branches
+
+    def max_width(self):
+        return max(b.max_width() for b in self.branches)
+
+class CallGroup(RegexBase):
+    def __init__(self, info, group, position):
+        RegexBase.__init__(self)
+        self.info = info
+        self.group = group
+        self.position = position
+
+        self._key = self.__class__, self.group
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        try:
+            self.group = int(self.group)
+        except ValueError:
+            try:
+                self.group = self.info.group_index[self.group]
+            except KeyError:
+                raise error("invalid group reference", pattern, self.position)
+
+        if not 0 <= self.group <= self.info.group_count:
+            raise error("unknown group", pattern, self.position)
+
+        if self.group > 0 and self.info.open_group_count[self.group] > 1:
+            raise error("ambiguous group reference", pattern, self.position)
+
+        self.info.group_calls.append((self, reverse, fuzzy))
+
+        self._key = self.__class__, self.group
+
+    def remove_captures(self):
+        raise error("group reference not allowed", pattern, self.position)
+
+    def _compile(self, reverse, fuzzy):
+        return [(OP.GROUP_CALL, self.call_ref)]
+
+    def dump(self, indent, reverse):
+        print("{}GROUP_CALL {}".format(INDENT * indent, self.group))
+
+    def __eq__(self, other):
+        return type(self) is type(other) and self.group == other.group
+
+    def max_width(self):
+        return UNLIMITED
+
+    def __del__(self):
+        self.info = None
+
+class CallRef(RegexBase):
+    def __init__(self, ref, parsed):
+        self.ref = ref
+        self.parsed = parsed
+
+    def _compile(self, reverse, fuzzy):
+        return ([(OP.CALL_REF, self.ref)] + self.parsed._compile(reverse,
+          fuzzy) + [(OP.END, )])
+
+class Character(RegexBase):
+    _opcode = {(NOCASE, False): OP.CHARACTER, (IGNORECASE, False):
+      OP.CHARACTER_IGN, (FULLCASE, False): OP.CHARACTER, (FULLIGNORECASE,
+      False): OP.CHARACTER_IGN, (NOCASE, True): OP.CHARACTER_REV, (IGNORECASE,
+      True): OP.CHARACTER_IGN_REV, (FULLCASE, True): OP.CHARACTER_REV,
+      (FULLIGNORECASE, True): OP.CHARACTER_IGN_REV}
+
+    def __init__(self, value, positive=True, case_flags=NOCASE,
+      zerowidth=False):
+        RegexBase.__init__(self)
+        self.value = value
+        self.positive = bool(positive)
+        self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags]
+        self.zerowidth = bool(zerowidth)
+
+        if (self.positive and (self.case_flags & FULLIGNORECASE) ==
+          FULLIGNORECASE):
+            self.folded = _regex.fold_case(FULL_CASE_FOLDING, chr(self.value))
+        else:
+            self.folded = chr(self.value)
+
+        self._key = (self.__class__, self.value, self.positive,
+          self.case_flags, self.zerowidth)
+
+    def rebuild(self, positive, case_flags, zerowidth):
+        return Character(self.value, positive, case_flags, zerowidth)
+
+    def optimise(self, info, reverse, in_set=False):
+        return self
+
+    def get_firstset(self, reverse):
+        return set([self])
+
+    def has_simple_start(self):
+        return True
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if self.positive:
+            flags |= POSITIVE_OP
+        if self.zerowidth:
+            flags |= ZEROWIDTH_OP
+        if fuzzy:
+            flags |= FUZZY_OP
+
+        code = PrecompiledCode([self._opcode[self.case_flags, reverse], flags,
+          self.value])
+
+        if len(self.folded) > 1:
+            # The character expands on full case-folding.
+            code = Branch([code, String([ord(c) for c in self.folded],
+              case_flags=self.case_flags)])
+
+        return code.compile(reverse, fuzzy)
+
+    def dump(self, indent, reverse):
+        display = ascii(chr(self.value)).lstrip("bu")
+        print("{}CHARACTER {} {}{}".format(INDENT * indent,
+          POS_TEXT[self.positive], display, CASE_TEXT[self.case_flags]))
+
+    def matches(self, ch):
+        return (ch == self.value) == self.positive
+
+    def max_width(self):
+        return len(self.folded)
+
+    def get_required_string(self, reverse):
+        if not self.positive:
+            return 1, None
+
+        self.folded_characters = tuple(ord(c) for c in self.folded)
+
+        return 0, self
+
+class Conditional(RegexBase):
+    def __init__(self, info, group, yes_item, no_item, position):
+        RegexBase.__init__(self)
+        self.info = info
+        self.group = group
+        self.yes_item = yes_item
+        self.no_item = no_item
+        self.position = position
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        try:
+            self.group = int(self.group)
+        except ValueError:
+            try:
+                self.group = self.info.group_index[self.group]
+            except KeyError:
+                if self.group == 'DEFINE':
+                    # 'DEFINE' is a special name unless there's a group with
+                    # that name.
+                    self.group = 0
+                else:
+                    raise error("unknown group", pattern, self.position)
+
+        if not 0 <= self.group <= self.info.group_count:
+            raise error("invalid group reference", pattern, self.position)
+
+        self.yes_item.fix_groups(pattern, reverse, fuzzy)
+        self.no_item.fix_groups(pattern, reverse, fuzzy)
+
+    def optimise(self, info, reverse):
+        yes_item = self.yes_item.optimise(info, reverse)
+        no_item = self.no_item.optimise(info, reverse)
+
+        return Conditional(info, self.group, yes_item, no_item, self.position)
+
+    def pack_characters(self, info):
+        self.yes_item = self.yes_item.pack_characters(info)
+        self.no_item = self.no_item.pack_characters(info)
+        return self
+
+    def remove_captures(self):
+        self.yes_item = self.yes_item.remove_captures()
+        self.no_item = self.no_item.remove_captures()
+
+    def is_atomic(self):
+        return self.yes_item.is_atomic() and self.no_item.is_atomic()
+
+    def can_be_affix(self):
+        return self.yes_item.can_be_affix() and self.no_item.can_be_affix()
+
+    def contains_group(self):
+        return self.yes_item.contains_group() or self.no_item.contains_group()
+
+    def get_firstset(self, reverse):
+        return (self.yes_item.get_firstset(reverse) |
+          self.no_item.get_firstset(reverse))
+
+    def _compile(self, reverse, fuzzy):
+        code = [(OP.GROUP_EXISTS, self.group)]
+        code.extend(self.yes_item.compile(reverse, fuzzy))
+        add_code = self.no_item.compile(reverse, fuzzy)
+        if add_code:
+            code.append((OP.NEXT, ))
+            code.extend(add_code)
+
+        code.append((OP.END, ))
+
+        return code
+
+    def dump(self, indent, reverse):
+        print("{}GROUP_EXISTS {}".format(INDENT * indent, self.group))
+        self.yes_item.dump(indent + 1, reverse)
+        if not self.no_item.is_empty():
+            print("{}OR".format(INDENT * indent))
+            self.no_item.dump(indent + 1, reverse)
+
+    def is_empty(self):
+        return self.yes_item.is_empty() and self.no_item.is_empty()
+
+    def __eq__(self, other):
+        return type(self) is type(other) and (self.group, self.yes_item,
+          self.no_item) == (other.group, other.yes_item, other.no_item)
+
+    def max_width(self):
+        return max(self.yes_item.max_width(), self.no_item.max_width())
+
+    def __del__(self):
+        self.info = None
+
+class DefaultBoundary(ZeroWidthBase):
+    _opcode = OP.DEFAULT_BOUNDARY
+    _op_name = "DEFAULT_BOUNDARY"
+
+class DefaultEndOfWord(ZeroWidthBase):
+    _opcode = OP.DEFAULT_END_OF_WORD
+    _op_name = "DEFAULT_END_OF_WORD"
+
+class DefaultStartOfWord(ZeroWidthBase):
+    _opcode = OP.DEFAULT_START_OF_WORD
+    _op_name = "DEFAULT_START_OF_WORD"
+
+class EndOfLine(ZeroWidthBase):
+    _opcode = OP.END_OF_LINE
+    _op_name = "END_OF_LINE"
+
+class EndOfLineU(EndOfLine):
+    _opcode = OP.END_OF_LINE_U
+    _op_name = "END_OF_LINE_U"
+
+class EndOfString(ZeroWidthBase):
+    _opcode = OP.END_OF_STRING
+    _op_name = "END_OF_STRING"
+
+class EndOfStringLine(ZeroWidthBase):
+    _opcode = OP.END_OF_STRING_LINE
+    _op_name = "END_OF_STRING_LINE"
+
+class EndOfStringLineU(EndOfStringLine):
+    _opcode = OP.END_OF_STRING_LINE_U
+    _op_name = "END_OF_STRING_LINE_U"
+
+class EndOfWord(ZeroWidthBase):
+    _opcode = OP.END_OF_WORD
+    _op_name = "END_OF_WORD"
+
+class Failure(ZeroWidthBase):
+    _op_name = "FAILURE"
+
+    def _compile(self, reverse, fuzzy):
+        return [(OP.FAILURE, )]
+
+class Fuzzy(RegexBase):
+    def __init__(self, subpattern, constraints=None):
+        RegexBase.__init__(self)
+        if constraints is None:
+            constraints = {}
+        self.subpattern = subpattern
+        self.constraints = constraints
+
+        # If an error type is mentioned in the cost equation, then its maximum
+        # defaults to unlimited.
+        if "cost" in constraints:
+            for e in "dis":
+                if e in constraints["cost"]:
+                    constraints.setdefault(e, (0, None))
+
+        # If any error type is mentioned, then all the error maxima default to
+        # 0, otherwise they default to unlimited.
+        if set(constraints) & set("dis"):
+            for e in "dis":
+                constraints.setdefault(e, (0, 0))
+        else:
+            for e in "dis":
+                constraints.setdefault(e, (0, None))
+
+        # The maximum of the generic error type defaults to unlimited.
+        constraints.setdefault("e", (0, None))
+
+        # The cost equation defaults to equal costs. Also, the cost of any
+        # error type not mentioned in the cost equation defaults to 0.
+        if "cost" in constraints:
+            for e in "dis":
+                constraints["cost"].setdefault(e, 0)
+        else:
+            constraints["cost"] = {"d": 1, "i": 1, "s": 1, "max":
+              constraints["e"][1]}
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        self.subpattern.fix_groups(pattern, reverse, True)
+
+    def pack_characters(self, info):
+        self.subpattern = self.subpattern.pack_characters(info)
+        return self
+
+    def remove_captures(self):
+        self.subpattern = self.subpattern.remove_captures()
+        return self
+
+    def is_atomic(self):
+        return self.subpattern.is_atomic()
+
+    def contains_group(self):
+        return self.subpattern.contains_group()
+
+    def _compile(self, reverse, fuzzy):
+        # The individual limits.
+        arguments = []
+        for e in "dise":
+            v = self.constraints[e]
+            arguments.append(v[0])
+            arguments.append(UNLIMITED if v[1] is None else v[1])
+
+        # The coeffs of the cost equation.
+        for e in "dis":
+            arguments.append(self.constraints["cost"][e])
+
+        # The maximum of the cost equation.
+        v = self.constraints["cost"]["max"]
+        arguments.append(UNLIMITED if v is None else v)
+
+        flags = 0
+        if reverse:
+            flags |= REVERSE_OP
+
+        test = self.constraints.get("test")
+
+        if test:
+            return ([(OP.FUZZY_EXT, flags) + tuple(arguments)] +
+              test.compile(reverse, True) + [(OP.NEXT,)] +
+              self.subpattern.compile(reverse, True) + [(OP.END,)])
+
+        return ([(OP.FUZZY, flags) + tuple(arguments)] +
+          self.subpattern.compile(reverse, True) + [(OP.END,)])
+
+    def dump(self, indent, reverse):
+        constraints = self._constraints_to_string()
+        if constraints:
+            constraints = " " + constraints
+        print("{}FUZZY{}".format(INDENT * indent, constraints))
+        self.subpattern.dump(indent + 1, reverse)
+
+    def is_empty(self):
+        return self.subpattern.is_empty()
+
+    def __eq__(self, other):
+        return (type(self) is type(other) and self.subpattern ==
+          other.subpattern and self.constraints == other.constraints)
+
+    def max_width(self):
+        return UNLIMITED
+
+    def _constraints_to_string(self):
+        constraints = []
+
+        for name in "ids":
+            min, max = self.constraints[name]
+            if max == 0:
+                continue
+
+            con = ""
+
+            if min > 0:
+                con = "{}<=".format(min)
+
+            con += name
+
+            if max is not None:
+                con += "<={}".format(max)
+
+            constraints.append(con)
+
+        cost = []
+        for name in "ids":
+            coeff = self.constraints["cost"][name]
+            if coeff > 0:
+                cost.append("{}{}".format(coeff, name))
+
+        limit = self.constraints["cost"]["max"]
+        if limit is not None and limit > 0:
+            cost = "{}<={}".format("+".join(cost), limit)
+            constraints.append(cost)
+
+        return ",".join(constraints)
+
+class Grapheme(RegexBase):
+    def _compile(self, reverse, fuzzy):
+        # Match at least 1 character until a grapheme boundary is reached. Note
+        # that this is the same whether matching forwards or backwards.
+        grapheme_matcher = Atomic(Sequence([LazyRepeat(AnyAll(), 1, None),
+          GraphemeBoundary()]))
+
+        return grapheme_matcher.compile(reverse, fuzzy)
+
+    def dump(self, indent, reverse):
+        print("{}GRAPHEME".format(INDENT * indent))
+
+    def max_width(self):
+        return UNLIMITED
+
+class GraphemeBoundary:
+    def compile(self, reverse, fuzzy):
+        return [(OP.GRAPHEME_BOUNDARY, 1)]
+
+class GreedyRepeat(RegexBase):
+    _opcode = OP.GREEDY_REPEAT
+    _op_name = "GREEDY_REPEAT"
+
+    def __init__(self, subpattern, min_count, max_count):
+        RegexBase.__init__(self)
+        self.subpattern = subpattern
+        self.min_count = min_count
+        self.max_count = max_count
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        self.subpattern.fix_groups(pattern, reverse, fuzzy)
+
+    def optimise(self, info, reverse):
+        subpattern = self.subpattern.optimise(info, reverse)
+
+        return type(self)(subpattern, self.min_count, self.max_count)
+
+    def pack_characters(self, info):
+        self.subpattern = self.subpattern.pack_characters(info)
+        return self
+
+    def remove_captures(self):
+        self.subpattern = self.subpattern.remove_captures()
+        return self
+
+    def is_atomic(self):
+        return self.min_count == self.max_count and self.subpattern.is_atomic()
+
+    def can_be_affix(self):
+        return False
+
+    def contains_group(self):
+        return self.subpattern.contains_group()
+
+    def get_firstset(self, reverse):
+        fs = self.subpattern.get_firstset(reverse)
+        if self.min_count == 0:
+            fs.add(None)
+
+        return fs
+
+    def _compile(self, reverse, fuzzy):
+        repeat = [self._opcode, self.min_count]
+        if self.max_count is None:
+            repeat.append(UNLIMITED)
+        else:
+            repeat.append(self.max_count)
+
+        subpattern = self.subpattern.compile(reverse, fuzzy)
+        if not subpattern:
+            return []
+
+        return ([tuple(repeat)] + subpattern + [(OP.END, )])
+
+    def dump(self, indent, reverse):
+        if self.max_count is None:
+            limit = "INF"
+        else:
+            limit = self.max_count
+        print("{}{} {} {}".format(INDENT * indent, self._op_name,
+          self.min_count, limit))
+
+        self.subpattern.dump(indent + 1, reverse)
+
+    def is_empty(self):
+        return self.subpattern.is_empty()
+
+    def __eq__(self, other):
+        return type(self) is type(other) and (self.subpattern, self.min_count,
+          self.max_count) == (other.subpattern, other.min_count,
+          other.max_count)
+
+    def max_width(self):
+        if self.max_count is None:
+            return UNLIMITED
+
+        return self.subpattern.max_width() * self.max_count
+
+    def get_required_string(self, reverse):
+        max_count = UNLIMITED if self.max_count is None else self.max_count
+        if self.min_count == 0:
+            w = self.subpattern.max_width() * max_count
+            return min(w, UNLIMITED), None
+
+        ofs, req = self.subpattern.get_required_string(reverse)
+        if req:
+            return ofs, req
+
+        w = self.subpattern.max_width() * max_count
+        return min(w, UNLIMITED), None
+
+class PossessiveRepeat(GreedyRepeat):
+    def is_atomic(self):
+        return True
+
+    def _compile(self, reverse, fuzzy):
+        subpattern = self.subpattern.compile(reverse, fuzzy)
+        if not subpattern:
+            return []
+
+        repeat = [self._opcode, self.min_count]
+        if self.max_count is None:
+            repeat.append(UNLIMITED)
+        else:
+            repeat.append(self.max_count)
+
+        return ([(OP.ATOMIC, ), tuple(repeat)] + subpattern + [(OP.END, ),
+          (OP.END, )])
+
+    def dump(self, indent, reverse):
+        print("{}ATOMIC".format(INDENT * indent))
+
+        if self.max_count is None:
+            limit = "INF"
+        else:
+            limit = self.max_count
+        print("{}{} {} {}".format(INDENT * (indent + 1), self._op_name,
+          self.min_count, limit))
+
+        self.subpattern.dump(indent + 2, reverse)
+
+class Group(RegexBase):
+    def __init__(self, info, group, subpattern):
+        RegexBase.__init__(self)
+        self.info = info
+        self.group = group
+        self.subpattern = subpattern
+
+        self.call_ref = None
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        self.info.defined_groups[self.group] = (self, reverse, fuzzy)
+        self.subpattern.fix_groups(pattern, reverse, fuzzy)
+
+    def optimise(self, info, reverse):
+        subpattern = self.subpattern.optimise(info, reverse)
+
+        return Group(self.info, self.group, subpattern)
+
+    def pack_characters(self, info):
+        self.subpattern = self.subpattern.pack_characters(info)
+        return self
+
+    def remove_captures(self):
+        return self.subpattern.remove_captures()
+
+    def is_atomic(self):
+        return self.subpattern.is_atomic()
+
+    def can_be_affix(self):
+        return False
+
+    def contains_group(self):
+        return True
+
+    def get_firstset(self, reverse):
+        return self.subpattern.get_firstset(reverse)
+
+    def has_simple_start(self):
+        return self.subpattern.has_simple_start()
+
+    def _compile(self, reverse, fuzzy):
+        code = []
+
+        public_group = private_group = self.group
+        if private_group < 0:
+            public_group = self.info.private_groups[private_group]
+            private_group = self.info.group_count - private_group
+
+        key = self.group, reverse, fuzzy
+        ref = self.info.call_refs.get(key)
+        if ref is not None:
+            code += [(OP.CALL_REF, ref)]
+
+        code += [(OP.GROUP, int(not reverse), private_group, public_group)]
+        code += self.subpattern.compile(reverse, fuzzy)
+        code += [(OP.END, )]
+
+        if ref is not None:
+            code += [(OP.END, )]
+
+        return code
+
+    def dump(self, indent, reverse):
+        group = self.group
+        if group < 0:
+            group = private_groups[group]
+        print("{}GROUP {}".format(INDENT * indent, group))
+        self.subpattern.dump(indent + 1, reverse)
+
+    def __eq__(self, other):
+        return (type(self) is type(other) and (self.group, self.subpattern) ==
+          (other.group, other.subpattern))
+
+    def max_width(self):
+        return self.subpattern.max_width()
+
+    def get_required_string(self, reverse):
+        return self.subpattern.get_required_string(reverse)
+
+    def __del__(self):
+        self.info = None
+
+class Keep(ZeroWidthBase):
+    _opcode = OP.KEEP
+    _op_name = "KEEP"
+
+class LazyRepeat(GreedyRepeat):
+    _opcode = OP.LAZY_REPEAT
+    _op_name = "LAZY_REPEAT"
+
+class LookAround(RegexBase):
+    _dir_text = {False: "AHEAD", True: "BEHIND"}
+
+    def __init__(self, behind, positive, subpattern):
+        RegexBase.__init__(self)
+        self.behind = bool(behind)
+        self.positive = bool(positive)
+        self.subpattern = subpattern
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        self.subpattern.fix_groups(pattern, self.behind, fuzzy)
+
+    def optimise(self, info, reverse):
+        subpattern = self.subpattern.optimise(info, self.behind)
+        if self.positive and subpattern.is_empty():
+            return subpattern
+
+        return LookAround(self.behind, self.positive, subpattern)
+
+    def pack_characters(self, info):
+        self.subpattern = self.subpattern.pack_characters(info)
+        return self
+
+    def remove_captures(self):
+        return self.subpattern.remove_captures()
+
+    def is_atomic(self):
+        return self.subpattern.is_atomic()
+
+    def can_be_affix(self):
+        return self.subpattern.can_be_affix()
+
+    def contains_group(self):
+        return self.subpattern.contains_group()
+
+    def get_firstset(self, reverse):
+        if self.positive and self.behind == reverse:
+            return self.subpattern.get_firstset(reverse)
+
+        return set([None])
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if self.positive:
+            flags |= POSITIVE_OP
+        if fuzzy:
+            flags |= FUZZY_OP
+        if reverse:
+            flags |= REVERSE_OP
+
+        return ([(OP.LOOKAROUND, flags, int(not self.behind))] +
+          self.subpattern.compile(self.behind) + [(OP.END, )])
+
+    def dump(self, indent, reverse):
+        print("{}LOOK{} {}".format(INDENT * indent,
+          self._dir_text[self.behind], POS_TEXT[self.positive]))
+        self.subpattern.dump(indent + 1, self.behind)
+
+    def is_empty(self):
+        return self.positive and self.subpattern.is_empty()
+
+    def __eq__(self, other):
+        return type(self) is type(other) and (self.behind, self.positive,
+          self.subpattern) == (other.behind, other.positive, other.subpattern)
+
+    def max_width(self):
+        return 0
+
+class LookAroundConditional(RegexBase):
+    _dir_text = {False: "AHEAD", True: "BEHIND"}
+
+    def __init__(self, behind, positive, subpattern, yes_item, no_item):
+        RegexBase.__init__(self)
+        self.behind = bool(behind)
+        self.positive = bool(positive)
+        self.subpattern = subpattern
+        self.yes_item = yes_item
+        self.no_item = no_item
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        self.subpattern.fix_groups(pattern, reverse, fuzzy)
+        self.yes_item.fix_groups(pattern, reverse, fuzzy)
+        self.no_item.fix_groups(pattern, reverse, fuzzy)
+
+    def optimise(self, info, reverse):
+        subpattern = self.subpattern.optimise(info, self.behind)
+        yes_item = self.yes_item.optimise(info, self.behind)
+        no_item = self.no_item.optimise(info, self.behind)
+
+        return LookAroundConditional(self.behind, self.positive, subpattern,
+          yes_item, no_item)
+
+    def pack_characters(self, info):
+        self.subpattern = self.subpattern.pack_characters(info)
+        self.yes_item = self.yes_item.pack_characters(info)
+        self.no_item = self.no_item.pack_characters(info)
+        return self
+
+    def remove_captures(self):
+        self.subpattern = self.subpattern.remove_captures()
+        self.yes_item = self.yes_item.remove_captures()
+        self.no_item = self.no_item.remove_captures()
+
+    def is_atomic(self):
+        return (self.subpattern.is_atomic() and self.yes_item.is_atomic() and
+          self.no_item.is_atomic())
+
+    def can_be_affix(self):
+        return (self.subpattern.can_be_affix() and self.yes_item.can_be_affix()
+          and self.no_item.can_be_affix())
+
+    def contains_group(self):
+        return (self.subpattern.contains_group() or
+          self.yes_item.contains_group() or self.no_item.contains_group())
+
+    def _compile(self, reverse, fuzzy):
+        code = [(OP.CONDITIONAL, int(self.positive), int(not self.behind))]
+        code.extend(self.subpattern.compile(self.behind, fuzzy))
+        code.append((OP.NEXT, ))
+        code.extend(self.yes_item.compile(reverse, fuzzy))
+        add_code = self.no_item.compile(reverse, fuzzy)
+        if add_code:
+            code.append((OP.NEXT, ))
+            code.extend(add_code)
+
+        code.append((OP.END, ))
+
+        return code
+
+    def dump(self, indent, reverse):
+        print("{}CONDITIONAL {} {}".format(INDENT * indent,
+          self._dir_text[self.behind], POS_TEXT[self.positive]))
+        self.subpattern.dump(indent + 1, self.behind)
+        print("{}EITHER".format(INDENT * indent))
+        self.yes_item.dump(indent + 1, reverse)
+        if not self.no_item.is_empty():
+            print("{}OR".format(INDENT * indent))
+            self.no_item.dump(indent + 1, reverse)
+
+    def is_empty(self):
+        return (self.subpattern.is_empty() and self.yes_item.is_empty() or
+          self.no_item.is_empty())
+
+    def __eq__(self, other):
+        return type(self) is type(other) and (self.subpattern, self.yes_item,
+          self.no_item) == (other.subpattern, other.yes_item, other.no_item)
+
+    def max_width(self):
+        return max(self.yes_item.max_width(), self.no_item.max_width())
+
+    def get_required_string(self, reverse):
+        return self.max_width(), None
+
+class PrecompiledCode(RegexBase):
+    def __init__(self, code):
+        self.code = code
+
+    def _compile(self, reverse, fuzzy):
+        return [tuple(self.code)]
+
+class Property(RegexBase):
+    _opcode = {(NOCASE, False): OP.PROPERTY, (IGNORECASE, False):
+      OP.PROPERTY_IGN, (FULLCASE, False): OP.PROPERTY, (FULLIGNORECASE, False):
+      OP.PROPERTY_IGN, (NOCASE, True): OP.PROPERTY_REV, (IGNORECASE, True):
+      OP.PROPERTY_IGN_REV, (FULLCASE, True): OP.PROPERTY_REV, (FULLIGNORECASE,
+      True): OP.PROPERTY_IGN_REV}
+
+    def __init__(self, value, positive=True, case_flags=NOCASE,
+      zerowidth=False):
+        RegexBase.__init__(self)
+        self.value = value
+        self.positive = bool(positive)
+        self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags]
+        self.zerowidth = bool(zerowidth)
+
+        self._key = (self.__class__, self.value, self.positive,
+          self.case_flags, self.zerowidth)
+
+    def rebuild(self, positive, case_flags, zerowidth):
+        return Property(self.value, positive, case_flags, zerowidth)
+
+    def optimise(self, info, reverse, in_set=False):
+        return self
+
+    def get_firstset(self, reverse):
+        return set([self])
+
+    def has_simple_start(self):
+        return True
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if self.positive:
+            flags |= POSITIVE_OP
+        if self.zerowidth:
+            flags |= ZEROWIDTH_OP
+        if fuzzy:
+            flags |= FUZZY_OP
+        return [(self._opcode[self.case_flags, reverse], flags, self.value)]
+
+    def dump(self, indent, reverse):
+        prop = PROPERTY_NAMES[self.value >> 16]
+        name, value = prop[0], prop[1][self.value & 0xFFFF]
+        print("{}PROPERTY {} {}:{}{}".format(INDENT * indent,
+          POS_TEXT[self.positive], name, value, CASE_TEXT[self.case_flags]))
+
+    def matches(self, ch):
+        return _regex.has_property_value(self.value, ch) == self.positive
+
+    def max_width(self):
+        return 1
+
+class Prune(ZeroWidthBase):
+    _op_name = "PRUNE"
+
+    def _compile(self, reverse, fuzzy):
+        return [(OP.PRUNE, )]
+
+class Range(RegexBase):
+    _opcode = {(NOCASE, False): OP.RANGE, (IGNORECASE, False): OP.RANGE_IGN,
+      (FULLCASE, False): OP.RANGE, (FULLIGNORECASE, False): OP.RANGE_IGN,
+      (NOCASE, True): OP.RANGE_REV, (IGNORECASE, True): OP.RANGE_IGN_REV,
+      (FULLCASE, True): OP.RANGE_REV, (FULLIGNORECASE, True): OP.RANGE_IGN_REV}
+    _op_name = "RANGE"
+
+    def __init__(self, lower, upper, positive=True, case_flags=NOCASE,
+      zerowidth=False):
+        RegexBase.__init__(self)
+        self.lower = lower
+        self.upper = upper
+        self.positive = bool(positive)
+        self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags]
+        self.zerowidth = bool(zerowidth)
+
+        self._key = (self.__class__, self.lower, self.upper, self.positive,
+          self.case_flags, self.zerowidth)
+
+    def rebuild(self, positive, case_flags, zerowidth):
+        return Range(self.lower, self.upper, positive, case_flags, zerowidth)
+
+    def optimise(self, info, reverse, in_set=False):
+        # Is the range case-sensitive?
+        if not self.positive or not (self.case_flags & IGNORECASE) or in_set:
+            return self
+
+        # Is full case-folding possible?
+        if (not (info.flags & UNICODE) or (self.case_flags & FULLIGNORECASE) !=
+          FULLIGNORECASE):
+            return self
+
+        # Get the characters which expand to multiple codepoints on folding.
+        expanding_chars = _regex.get_expand_on_folding()
+
+        # Get the folded characters in the range.
+        items = []
+        for ch in expanding_chars:
+            if self.lower <= ord(ch) <= self.upper:
+                folded = _regex.fold_case(FULL_CASE_FOLDING, ch)
+                items.append(String([ord(c) for c in folded],
+                  case_flags=self.case_flags))
+
+        if not items:
+            # We can fall back to simple case-folding.
+            return self
+
+        if len(items) < self.upper - self.lower + 1:
+            # Not all the characters are covered by the full case-folding.
+            items.insert(0, self)
+
+        return Branch(items)
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if self.positive:
+            flags |= POSITIVE_OP
+        if self.zerowidth:
+            flags |= ZEROWIDTH_OP
+        if fuzzy:
+            flags |= FUZZY_OP
+        return [(self._opcode[self.case_flags, reverse], flags, self.lower,
+          self.upper)]
+
+    def dump(self, indent, reverse):
+        display_lower = ascii(chr(self.lower)).lstrip("bu")
+        display_upper = ascii(chr(self.upper)).lstrip("bu")
+        print("{}RANGE {} {} {}{}".format(INDENT * indent,
+          POS_TEXT[self.positive], display_lower, display_upper,
+          CASE_TEXT[self.case_flags]))
+
+    def matches(self, ch):
+        return (self.lower <= ch <= self.upper) == self.positive
+
+    def max_width(self):
+        return 1
+
+class RefGroup(RegexBase):
+    _opcode = {(NOCASE, False): OP.REF_GROUP, (IGNORECASE, False):
+      OP.REF_GROUP_IGN, (FULLCASE, False): OP.REF_GROUP, (FULLIGNORECASE,
+      False): OP.REF_GROUP_FLD, (NOCASE, True): OP.REF_GROUP_REV, (IGNORECASE,
+      True): OP.REF_GROUP_IGN_REV, (FULLCASE, True): OP.REF_GROUP_REV,
+      (FULLIGNORECASE, True): OP.REF_GROUP_FLD_REV}
+
+    def __init__(self, info, group, position, case_flags=NOCASE):
+        RegexBase.__init__(self)
+        self.info = info
+        self.group = group
+        self.position = position
+        self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags]
+
+        self._key = self.__class__, self.group, self.case_flags
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        try:
+            self.group = int(self.group)
+        except ValueError:
+            try:
+                self.group = self.info.group_index[self.group]
+            except KeyError:
+                raise error("unknown group", pattern, self.position)
+
+        if not 1 <= self.group <= self.info.group_count:
+            raise error("invalid group reference", pattern, self.position)
+
+        self._key = self.__class__, self.group, self.case_flags
+
+    def remove_captures(self):
+        raise error("group reference not allowed", pattern, self.position)
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if fuzzy:
+            flags |= FUZZY_OP
+        return [(self._opcode[self.case_flags, reverse], flags, self.group)]
+
+    def dump(self, indent, reverse):
+        print("{}REF_GROUP {}{}".format(INDENT * indent, self.group,
+          CASE_TEXT[self.case_flags]))
+
+    def max_width(self):
+        return UNLIMITED
+
+    def __del__(self):
+        self.info = None
+
+class SearchAnchor(ZeroWidthBase):
+    _opcode = OP.SEARCH_ANCHOR
+    _op_name = "SEARCH_ANCHOR"
+
+class Sequence(RegexBase):
+    def __init__(self, items=None):
+        RegexBase.__init__(self)
+        if items is None:
+            items = []
+
+        self.items = items
+
+    def fix_groups(self, pattern, reverse, fuzzy):
+        for s in self.items:
+            s.fix_groups(pattern, reverse, fuzzy)
+
+    def optimise(self, info, reverse):
+        # Flatten the sequences.
+        items = []
+        for s in self.items:
+            s = s.optimise(info, reverse)
+            if isinstance(s, Sequence):
+                items.extend(s.items)
+            else:
+                items.append(s)
+
+        return make_sequence(items)
+
+    def pack_characters(self, info):
+        "Packs sequences of characters into strings."
+        items = []
+        characters = []
+        case_flags = NOCASE
+        for s in self.items:
+            if type(s) is Character and s.positive and not s.zerowidth:
+                if s.case_flags != case_flags:
+                    # Different case sensitivity, so flush, unless neither the
+                    # previous nor the new character are cased.
+                    if s.case_flags or is_cased_i(info, s.value):
+                        Sequence._flush_characters(info, characters,
+                          case_flags, items)
+
+                        case_flags = s.case_flags
+
+                characters.append(s.value)
+            elif type(s) is String or type(s) is Literal:
+                if s.case_flags != case_flags:
+                    # Different case sensitivity, so flush, unless the neither
+                    # the previous nor the new string are cased.
+                    if s.case_flags or any(is_cased_i(info, c) for c in
+                      characters):
+                        Sequence._flush_characters(info, characters,
+                          case_flags, items)
+
+                        case_flags = s.case_flags
+
+                characters.extend(s.characters)
+            else:
+                Sequence._flush_characters(info, characters, case_flags, items)
+
+                items.append(s.pack_characters(info))
+
+        Sequence._flush_characters(info, characters, case_flags, items)
+
+        return make_sequence(items)
+
+    def remove_captures(self):
+        self.items = [s.remove_captures() for s in self.items]
+        return self
+
+    def is_atomic(self):
+        return all(s.is_atomic() for s in self.items)
+
+    def can_be_affix(self):
+        return False
+
+    def contains_group(self):
+        return any(s.contains_group() for s in self.items)
+
+    def get_firstset(self, reverse):
+        fs = set()
+        items = self.items
+        if reverse:
+            items.reverse()
+        for s in items:
+            fs |= s.get_firstset(reverse)
+            if None not in fs:
+                return fs
+            fs.discard(None)
+
+        return fs | set([None])
+
+    def has_simple_start(self):
+        return bool(self.items) and self.items[0].has_simple_start()
+
+    def _compile(self, reverse, fuzzy):
+        seq = self.items
+        if reverse:
+            seq = seq[::-1]
+
+        code = []
+        for s in seq:
+            code.extend(s.compile(reverse, fuzzy))
+
+        return code
+
+    def dump(self, indent, reverse):
+        for s in self.items:
+            s.dump(indent, reverse)
+
+    @staticmethod
+    def _flush_characters(info, characters, case_flags, items):
+        if not characters:
+            return
+
+        # Disregard case_flags if all of the characters are case-less.
+        if case_flags & IGNORECASE:
+            if not any(is_cased_i(info, c) for c in characters):
+                case_flags = NOCASE
+
+        if (case_flags & FULLIGNORECASE) == FULLIGNORECASE:
+            literals = Sequence._fix_full_casefold(characters)
+
+            for item in literals:
+                chars = item.characters
+
+                if len(chars) == 1:
+                    items.append(Character(chars[0], case_flags=item.case_flags))
+                else:
+                    items.append(String(chars, case_flags=item.case_flags))
+        else:
+            if len(characters) == 1:
+                items.append(Character(characters[0], case_flags=case_flags))
+            else:
+                items.append(String(characters, case_flags=case_flags))
+
+        characters[:] = []
+
+    @staticmethod
+    def _fix_full_casefold(characters):
+        # Split a literal needing full case-folding into chunks that need it
+        # and chunks that can use simple case-folding, which is faster.
+        expanded = [_regex.fold_case(FULL_CASE_FOLDING, c) for c in
+          _regex.get_expand_on_folding()]
+        string = _regex.fold_case(FULL_CASE_FOLDING, ''.join(chr(c)
+          for c in characters)).lower()
+        chunks = []
+
+        for e in expanded:
+            found = string.find(e)
+
+            while found >= 0:
+                chunks.append((found, found + len(e)))
+                found = string.find(e, found + 1)
+
+        pos = 0
+        literals = []
+
+        for start, end in Sequence._merge_chunks(chunks):
+            if pos < start:
+                literals.append(Literal(characters[pos : start],
+                  case_flags=IGNORECASE))
+
+            literals.append(Literal(characters[start : end],
+              case_flags=FULLIGNORECASE))
+            pos = end
+
+        if pos < len(characters):
+            literals.append(Literal(characters[pos : ], case_flags=IGNORECASE))
+
+        return literals
+
+    @staticmethod
+    def _merge_chunks(chunks):
+        if len(chunks) < 2:
+            return chunks
+
+        chunks.sort()
+
+        start, end = chunks[0]
+        new_chunks = []
+
+        for s, e in chunks[1 : ]:
+            if s <= end:
+                end = max(end, e)
+            else:
+                new_chunks.append((start, end))
+                start, end = s, e
+
+        new_chunks.append((start, end))
+
+        return new_chunks
+
+    def is_empty(self):
+        return all(i.is_empty() for i in self.items)
+
+    def __eq__(self, other):
+        return type(self) is type(other) and self.items == other.items
+
+    def max_width(self):
+        return sum(s.max_width() for s in self.items)
+
+    def get_required_string(self, reverse):
+        seq = self.items
+        if reverse:
+            seq = seq[::-1]
+
+        offset = 0
+
+        for s in seq:
+            ofs, req = s.get_required_string(reverse)
+            offset += ofs
+            if req:
+                return offset, req
+
+        return offset, None
+
+class SetBase(RegexBase):
+    def __init__(self, info, items, positive=True, case_flags=NOCASE,
+      zerowidth=False):
+        RegexBase.__init__(self)
+        self.info = info
+        self.items = tuple(items)
+        self.positive = bool(positive)
+        self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags]
+        self.zerowidth = bool(zerowidth)
+
+        self.char_width = 1
+
+        self._key = (self.__class__, self.items, self.positive,
+          self.case_flags, self.zerowidth)
+
+    def rebuild(self, positive, case_flags, zerowidth):
+        return type(self)(self.info, self.items, positive, case_flags,
+          zerowidth).optimise(self.info, False)
+
+    def get_firstset(self, reverse):
+        return set([self])
+
+    def has_simple_start(self):
+        return True
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if self.positive:
+            flags |= POSITIVE_OP
+        if self.zerowidth:
+            flags |= ZEROWIDTH_OP
+        if fuzzy:
+            flags |= FUZZY_OP
+        code = [(self._opcode[self.case_flags, reverse], flags)]
+        for m in self.items:
+            code.extend(m.compile())
+
+        code.append((OP.END, ))
+
+        return code
+
+    def dump(self, indent, reverse):
+        print("{}{} {}{}".format(INDENT * indent, self._op_name,
+          POS_TEXT[self.positive], CASE_TEXT[self.case_flags]))
+        for i in self.items:
+            i.dump(indent + 1, reverse)
+
+    def _handle_case_folding(self, info, in_set):
+        # Is the set case-sensitive?
+        if not self.positive or not (self.case_flags & IGNORECASE) or in_set:
+            return self
+
+        # Is full case-folding possible?
+        if (not (self.info.flags & UNICODE) or (self.case_flags &
+          FULLIGNORECASE) != FULLIGNORECASE):
+            return self
+
+        # Get the characters which expand to multiple codepoints on folding.
+        expanding_chars = _regex.get_expand_on_folding()
+
+        # Get the folded characters in the set.
+        items = []
+        seen = set()
+        for ch in expanding_chars:
+            if self.matches(ord(ch)):
+                folded = _regex.fold_case(FULL_CASE_FOLDING, ch)
+                if folded not in seen:
+                    items.append(String([ord(c) for c in folded],
+                      case_flags=self.case_flags))
+                    seen.add(folded)
+
+        if not items:
+            # We can fall back to simple case-folding.
+            return self
+
+        return Branch([self] + items)
+
+    def max_width(self):
+        # Is the set case-sensitive?
+        if not self.positive or not (self.case_flags & IGNORECASE):
+            return 1
+
+        # Is full case-folding possible?
+        if (not (self.info.flags & UNICODE) or (self.case_flags &
+          FULLIGNORECASE) != FULLIGNORECASE):
+            return 1
+
+        # Get the characters which expand to multiple codepoints on folding.
+        expanding_chars = _regex.get_expand_on_folding()
+
+        # Get the folded characters in the set.
+        seen = set()
+        for ch in expanding_chars:
+            if self.matches(ord(ch)):
+                folded = _regex.fold_case(FULL_CASE_FOLDING, ch)
+                seen.add(folded)
+
+        if not seen:
+            return 1
+
+        return max(len(folded) for folded in seen)
+
+    def __del__(self):
+        self.info = None
+
+class SetDiff(SetBase):
+    _opcode = {(NOCASE, False): OP.SET_DIFF, (IGNORECASE, False):
+      OP.SET_DIFF_IGN, (FULLCASE, False): OP.SET_DIFF, (FULLIGNORECASE, False):
+      OP.SET_DIFF_IGN, (NOCASE, True): OP.SET_DIFF_REV, (IGNORECASE, True):
+      OP.SET_DIFF_IGN_REV, (FULLCASE, True): OP.SET_DIFF_REV, (FULLIGNORECASE,
+      True): OP.SET_DIFF_IGN_REV}
+    _op_name = "SET_DIFF"
+
+    def optimise(self, info, reverse, in_set=False):
+        items = self.items
+        if len(items) > 2:
+            items = [items[0], SetUnion(info, items[1 : ])]
+
+        if len(items) == 1:
+            return items[0].with_flags(case_flags=self.case_flags,
+              zerowidth=self.zerowidth).optimise(info, reverse, in_set)
+
+        self.items = tuple(m.optimise(info, reverse, in_set=True) for m in
+          items)
+
+        return self._handle_case_folding(info, in_set)
+
+    def matches(self, ch):
+        m = self.items[0].matches(ch) and not self.items[1].matches(ch)
+        return m == self.positive
+
+class SetInter(SetBase):
+    _opcode = {(NOCASE, False): OP.SET_INTER, (IGNORECASE, False):
+      OP.SET_INTER_IGN, (FULLCASE, False): OP.SET_INTER, (FULLIGNORECASE,
+      False): OP.SET_INTER_IGN, (NOCASE, True): OP.SET_INTER_REV, (IGNORECASE,
+      True): OP.SET_INTER_IGN_REV, (FULLCASE, True): OP.SET_INTER_REV,
+      (FULLIGNORECASE, True): OP.SET_INTER_IGN_REV}
+    _op_name = "SET_INTER"
+
+    def optimise(self, info, reverse, in_set=False):
+        items = []
+        for m in self.items:
+            m = m.optimise(info, reverse, in_set=True)
+            if isinstance(m, SetInter) and m.positive:
+                # Intersection in intersection.
+                items.extend(m.items)
+            else:
+                items.append(m)
+
+        if len(items) == 1:
+            return items[0].with_flags(case_flags=self.case_flags,
+              zerowidth=self.zerowidth).optimise(info, reverse, in_set)
+
+        self.items = tuple(items)
+
+        return self._handle_case_folding(info, in_set)
+
+    def matches(self, ch):
+        m = all(i.matches(ch) for i in self.items)
+        return m == self.positive
+
+class SetSymDiff(SetBase):
+    _opcode = {(NOCASE, False): OP.SET_SYM_DIFF, (IGNORECASE, False):
+      OP.SET_SYM_DIFF_IGN, (FULLCASE, False): OP.SET_SYM_DIFF, (FULLIGNORECASE,
+      False): OP.SET_SYM_DIFF_IGN, (NOCASE, True): OP.SET_SYM_DIFF_REV,
+      (IGNORECASE, True): OP.SET_SYM_DIFF_IGN_REV, (FULLCASE, True):
+      OP.SET_SYM_DIFF_REV, (FULLIGNORECASE, True): OP.SET_SYM_DIFF_IGN_REV}
+    _op_name = "SET_SYM_DIFF"
+
+    def optimise(self, info, reverse, in_set=False):
+        items = []
+        for m in self.items:
+            m = m.optimise(info, reverse, in_set=True)
+            if isinstance(m, SetSymDiff) and m.positive:
+                # Symmetric difference in symmetric difference.
+                items.extend(m.items)
+            else:
+                items.append(m)
+
+        if len(items) == 1:
+            return items[0].with_flags(case_flags=self.case_flags,
+              zerowidth=self.zerowidth).optimise(info, reverse, in_set)
+
+        self.items = tuple(items)
+
+        return self._handle_case_folding(info, in_set)
+
+    def matches(self, ch):
+        m = False
+        for i in self.items:
+            m = m != i.matches(ch)
+
+        return m == self.positive
+
+class SetUnion(SetBase):
+    _opcode = {(NOCASE, False): OP.SET_UNION, (IGNORECASE, False):
+      OP.SET_UNION_IGN, (FULLCASE, False): OP.SET_UNION, (FULLIGNORECASE,
+      False): OP.SET_UNION_IGN, (NOCASE, True): OP.SET_UNION_REV, (IGNORECASE,
+      True): OP.SET_UNION_IGN_REV, (FULLCASE, True): OP.SET_UNION_REV,
+      (FULLIGNORECASE, True): OP.SET_UNION_IGN_REV}
+    _op_name = "SET_UNION"
+
+    def optimise(self, info, reverse, in_set=False):
+        items = []
+        for m in self.items:
+            m = m.optimise(info, reverse, in_set=True)
+            if isinstance(m, SetUnion) and m.positive:
+                # Union in union.
+                items.extend(m.items)
+            else:
+                items.append(m)
+
+        if len(items) == 1:
+            i = items[0]
+            return i.with_flags(positive=i.positive == self.positive,
+              case_flags=self.case_flags,
+              zerowidth=self.zerowidth).optimise(info, reverse, in_set)
+
+        self.items = tuple(items)
+
+        return self._handle_case_folding(info, in_set)
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if self.positive:
+            flags |= POSITIVE_OP
+        if self.zerowidth:
+            flags |= ZEROWIDTH_OP
+        if fuzzy:
+            flags |= FUZZY_OP
+
+        characters, others = defaultdict(list), []
+        for m in self.items:
+            if isinstance(m, Character):
+                characters[m.positive].append(m.value)
+            else:
+                others.append(m)
+
+        code = [(self._opcode[self.case_flags, reverse], flags)]
+
+        for positive, values in characters.items():
+            flags = 0
+            if positive:
+                flags |= POSITIVE_OP
+            if len(values) == 1:
+                code.append((OP.CHARACTER, flags, values[0]))
+            else:
+                code.append((OP.STRING, flags, len(values)) + tuple(values))
+
+        for m in others:
+            code.extend(m.compile())
+
+        code.append((OP.END, ))
+
+        return code
+
+    def matches(self, ch):
+        m = any(i.matches(ch) for i in self.items)
+        return m == self.positive
+
+class Skip(ZeroWidthBase):
+    _op_name = "SKIP"
+    _opcode = OP.SKIP
+
+class StartOfLine(ZeroWidthBase):
+    _opcode = OP.START_OF_LINE
+    _op_name = "START_OF_LINE"
+
+class StartOfLineU(StartOfLine):
+    _opcode = OP.START_OF_LINE_U
+    _op_name = "START_OF_LINE_U"
+
+class StartOfString(ZeroWidthBase):
+    _opcode = OP.START_OF_STRING
+    _op_name = "START_OF_STRING"
+
+class StartOfWord(ZeroWidthBase):
+    _opcode = OP.START_OF_WORD
+    _op_name = "START_OF_WORD"
+
+class String(RegexBase):
+    _opcode = {(NOCASE, False): OP.STRING, (IGNORECASE, False): OP.STRING_IGN,
+      (FULLCASE, False): OP.STRING, (FULLIGNORECASE, False): OP.STRING_FLD,
+      (NOCASE, True): OP.STRING_REV, (IGNORECASE, True): OP.STRING_IGN_REV,
+      (FULLCASE, True): OP.STRING_REV, (FULLIGNORECASE, True):
+      OP.STRING_FLD_REV}
+
+    def __init__(self, characters, case_flags=NOCASE):
+        self.characters = tuple(characters)
+        self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags]
+
+        if (self.case_flags & FULLIGNORECASE) == FULLIGNORECASE:
+            folded_characters = []
+            for char in self.characters:
+                folded = _regex.fold_case(FULL_CASE_FOLDING, chr(char))
+                folded_characters.extend(ord(c) for c in folded)
+        else:
+            folded_characters = self.characters
+
+        self.folded_characters = tuple(folded_characters)
+        self.required = False
+
+        self._key = self.__class__, self.characters, self.case_flags
+
+    def get_firstset(self, reverse):
+        if reverse:
+            pos = -1
+        else:
+            pos = 0
+        return set([Character(self.characters[pos],
+          case_flags=self.case_flags)])
+
+    def has_simple_start(self):
+        return True
+
+    def _compile(self, reverse, fuzzy):
+        flags = 0
+        if fuzzy:
+            flags |= FUZZY_OP
+        if self.required:
+            flags |= REQUIRED_OP
+        return [(self._opcode[self.case_flags, reverse], flags,
+          len(self.folded_characters)) + self.folded_characters]
+
+    def dump(self, indent, reverse):
+        display = ascii("".join(chr(c) for c in self.characters)).lstrip("bu")
+        print("{}STRING {}{}".format(INDENT * indent, display,
+          CASE_TEXT[self.case_flags]))
+
+    def max_width(self):
+        return len(self.folded_characters)
+
+    def get_required_string(self, reverse):
+        return 0, self
+
+class Literal(String):
+    def dump(self, indent, reverse):
+        literal = ''.join(chr(c) for c in self.characters)
+        display = ascii(literal).lstrip("bu")
+        print("{}LITERAL MATCH {}{}".format(INDENT * indent, display,
+          CASE_TEXT[self.case_flags]))
+
+class StringSet(Branch):
+    def __init__(self, info, name, case_flags=NOCASE):
+        self.info = info
+        self.name = name
+        self.case_flags = CASE_FLAGS_COMBINATIONS[case_flags]
+
+        self._key = self.__class__, self.name, self.case_flags
+
+        self.set_key = (name, self.case_flags)
+        if self.set_key not in info.named_lists_used:
+            info.named_lists_used[self.set_key] = len(info.named_lists_used)
+
+        index = self.info.named_lists_used[self.set_key]
+        items = self.info.kwargs[self.name]
+
+        case_flags = self.case_flags
+
+        encoding = self.info.flags & _ALL_ENCODINGS
+        fold_flags = encoding | case_flags
+
+        choices = []
+
+        for string in items:
+            if isinstance(string, str):
+                string = [ord(c) for c in string]
+
+            choices.append([Character(c, case_flags=case_flags) for c in
+              string])
+
+        # Sort from longest to shortest.
+        choices.sort(key=len, reverse=True)
+
+        self.branches = [Sequence(choice) for choice in choices]
+
+    def dump(self, indent, reverse):
+        print("{}STRING_SET {}{}".format(INDENT * indent, self.name,
+          CASE_TEXT[self.case_flags]))
+
+    def __del__(self):
+        self.info = None
+
+class Source:
+    "Scanner for the regular expression source string."
+    def __init__(self, string):
+        if isinstance(string, str):
+            self.string = string
+            self.char_type = chr
+        else:
+            self.string = string.decode("latin-1")
+            self.char_type = lambda c: bytes([c])
+
+        self.pos = 0
+        self.ignore_space = False
+        self.sep = string[ : 0]
+
+    def get(self, override_ignore=False):
+        string = self.string
+        pos = self.pos
+
+        try:
+            if self.ignore_space and not override_ignore:
+                while True:
+                    if string[pos].isspace():
+                        # Skip over the whitespace.
+                        pos += 1
+                    elif string[pos] == "#":
+                        # Skip over the comment to the end of the line.
+                        pos = string.index("\n", pos)
+                    else:
+                        break
+
+            ch = string[pos]
+            self.pos = pos + 1
+            return ch
+        except IndexError:
+            # We've reached the end of the string.
+            self.pos = pos
+            return string[ : 0]
+        except ValueError:
+            # The comment extended to the end of the string.
+            self.pos = len(string)
+            return string[ : 0]
+
+    def get_many(self, count=1):
+        string = self.string
+        pos = self.pos
+
+        try:
+            if self.ignore_space:
+                substring = []
+
+                while len(substring) < count:
+                    while True:
+                        if string[pos].isspace():
+                            # Skip over the whitespace.
+                            pos += 1
+                        elif string[pos] == "#":
+                            # Skip over the comment to the end of the line.
+                            pos = string.index("\n", pos)
+                        else:
+                            break
+
+                    substring.append(string[pos])
+                    pos += 1
+
+                substring = "".join(substring)
+            else:
+                substring = string[pos : pos + count]
+                pos += len(substring)
+
+            self.pos = pos
+            return substring
+        except IndexError:
+            # We've reached the end of the string.
+            self.pos = len(string)
+            return "".join(substring)
+        except ValueError:
+            # The comment extended to the end of the string.
+            self.pos = len(string)
+            return "".join(substring)
+
+    def get_while(self, test_set, include=True, keep_spaces=False):
+        string = self.string
+        pos = self.pos
+
+        if self.ignore_space and not keep_spaces:
+            try:
+                substring = []
+
+                while True:
+                    if string[pos].isspace():
+                        # Skip over the whitespace.
+                        pos += 1
+                    elif string[pos] == "#":
+                        # Skip over the comment to the end of the line.
+                        pos = string.index("\n", pos)
+                    elif (string[pos] in test_set) == include:
+                        substring.append(string[pos])
+                        pos += 1
+                    else:
+                        break
+
+                self.pos = pos
+            except IndexError:
+                # We've reached the end of the string.
+                self.pos = len(string)
+            except ValueError:
+                # The comment extended to the end of the string.
+                self.pos = len(string)
+
+            return "".join(substring)
+        else:
+            try:
+                while (string[pos] in test_set) == include:
+                    pos += 1
+
+                substring = string[self.pos : pos]
+
+                self.pos = pos
+
+                return substring
+            except IndexError:
+                # We've reached the end of the string.
+                substring = string[self.pos : pos]
+
+                self.pos = pos
+
+                return substring
+
+    def skip_while(self, test_set, include=True):
+        string = self.string
+        pos = self.pos
+
+        try:
+            if self.ignore_space:
+                while True:
+                    if string[pos].isspace():
+                        # Skip over the whitespace.
+                        pos += 1
+                    elif string[pos] == "#":
+                        # Skip over the comment to the end of the line.
+                        pos = string.index("\n", pos)
+                    elif (string[pos] in test_set) == include:
+                        pos += 1
+                    else:
+                        break
+            else:
+                while (string[pos] in test_set) == include:
+                    pos += 1
+
+            self.pos = pos
+        except IndexError:
+            # We've reached the end of the string.
+            self.pos = len(string)
+        except ValueError:
+            # The comment extended to the end of the string.
+            self.pos = len(string)
+
+    def match(self, substring):
+        string = self.string
+        pos = self.pos
+
+        if self.ignore_space:
+            try:
+                for c in substring:
+                    while True:
+                        if string[pos].isspace():
+                            # Skip over the whitespace.
+                            pos += 1
+                        elif string[pos] == "#":
+                            # Skip over the comment to the end of the line.
+                            pos = string.index("\n", pos)
+                        else:
+                            break
+
+                    if string[pos] != c:
+                        return False
+
+                    pos += 1
+
+                self.pos = pos
+
+                return True
+            except IndexError:
+                # We've reached the end of the string.
+                return False
+            except ValueError:
+                # The comment extended to the end of the string.
+                return False
+        else:
+            if not string.startswith(substring, pos):
+                return False
+
+            self.pos = pos + len(substring)
+
+            return True
+
+    def expect(self, substring):
+        if not self.match(substring):
+            raise error("missing {}".format(substring), self.string, self.pos)
+
+    def at_end(self):
+        string = self.string
+        pos = self.pos
+
+        try:
+            if self.ignore_space:
+                while True:
+                    if string[pos].isspace():
+                        pos += 1
+                    elif string[pos] == "#":
+                        pos = string.index("\n", pos)
+                    else:
+                        break
+
+            return pos >= len(string)
+        except IndexError:
+            # We've reached the end of the string.
+            return True
+        except ValueError:
+            # The comment extended to the end of the string.
+            return True
+
+class Info:
+    "Info about the regular expression."
+
+    def __init__(self, flags=0, char_type=None, kwargs={}):
+        flags |= DEFAULT_FLAGS[(flags & _ALL_VERSIONS) or DEFAULT_VERSION]
+        self.flags = flags
+        self.global_flags = flags
+        self.inline_locale = False
+
+        self.kwargs = kwargs
+
+        self.group_count = 0
+        self.group_index = {}
+        self.group_name = {}
+        self.char_type = char_type
+        self.named_lists_used = {}
+        self.open_groups = []
+        self.open_group_count = {}
+        self.defined_groups = {}
+        self.group_calls = []
+        self.private_groups = {}
+
+    def open_group(self, name=None):
+        group = self.group_index.get(name)
+        if group is None:
+            while True:
+                self.group_count += 1
+                if name is None or self.group_count not in self.group_name:
+                    break
+
+            group = self.group_count
+            if name:
+                self.group_index[name] = group
+                self.group_name[group] = name
+
+        if group in self.open_groups:
+            # We have a nested named group. We'll assign it a private group
+            # number, initially negative until we can assign a proper
+            # (positive) number.
+            group_alias = -(len(self.private_groups) + 1)
+            self.private_groups[group_alias] = group
+            group = group_alias
+
+        self.open_groups.append(group)
+        self.open_group_count[group] = self.open_group_count.get(group, 0) + 1
+
+        return group
+
+    def close_group(self):
+        self.open_groups.pop()
+
+    def is_open_group(self, name):
+        # In version 1, a group reference can refer to an open group. We'll
+        # just pretend the group isn't open.
+        version = (self.flags & _ALL_VERSIONS) or DEFAULT_VERSION
+        if version == VERSION1:
+            return False
+
+        if name.isdigit():
+            group = int(name)
+        else:
+            group = self.group_index.get(name)
+
+        return group in self.open_groups
+
+def _check_group_features(info, parsed):
+    """Checks whether the reverse and fuzzy features of the group calls match
+    the groups which they call.
+    """
+    call_refs = {}
+    additional_groups = []
+    for call, reverse, fuzzy in info.group_calls:
+        # Look up the reference of this group call.
+        key = (call.group, reverse, fuzzy)
+        ref = call_refs.get(key)
+        if ref is None:
+            # This group doesn't have a reference yet, so look up its features.
+            if call.group == 0:
+                # Calling the pattern as a whole.
+                rev = bool(info.flags & REVERSE)
+                fuz = isinstance(parsed, Fuzzy)
+                if (rev, fuz) != (reverse, fuzzy):
+                    # The pattern as a whole doesn't have the features we want,
+                    # so we'll need to make a copy of it with the desired
+                    # features.
+                    additional_groups.append((CallRef(len(call_refs), parsed),
+                      reverse, fuzzy))
+            else:
+                # Calling a capture group.
+                def_info = info.defined_groups[call.group]
+                group = def_info[0]
+                if def_info[1 : ] != (reverse, fuzzy):
+                    # The group doesn't have the features we want, so we'll
+                    # need to make a copy of it with the desired features.
+                    additional_groups.append((group, reverse, fuzzy))
+
+            ref = len(call_refs)
+            call_refs[key] = ref
+
+        call.call_ref = ref
+
+    info.call_refs = call_refs
+    info.additional_groups = additional_groups
+
+def _get_required_string(parsed, flags):
+    "Gets the required string and related info of a parsed pattern."
+
+    req_offset, required = parsed.get_required_string(bool(flags & REVERSE))
+    if required:
+        required.required = True
+        if req_offset >= UNLIMITED:
+            req_offset = -1
+
+        req_flags = required.case_flags
+        if not (flags & UNICODE):
+            req_flags &= ~UNICODE
+
+        req_chars = required.folded_characters
+    else:
+        req_offset = 0
+        req_chars = ()
+        req_flags = 0
+
+    return req_offset, req_chars, req_flags
+
+class Scanner:
+    def __init__(self, lexicon, flags=0):
+        self.lexicon = lexicon
+
+        # Combine phrases into a compound pattern.
+        patterns = []
+        for phrase, action in lexicon:
+            # Parse the regular expression.
+            source = Source(phrase)
+            info = Info(flags, source.char_type)
+            source.ignore_space = bool(info.flags & VERBOSE)
+            parsed = _parse_pattern(source, info)
+            if not source.at_end():
+                raise error("unbalanced parenthesis", source.string,
+                  source.pos)
+
+            # We want to forbid capture groups within each phrase.
+            patterns.append(parsed.remove_captures())
+
+        # Combine all the subpatterns into one pattern.
+        info = Info(flags)
+        patterns = [Group(info, g + 1, p) for g, p in enumerate(patterns)]
+        parsed = Branch(patterns)
+
+        # Optimise the compound pattern.
+        reverse = bool(info.flags & REVERSE)
+        parsed = parsed.optimise(info, reverse)
+        parsed = parsed.pack_characters(info)
+
+        # Get the required string.
+        req_offset, req_chars, req_flags = _get_required_string(parsed,
+          info.flags)
+
+        # Check the features of the groups.
+        _check_group_features(info, parsed)
+
+        # Complain if there are any group calls. They are not supported by the
+        # Scanner class.
+        if info.call_refs:
+            raise error("recursive regex not supported by Scanner",
+              source.string, source.pos)
+
+        reverse = bool(info.flags & REVERSE)
+
+        # Compile the compound pattern. The result is a list of tuples.
+        code = parsed.compile(reverse) + [(OP.SUCCESS, )]
+
+        # Flatten the code into a list of ints.
+        code = _flatten_code(code)
+
+        if not parsed.has_simple_start():
+            # Get the first set, if possible.
+            try:
+                fs_code = _compile_firstset(info, parsed.get_firstset(reverse))
+                fs_code = _flatten_code(fs_code)
+                code = fs_code + code
+            except _FirstSetError:
+                pass
+
+        # Check the global flags for conflicts.
+        version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION
+        if version not in (0, VERSION0, VERSION1):
+            raise ValueError("VERSION0 and VERSION1 flags are mutually incompatible")
+
+        # Create the PatternObject.
+        #
+        # Local flags like IGNORECASE affect the code generation, but aren't
+        # needed by the PatternObject itself. Conversely, global flags like
+        # LOCALE _don't_ affect the code generation but _are_ needed by the
+        # PatternObject.
+        self.scanner = _regex.compile(None, (flags & GLOBAL_FLAGS) | version,
+          code, {}, {}, {}, [], req_offset, req_chars, req_flags,
+          len(patterns))
+
+    def scan(self, string):
+        result = []
+        append = result.append
+        match = self.scanner.scanner(string).match
+        i = 0
+        while True:
+            m = match()
+            if not m:
+                break
+            j = m.end()
+            if i == j:
+                break
+            action = self.lexicon[m.lastindex - 1][1]
+            if hasattr(action, '__call__'):
+                self.match = m
+                action = action(self, m.group())
+            if action is not None:
+                append(action)
+            i = j
+
+        return result, string[i : ]
+
+# Get the known properties dict.
+PROPERTIES = _regex.get_properties()
+
+# Build the inverse of the properties dict.
+PROPERTY_NAMES = {}
+for prop_name, (prop_id, values) in PROPERTIES.items():
+    name, prop_values = PROPERTY_NAMES.get(prop_id, ("", {}))
+    name = max(name, prop_name, key=len)
+    PROPERTY_NAMES[prop_id] = name, prop_values
+
+    for val_name, val_id in values.items():
+        prop_values[val_id] = max(prop_values.get(val_id, ""), val_name,
+          key=len)
+
+# Character escape sequences.
+CHARACTER_ESCAPES = {
+    "a": "\a",
+    "b": "\b",
+    "f": "\f",
+    "n": "\n",
+    "r": "\r",
+    "t": "\t",
+    "v": "\v",
+}
+
+# Predefined character set escape sequences.
+CHARSET_ESCAPES = {
+    "d": lookup_property(None, "Digit", True),
+    "D": lookup_property(None, "Digit", False),
+    "h": lookup_property(None, "Blank", True),
+    "s": lookup_property(None, "Space", True),
+    "S": lookup_property(None, "Space", False),
+    "w": lookup_property(None, "Word", True),
+    "W": lookup_property(None, "Word", False),
+}
+
+# Positional escape sequences.
+POSITION_ESCAPES = {
+    "A": StartOfString(),
+    "b": Boundary(),
+    "B": Boundary(False),
+    "K": Keep(),
+    "m": StartOfWord(),
+    "M": EndOfWord(),
+    "Z": EndOfString(),
+}
+
+# Positional escape sequences when WORD flag set.
+WORD_POSITION_ESCAPES = dict(POSITION_ESCAPES)
+WORD_POSITION_ESCAPES.update({
+    "b": DefaultBoundary(),
+    "B": DefaultBoundary(False),
+    "m": DefaultStartOfWord(),
+    "M": DefaultEndOfWord(),
+})
+
+# Regex control verbs.
+VERBS = {
+    "FAIL": Failure(),
+    "F": Failure(),
+    "PRUNE": Prune(),
+    "SKIP": Skip(),
+}
diff --git a/.venv/lib/python3.12/site-packages/regex/regex.py b/.venv/lib/python3.12/site-packages/regex/regex.py
new file mode 100644
index 00000000..0fdb4da9
--- /dev/null
+++ b/.venv/lib/python3.12/site-packages/regex/regex.py
@@ -0,0 +1,746 @@
+#
+# Secret Labs' Regular Expression Engine
+#
+# Copyright (c) 1998-2001 by Secret Labs AB.  All rights reserved.
+#
+# This version of the SRE library can be redistributed under CNRI's
+# Python 1.6 license.  For any other use, please contact Secret Labs
+# AB (info@pythonware.com).
+#
+# Portions of this engine have been developed in cooperation with
+# CNRI.  Hewlett-Packard provided funding for 1.6 integration and
+# other compatibility work.
+#
+# 2010-01-16 mrab Python front-end re-written and extended
+
+r"""Support for regular expressions (RE).
+
+This module provides regular expression matching operations similar to those
+found in Perl. It supports both 8-bit and Unicode strings; both the pattern and
+the strings being processed can contain null bytes and characters outside the
+US ASCII range.
+
+Regular expressions can contain both special and ordinary characters. Most
+ordinary characters, like "A", "a", or "0", are the simplest regular
+expressions; they simply match themselves. You can concatenate ordinary
+characters, so last matches the string 'last'.
+
+There are a few differences between the old (legacy) behaviour and the new
+(enhanced) behaviour, which are indicated by VERSION0 or VERSION1.
+
+The special characters are:
+    "."                 Matches any character except a newline.
+    "^"                 Matches the start of the string.
+    "$"                 Matches the end of the string or just before the
+                        newline at the end of the string.
+    "*"                 Matches 0 or more (greedy) repetitions of the preceding
+                        RE. Greedy means that it will match as many repetitions
+                        as possible.
+    "+"                 Matches 1 or more (greedy) repetitions of the preceding
+                        RE.
+    "?"                 Matches 0 or 1 (greedy) of the preceding RE.
+    *?,+?,??            Non-greedy versions of the previous three special
+                        characters.
+    *+,++,?+            Possessive versions of the previous three special
+                        characters.
+    {m,n}               Matches from m to n repetitions of the preceding RE.
+    {m,n}?              Non-greedy version of the above.
+    {m,n}+              Possessive version of the above.
+    {...}               Fuzzy matching constraints.
+    "\\"                Either escapes special characters or signals a special
+                        sequence.
+    [...]               Indicates a set of characters. A "^" as the first
+                        character indicates a complementing set.
+    "|"                 A|B, creates an RE that will match either A or B.
+    (...)               Matches the RE inside the parentheses. The contents are
+                        captured and can be retrieved or matched later in the
+                        string.
+    (?flags-flags)      VERSION1: Sets/clears the flags for the remainder of
+                        the group or pattern; VERSION0: Sets the flags for the
+                        entire pattern.
+    (?:...)             Non-capturing version of regular parentheses.
+    (?>...)             Atomic non-capturing version of regular parentheses.
+    (?flags-flags:...)  Non-capturing version of regular parentheses with local
+                        flags.
+    (?P<name>...)       The substring matched by the group is accessible by
+                        name.
+    (?<name>...)        The substring matched by the group is accessible by
+                        name.
+    (?P=name)           Matches the text matched earlier by the group named
+                        name.
+    (?#...)             A comment; ignored.
+    (?=...)             Matches if ... matches next, but doesn't consume the
+                        string.
+    (?!...)             Matches if ... doesn't match next.
+    (?<=...)            Matches if preceded by ....
+    (?<!...)            Matches if not preceded by ....
+    (?(id)yes|no)       Matches yes pattern if group id matched, the (optional)
+                        no pattern otherwise.
+    (?(DEFINE)...)      If there's no group called "DEFINE", then ... will be
+                        ignored, but any group definitions will be available.
+    (?|...|...)         (?|A|B), creates an RE that will match either A or B,
+                        but reuses capture group numbers across the
+                        alternatives.
+    (*FAIL)             Forces matching to fail, which means immediate
+                        backtracking.
+    (*F)                Abbreviation for (*FAIL).
+    (*PRUNE)            Discards the current backtracking information. Its
+                        effect doesn't extend outside an atomic group or a
+                        lookaround.
+    (*SKIP)             Similar to (*PRUNE), except that it also sets where in
+                        the text the next attempt at matching the entire
+                        pattern will start. Its effect doesn't extend outside
+                        an atomic group or a lookaround.
+
+The fuzzy matching constraints are: "i" to permit insertions, "d" to permit
+deletions, "s" to permit substitutions, "e" to permit any of these. Limits are
+optional with "<=" and "<". If any type of error is provided then any type not
+provided is not permitted.
+
+A cost equation may be provided.
+
+Examples:
+    (?:fuzzy){i<=2}
+    (?:fuzzy){i<=1,s<=2,d<=1,1i+1s+1d<3}
+
+VERSION1: Set operators are supported, and a set can include nested sets. The
+set operators, in order of increasing precedence, are:
+    ||  Set union ("x||y" means "x or y").
+    ~~  (double tilde) Symmetric set difference ("x~~y" means "x or y, but not
+        both").
+    &&  Set intersection ("x&&y" means "x and y").
+    --  (double dash) Set difference ("x--y" means "x but not y").
+
+Implicit union, ie, simple juxtaposition like in [ab], has the highest
+precedence.
+
+VERSION0 and VERSION1:
+The special sequences consist of "\\" and a character from the list below. If
+the ordinary character is not on the list, then the resulting RE will match the
+second character.
+    \number         Matches the contents of the group of the same number if
+                    number is no more than 2 digits, otherwise the character
+                    with the 3-digit octal code.
+    \a              Matches the bell character.
+    \A              Matches only at the start of the string.
+    \b              Matches the empty string, but only at the start or end of a
+                    word.
+    \B              Matches the empty string, but not at the start or end of a
+                    word.
+    \d              Matches any decimal digit; equivalent to the set [0-9] when
+                    matching a bytestring or a Unicode string with the ASCII
+                    flag, or the whole range of Unicode digits when matching a
+                    Unicode string.
+    \D              Matches any non-digit character; equivalent to [^\d].
+    \f              Matches the formfeed character.
+    \g<name>        Matches the text matched by the group named name.
+    \G              Matches the empty string, but only at the position where
+                    the search started.
+    \h              Matches horizontal whitespace.
+    \K              Keeps only what follows for the entire match.
+    \L<name>        Named list. The list is provided as a keyword argument.
+    \m              Matches the empty string, but only at the start of a word.
+    \M              Matches the empty string, but only at the end of a word.
+    \n              Matches the newline character.
+    \N{name}        Matches the named character.
+    \p{name=value}  Matches the character if its property has the specified
+                    value.
+    \P{name=value}  Matches the character if its property hasn't the specified
+                    value.
+    \r              Matches the carriage-return character.
+    \s              Matches any whitespace character; equivalent to
+                    [ \t\n\r\f\v].
+    \S              Matches any non-whitespace character; equivalent to [^\s].
+    \t              Matches the tab character.
+    \uXXXX          Matches the Unicode codepoint with 4-digit hex code XXXX.
+    \UXXXXXXXX      Matches the Unicode codepoint with 8-digit hex code
+                    XXXXXXXX.
+    \v              Matches the vertical tab character.
+    \w              Matches any alphanumeric character; equivalent to
+                    [a-zA-Z0-9_] when matching a bytestring or a Unicode string
+                    with the ASCII flag, or the whole range of Unicode
+                    alphanumeric characters (letters plus digits plus
+                    underscore) when matching a Unicode string. With LOCALE, it
+                    will match the set [0-9_] plus characters defined as
+                    letters for the current locale.
+    \W              Matches the complement of \w; equivalent to [^\w].
+    \xXX            Matches the character with 2-digit hex code XX.
+    \X              Matches a grapheme.
+    \Z              Matches only at the end of the string.
+    \\              Matches a literal backslash.
+
+This module exports the following functions:
+    match      Match a regular expression pattern at the beginning of a string.
+    fullmatch  Match a regular expression pattern against all of a string.
+    search     Search a string for the presence of a pattern.
+    sub        Substitute occurrences of a pattern found in a string using a
+               template string.
+    subf       Substitute occurrences of a pattern found in a string using a
+               format string.
+    subn       Same as sub, but also return the number of substitutions made.
+    subfn      Same as subf, but also return the number of substitutions made.
+    split      Split a string by the occurrences of a pattern. VERSION1: will
+               split at zero-width match; VERSION0: won't split at zero-width
+               match.
+    splititer  Return an iterator yielding the parts of a split string.
+    findall    Find all occurrences of a pattern in a string.
+    finditer   Return an iterator yielding a match object for each match.
+    compile    Compile a pattern into a Pattern object.
+    purge      Clear the regular expression cache.
+    escape     Backslash all non-alphanumerics or special characters in a
+               string.
+
+Most of the functions support a concurrent parameter: if True, the GIL will be
+released during matching, allowing other Python threads to run concurrently. If
+the string changes during matching, the behaviour is undefined. This parameter
+is not needed when working on the builtin (immutable) string classes.
+
+Some of the functions in this module take flags as optional parameters. Most of
+these flags can also be set within an RE:
+    A   a   ASCII         Make \w, \W, \b, \B, \d, and \D match the
+                          corresponding ASCII character categories. Default
+                          when matching a bytestring.
+    B   b   BESTMATCH     Find the best fuzzy match (default is first).
+    D       DEBUG         Print the parsed pattern.
+    E   e   ENHANCEMATCH  Attempt to improve the fit after finding the first
+                          fuzzy match.
+    F   f   FULLCASE      Use full case-folding when performing
+                          case-insensitive matching in Unicode.
+    I   i   IGNORECASE    Perform case-insensitive matching.
+    L   L   LOCALE        Make \w, \W, \b, \B, \d, and \D dependent on the
+                          current locale. (One byte per character only.)
+    M   m   MULTILINE     "^" matches the beginning of lines (after a newline)
+                          as well as the string. "$" matches the end of lines
+                          (before a newline) as well as the end of the string.
+    P   p   POSIX         Perform POSIX-standard matching (leftmost longest).
+    R   r   REVERSE       Searches backwards.
+    S   s   DOTALL        "." matches any character at all, including the
+                          newline.
+    U   u   UNICODE       Make \w, \W, \b, \B, \d, and \D dependent on the
+                          Unicode locale. Default when matching a Unicode
+                          string.
+    V0  V0  VERSION0      Turn on the old legacy behaviour.
+    V1  V1  VERSION1      Turn on the new enhanced behaviour. This flag
+                          includes the FULLCASE flag.
+    W   w   WORD          Make \b and \B work with default Unicode word breaks
+                          and make ".", "^" and "$" work with Unicode line
+                          breaks.
+    X   x   VERBOSE       Ignore whitespace and comments for nicer looking REs.
+
+This module also defines an exception 'error'.
+
+"""
+
+# Public symbols.
+__all__ = ["cache_all", "compile", "DEFAULT_VERSION", "escape", "findall",
+  "finditer", "fullmatch", "match", "purge", "search", "split", "splititer",
+  "sub", "subf", "subfn", "subn", "template", "Scanner", "A", "ASCII", "B",
+  "BESTMATCH", "D", "DEBUG", "E", "ENHANCEMATCH", "S", "DOTALL", "F",
+  "FULLCASE", "I", "IGNORECASE", "L", "LOCALE", "M", "MULTILINE", "P", "POSIX",
+  "R", "REVERSE", "T", "TEMPLATE", "U", "UNICODE", "V0", "VERSION0", "V1",
+  "VERSION1", "X", "VERBOSE", "W", "WORD", "error", "Regex", "__version__",
+  "__doc__", "RegexFlag"]
+
+__version__ = "2.5.148"
+
+# --------------------------------------------------------------------
+# Public interface.
+
+def match(pattern, string, flags=0, pos=None, endpos=None, partial=False,
+  concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Try to apply the pattern at the start of the string, returning a match
+    object, or None if no match was found."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.match(string, pos, endpos, concurrent, partial, timeout)
+
+def fullmatch(pattern, string, flags=0, pos=None, endpos=None, partial=False,
+  concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Try to apply the pattern against all of the string, returning a match
+    object, or None if no match was found."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.fullmatch(string, pos, endpos, concurrent, partial, timeout)
+
+def search(pattern, string, flags=0, pos=None, endpos=None, partial=False,
+  concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Search through string looking for a match to the pattern, returning a
+    match object, or None if no match was found."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.search(string, pos, endpos, concurrent, partial, timeout)
+
+def sub(pattern, repl, string, count=0, flags=0, pos=None, endpos=None,
+  concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Return the string obtained by replacing the leftmost (or rightmost with a
+    reverse pattern) non-overlapping occurrences of the pattern in string by the
+    replacement repl. repl can be either a string or a callable; if a string,
+    backslash escapes in it are processed; if a callable, it's passed the match
+    object and must return a replacement string to be used."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.sub(repl, string, count, pos, endpos, concurrent, timeout)
+
+def subf(pattern, format, string, count=0, flags=0, pos=None, endpos=None,
+  concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Return the string obtained by replacing the leftmost (or rightmost with a
+    reverse pattern) non-overlapping occurrences of the pattern in string by the
+    replacement format. format can be either a string or a callable; if a string,
+    it's treated as a format string; if a callable, it's passed the match object
+    and must return a replacement string to be used."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.subf(format, string, count, pos, endpos, concurrent, timeout)
+
+def subn(pattern, repl, string, count=0, flags=0, pos=None, endpos=None,
+  concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Return a 2-tuple containing (new_string, number). new_string is the string
+    obtained by replacing the leftmost (or rightmost with a reverse pattern)
+    non-overlapping occurrences of the pattern in the source string by the
+    replacement repl. number is the number of substitutions that were made. repl
+    can be either a string or a callable; if a string, backslash escapes in it
+    are processed; if a callable, it's passed the match object and must return a
+    replacement string to be used."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.subn(repl, string, count, pos, endpos, concurrent, timeout)
+
+def subfn(pattern, format, string, count=0, flags=0, pos=None, endpos=None,
+  concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Return a 2-tuple containing (new_string, number). new_string is the string
+    obtained by replacing the leftmost (or rightmost with a reverse pattern)
+    non-overlapping occurrences of the pattern in the source string by the
+    replacement format. number is the number of substitutions that were made. format
+    can be either a string or a callable; if a string, it's treated as a format
+    string; if a callable, it's passed the match object and must return a
+    replacement string to be used."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.subfn(format, string, count, pos, endpos, concurrent, timeout)
+
+def split(pattern, string, maxsplit=0, flags=0, concurrent=None, timeout=None,
+  ignore_unused=False, **kwargs):
+    """Split the source string by the occurrences of the pattern, returning a
+    list containing the resulting substrings.  If capturing parentheses are used
+    in pattern, then the text of all groups in the pattern are also returned as
+    part of the resulting list.  If maxsplit is nonzero, at most maxsplit splits
+    occur, and the remainder of the string is returned as the final element of
+    the list."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.split(string, maxsplit, concurrent, timeout)
+
+def splititer(pattern, string, maxsplit=0, flags=0, concurrent=None,
+  timeout=None, ignore_unused=False, **kwargs):
+    "Return an iterator yielding the parts of a split string."
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.splititer(string, maxsplit, concurrent, timeout)
+
+def findall(pattern, string, flags=0, pos=None, endpos=None, overlapped=False,
+  concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Return a list of all matches in the string. The matches may be overlapped
+    if overlapped is True. If one or more groups are present in the pattern,
+    return a list of groups; this will be a list of tuples if the pattern has
+    more than one group. Empty matches are included in the result."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.findall(string, pos, endpos, overlapped, concurrent, timeout)
+
+def finditer(pattern, string, flags=0, pos=None, endpos=None, overlapped=False,
+  partial=False, concurrent=None, timeout=None, ignore_unused=False, **kwargs):
+    """Return an iterator over all matches in the string. The matches may be
+    overlapped if overlapped is True. For each match, the iterator returns a
+    match object. Empty matches are included in the result."""
+    pat = _compile(pattern, flags, ignore_unused, kwargs, True)
+    return pat.finditer(string, pos, endpos, overlapped, concurrent, partial,
+      timeout)
+
+def compile(pattern, flags=0, ignore_unused=False, cache_pattern=None, **kwargs):
+    "Compile a regular expression pattern, returning a pattern object."
+    if cache_pattern is None:
+        cache_pattern = _cache_all
+    return _compile(pattern, flags, ignore_unused, kwargs, cache_pattern)
+
+def purge():
+    "Clear the regular expression cache"
+    _cache.clear()
+    _locale_sensitive.clear()
+
+# Whether to cache all patterns.
+_cache_all = True
+
+def cache_all(value=True):
+    """Sets whether to cache all patterns, even those are compiled explicitly.
+    Passing None has no effect, but returns the current setting."""
+    global _cache_all
+
+    if value is None:
+        return _cache_all
+
+    _cache_all = value
+
+def template(pattern, flags=0):
+    "Compile a template pattern, returning a pattern object."
+    return _compile(pattern, flags | TEMPLATE, False, {}, False)
+
+def escape(pattern, special_only=True, literal_spaces=False):
+    """Escape a string for use as a literal in a pattern. If special_only is
+    True, escape only special characters, else escape all non-alphanumeric
+    characters. If literal_spaces is True, don't escape spaces."""
+    # Convert it to Unicode.
+    if isinstance(pattern, bytes):
+        p = pattern.decode("latin-1")
+    else:
+        p = pattern
+
+    s = []
+    if special_only:
+        for c in p:
+            if c == " " and literal_spaces:
+                s.append(c)
+            elif c in _METACHARS or c.isspace():
+                s.append("\\")
+                s.append(c)
+            else:
+                s.append(c)
+    else:
+        for c in p:
+            if c == " " and literal_spaces:
+                s.append(c)
+            elif c in _ALNUM:
+                s.append(c)
+            else:
+                s.append("\\")
+                s.append(c)
+
+    r = "".join(s)
+    # Convert it back to bytes if necessary.
+    if isinstance(pattern, bytes):
+        r = r.encode("latin-1")
+
+    return r
+
+# --------------------------------------------------------------------
+# Internals.
+
+import regex._regex_core as _regex_core
+import regex._regex as _regex
+from threading import RLock as _RLock
+from locale import getpreferredencoding as _getpreferredencoding
+from regex._regex_core import *
+from regex._regex_core import (_ALL_VERSIONS, _ALL_ENCODINGS, _FirstSetError,
+  _UnscopedFlagSet, _check_group_features, _compile_firstset,
+  _compile_replacement, _flatten_code, _fold_case, _get_required_string,
+  _parse_pattern, _shrink_cache)
+from regex._regex_core import (ALNUM as _ALNUM, Info as _Info, OP as _OP, Source
+  as _Source, Fuzzy as _Fuzzy)
+
+# Version 0 is the old behaviour, compatible with the original 're' module.
+# Version 1 is the new behaviour, which differs slightly.
+
+DEFAULT_VERSION = VERSION0
+
+_METACHARS = frozenset("()[]{}?*+|^$\\.-#&~")
+
+_regex_core.DEFAULT_VERSION = DEFAULT_VERSION
+
+# Caches for the patterns and replacements.
+_cache = {}
+_cache_lock = _RLock()
+_named_args = {}
+_replacement_cache = {}
+_locale_sensitive = {}
+
+# Maximum size of the cache.
+_MAXCACHE = 500
+_MAXREPCACHE = 500
+
+def _compile(pattern, flags, ignore_unused, kwargs, cache_it):
+    "Compiles a regular expression to a PatternObject."
+
+    global DEFAULT_VERSION
+    try:
+        from regex import DEFAULT_VERSION
+    except ImportError:
+        pass
+
+    # We won't bother to cache the pattern if we're debugging.
+    if (flags & DEBUG) != 0:
+        cache_it = False
+
+    # What locale is this pattern using?
+    locale_key = (type(pattern), pattern)
+    if _locale_sensitive.get(locale_key, True) or (flags & LOCALE) != 0:
+        # This pattern is, or might be, locale-sensitive.
+        pattern_locale = _getpreferredencoding()
+    else:
+        # This pattern is definitely not locale-sensitive.
+        pattern_locale = None
+
+    def complain_unused_args():
+        if ignore_unused:
+            return
+
+        # Complain about any unused keyword arguments, possibly resulting from a typo.
+        unused_kwargs = set(kwargs) - {k for k, v in args_needed}
+        if unused_kwargs:
+            any_one = next(iter(unused_kwargs))
+            raise ValueError('unused keyword argument {!a}'.format(any_one))
+
+    if cache_it:
+        try:
+            # Do we know what keyword arguments are needed?
+            args_key = pattern, type(pattern), flags
+            args_needed = _named_args[args_key]
+
+            # Are we being provided with its required keyword arguments?
+            args_supplied = set()
+            if args_needed:
+                for k, v in args_needed:
+                    try:
+                        args_supplied.add((k, frozenset(kwargs[k])))
+                    except KeyError:
+                        raise error("missing named list: {!r}".format(k))
+
+            complain_unused_args()
+
+            args_supplied = frozenset(args_supplied)
+
+            # Have we already seen this regular expression and named list?
+            pattern_key = (pattern, type(pattern), flags, args_supplied,
+              DEFAULT_VERSION, pattern_locale)
+            return _cache[pattern_key]
+        except KeyError:
+            # It's a new pattern, or new named list for a known pattern.
+            pass
+
+    # Guess the encoding from the class of the pattern string.
+    if isinstance(pattern, str):
+        guess_encoding = UNICODE
+    elif isinstance(pattern, bytes):
+        guess_encoding = ASCII
+    elif isinstance(pattern, Pattern):
+        if flags:
+            raise ValueError("cannot process flags argument with a compiled pattern")
+
+        return pattern
+    else:
+        raise TypeError("first argument must be a string or compiled pattern")
+
+    # Set the default version in the core code in case it has been changed.
+    _regex_core.DEFAULT_VERSION = DEFAULT_VERSION
+
+    global_flags = flags
+
+    while True:
+        caught_exception = None
+        try:
+            source = _Source(pattern)
+            info = _Info(global_flags, source.char_type, kwargs)
+            info.guess_encoding = guess_encoding
+            source.ignore_space = bool(info.flags & VERBOSE)
+            parsed = _parse_pattern(source, info)
+            break
+        except _UnscopedFlagSet:
+            # Remember the global flags for the next attempt.
+            global_flags = info.global_flags
+        except error as e:
+            caught_exception = e
+
+        if caught_exception:
+            raise error(caught_exception.msg, caught_exception.pattern,
+              caught_exception.pos)
+
+    if not source.at_end():
+        raise error("unbalanced parenthesis", pattern, source.pos)
+
+    # Check the global flags for conflicts.
+    version = (info.flags & _ALL_VERSIONS) or DEFAULT_VERSION
+    if version not in (0, VERSION0, VERSION1):
+        raise ValueError("VERSION0 and VERSION1 flags are mutually incompatible")
+
+    if (info.flags & _ALL_ENCODINGS) not in (0, ASCII, LOCALE, UNICODE):
+        raise ValueError("ASCII, LOCALE and UNICODE flags are mutually incompatible")
+
+    if isinstance(pattern, bytes) and (info.flags & UNICODE):
+        raise ValueError("cannot use UNICODE flag with a bytes pattern")
+
+    if not (info.flags & _ALL_ENCODINGS):
+        if isinstance(pattern, str):
+            info.flags |= UNICODE
+        else:
+            info.flags |= ASCII
+
+    reverse = bool(info.flags & REVERSE)
+    fuzzy = isinstance(parsed, _Fuzzy)
+
+    # Remember whether this pattern as an inline locale flag.
+    _locale_sensitive[locale_key] = info.inline_locale
+
+    # Fix the group references.
+    caught_exception = None
+    try:
+        parsed.fix_groups(pattern, reverse, False)
+    except error as e:
+        caught_exception = e
+
+    if caught_exception:
+        raise error(caught_exception.msg, caught_exception.pattern,
+          caught_exception.pos)
+
+    # Should we print the parsed pattern?
+    if flags & DEBUG:
+        parsed.dump(indent=0, reverse=reverse)
+
+    # Optimise the parsed pattern.
+    parsed = parsed.optimise(info, reverse)
+    parsed = parsed.pack_characters(info)
+
+    # Get the required string.
+    req_offset, req_chars, req_flags = _get_required_string(parsed, info.flags)
+
+    # Build the named lists.
+    named_lists = {}
+    named_list_indexes = [None] * len(info.named_lists_used)
+    args_needed = set()
+    for key, index in info.named_lists_used.items():
+        name, case_flags = key
+        values = frozenset(kwargs[name])
+        if case_flags:
+            items = frozenset(_fold_case(info, v) for v in values)
+        else:
+            items = values
+        named_lists[name] = values
+        named_list_indexes[index] = items
+        args_needed.add((name, values))
+
+    complain_unused_args()
+
+    # Check the features of the groups.
+    _check_group_features(info, parsed)
+
+    # Compile the parsed pattern. The result is a list of tuples.
+    code = parsed.compile(reverse)
+
+    # Is there a group call to the pattern as a whole?
+    key = (0, reverse, fuzzy)
+    ref = info.call_refs.get(key)
+    if ref is not None:
+        code = [(_OP.CALL_REF, ref)] + code + [(_OP.END, )]
+
+    # Add the final 'success' opcode.
+    code += [(_OP.SUCCESS, )]
+
+    # Compile the additional copies of the groups that we need.
+    for group, rev, fuz in info.additional_groups:
+        code += group.compile(rev, fuz)
+
+    # Flatten the code into a list of ints.
+    code = _flatten_code(code)
+
+    if not parsed.has_simple_start():
+        # Get the first set, if possible.
+        try:
+            fs_code = _compile_firstset(info, parsed.get_firstset(reverse))
+            fs_code = _flatten_code(fs_code)
+            code = fs_code + code
+        except _FirstSetError:
+            pass
+
+    # The named capture groups.
+    index_group = dict((v, n) for n, v in info.group_index.items())
+
+    # Create the PatternObject.
+    #
+    # Local flags like IGNORECASE affect the code generation, but aren't needed
+    # by the PatternObject itself. Conversely, global flags like LOCALE _don't_
+    # affect the code generation but _are_ needed by the PatternObject.
+    compiled_pattern = _regex.compile(pattern, info.flags | version, code,
+      info.group_index, index_group, named_lists, named_list_indexes,
+      req_offset, req_chars, req_flags, info.group_count)
+
+    # Do we need to reduce the size of the cache?
+    if len(_cache) >= _MAXCACHE:
+        with _cache_lock:
+            _shrink_cache(_cache, _named_args, _locale_sensitive, _MAXCACHE)
+
+    if cache_it:
+        if (info.flags & LOCALE) == 0:
+            pattern_locale = None
+
+        args_needed = frozenset(args_needed)
+
+        # Store this regular expression and named list.
+        pattern_key = (pattern, type(pattern), flags, args_needed,
+          DEFAULT_VERSION, pattern_locale)
+        _cache[pattern_key] = compiled_pattern
+
+        # Store what keyword arguments are needed.
+        _named_args[args_key] = args_needed
+
+    return compiled_pattern
+
+def _compile_replacement_helper(pattern, template):
+    "Compiles a replacement template."
+    # This function is called by the _regex module.
+
+    # Have we seen this before?
+    key = pattern.pattern, pattern.flags, template
+    compiled = _replacement_cache.get(key)
+    if compiled is not None:
+        return compiled
+
+    if len(_replacement_cache) >= _MAXREPCACHE:
+        _replacement_cache.clear()
+
+    is_unicode = isinstance(template, str)
+    source = _Source(template)
+    if is_unicode:
+        def make_string(char_codes):
+            return "".join(chr(c) for c in char_codes)
+    else:
+        def make_string(char_codes):
+            return bytes(char_codes)
+
+    compiled = []
+    literal = []
+    while True:
+        ch = source.get()
+        if not ch:
+            break
+        if ch == "\\":
+            # '_compile_replacement' will return either an int group reference
+            # or a string literal. It returns items (plural) in order to handle
+            # a 2-character literal (an invalid escape sequence).
+            is_group, items = _compile_replacement(source, pattern, is_unicode)
+            if is_group:
+                # It's a group, so first flush the literal.
+                if literal:
+                    compiled.append(make_string(literal))
+                    literal = []
+                compiled.extend(items)
+            else:
+                literal.extend(items)
+        else:
+            literal.append(ord(ch))
+
+    # Flush the literal.
+    if literal:
+        compiled.append(make_string(literal))
+
+    _replacement_cache[key] = compiled
+
+    return compiled
+
+# We define Pattern here after all the support objects have been defined.
+_pat = _compile('', 0, False, {}, False)
+Pattern = type(_pat)
+Match = type(_pat.match(''))
+del _pat
+
+# Make Pattern public for typing annotations.
+__all__.append("Pattern")
+__all__.append("Match")
+
+# We'll define an alias for the 'compile' function so that the repr of a
+# pattern object is eval-able.
+Regex = compile
+
+# Register myself for pickling.
+import copyreg as _copy_reg
+
+def _pickle(pattern):
+    return _regex.compile, pattern._pickled_data
+
+_copy_reg.pickle(Pattern, _pickle)
diff --git a/.venv/lib/python3.12/site-packages/regex/test_regex.py b/.venv/lib/python3.12/site-packages/regex/test_regex.py
new file mode 100644
index 00000000..bce5a871
--- /dev/null
+++ b/.venv/lib/python3.12/site-packages/regex/test_regex.py
@@ -0,0 +1,4488 @@
+from weakref import proxy
+import copy
+import pickle
+import regex
+import string
+import sys
+import unittest
+
+# String subclasses for issue 18468.
+class StrSubclass(str):
+    def __getitem__(self, index):
+        return StrSubclass(super().__getitem__(index))
+
+class BytesSubclass(bytes):
+    def __getitem__(self, index):
+        return BytesSubclass(super().__getitem__(index))
+
+class RegexTests(unittest.TestCase):
+    PATTERN_CLASS = "<class '_regex.Pattern'>"
+    FLAGS_WITH_COMPILED_PAT = "cannot process flags argument with a compiled pattern"
+    INVALID_GROUP_REF = "invalid group reference"
+    MISSING_GT = "missing >"
+    BAD_GROUP_NAME = "bad character in group name"
+    MISSING_GROUP_NAME = "missing group name"
+    MISSING_LT = "missing <"
+    UNKNOWN_GROUP_I = "unknown group"
+    UNKNOWN_GROUP = "unknown group"
+    BAD_ESCAPE = r"bad escape \(end of pattern\)"
+    BAD_OCTAL_ESCAPE = r"bad escape \\"
+    BAD_SET = "unterminated character set"
+    STR_PAT_ON_BYTES = "cannot use a string pattern on a bytes-like object"
+    BYTES_PAT_ON_STR = "cannot use a bytes pattern on a string-like object"
+    STR_PAT_BYTES_TEMPL = "expected str instance, bytes found"
+    BYTES_PAT_STR_TEMPL = "expected a bytes-like object, str found"
+    BYTES_PAT_UNI_FLAG = "cannot use UNICODE flag with a bytes pattern"
+    MIXED_FLAGS = "ASCII, LOCALE and UNICODE flags are mutually incompatible"
+    MISSING_RPAREN = "missing \\)"
+    TRAILING_CHARS = "unbalanced parenthesis"
+    BAD_CHAR_RANGE = "bad character range"
+    NOTHING_TO_REPEAT = "nothing to repeat"
+    MULTIPLE_REPEAT = "multiple repeat"
+    OPEN_GROUP = "cannot refer to an open group"
+    DUPLICATE_GROUP = "duplicate group"
+    CANT_TURN_OFF = "bad inline flags: cannot turn flags off"
+    UNDEF_CHAR_NAME = "undefined character name"
+
+    def assertTypedEqual(self, actual, expect, msg=None):
+        self.assertEqual(actual, expect, msg)
+
+        def recurse(actual, expect):
+            if isinstance(expect, (tuple, list)):
+                for x, y in zip(actual, expect):
+                    recurse(x, y)
+            else:
+                self.assertIs(type(actual), type(expect), msg)
+
+        recurse(actual, expect)
+
+    def test_weakref(self):
+        s = 'QabbbcR'
+        x = regex.compile('ab+c')
+        y = proxy(x)
+        if x.findall('QabbbcR') != y.findall('QabbbcR'):
+            self.fail()
+
+    def test_search_star_plus(self):
+        self.assertEqual(regex.search('a*', 'xxx').span(0), (0, 0))
+        self.assertEqual(regex.search('x*', 'axx').span(), (0, 0))
+        self.assertEqual(regex.search('x+', 'axx').span(0), (1, 3))
+        self.assertEqual(regex.search('x+', 'axx').span(), (1, 3))
+        self.assertEqual(regex.search('x', 'aaa'), None)
+        self.assertEqual(regex.match('a*', 'xxx').span(0), (0, 0))
+        self.assertEqual(regex.match('a*', 'xxx').span(), (0, 0))
+        self.assertEqual(regex.match('x*', 'xxxa').span(0), (0, 3))
+        self.assertEqual(regex.match('x*', 'xxxa').span(), (0, 3))
+        self.assertEqual(regex.match('a+', 'xxx'), None)
+
+    def bump_num(self, matchobj):
+        int_value = int(matchobj[0])
+        return str(int_value + 1)
+
+    def test_basic_regex_sub(self):
+        self.assertEqual(regex.sub("(?i)b+", "x", "bbbb BBBB"), 'x x')
+        self.assertEqual(regex.sub(r'\d+', self.bump_num, '08.2 -2 23x99y'),
+          '9.3 -3 24x100y')
+        self.assertEqual(regex.sub(r'\d+', self.bump_num, '08.2 -2 23x99y', 3),
+          '9.3 -3 23x99y')
+
+        self.assertEqual(regex.sub('.', lambda m: r"\n", 'x'), "\\n")
+        self.assertEqual(regex.sub('.', r"\n", 'x'), "\n")
+
+        self.assertEqual(regex.sub('(?P<a>x)', r'\g<a>\g<a>', 'xx'), 'xxxx')
+        self.assertEqual(regex.sub('(?P<a>x)', r'\g<a>\g<1>', 'xx'), 'xxxx')
+        self.assertEqual(regex.sub('(?P<unk>x)', r'\g<unk>\g<unk>', 'xx'),
+          'xxxx')
+        self.assertEqual(regex.sub('(?P<unk>x)', r'\g<1>\g<1>', 'xx'), 'xxxx')
+
+        self.assertEqual(regex.sub('a', r'\t\n\v\r\f\a\b', 'a'), "\t\n\v\r\f\a\b")
+        self.assertEqual(regex.sub('a', '\t\n\v\r\f\a', 'a'), "\t\n\v\r\f\a")
+        self.assertEqual(regex.sub('a', '\t\n\v\r\f\a', 'a'), chr(9) + chr(10)
+          + chr(11) + chr(13) + chr(12) + chr(7))
+
+        self.assertEqual(regex.sub(r'^\s*', 'X', 'test'), 'Xtest')
+
+        self.assertEqual(regex.sub(r"x", r"\x0A", "x"), "\n")
+        self.assertEqual(regex.sub(r"x", r"\u000A", "x"), "\n")
+        self.assertEqual(regex.sub(r"x", r"\U0000000A", "x"), "\n")
+        self.assertEqual(regex.sub(r"x", r"\N{LATIN CAPITAL LETTER A}",
+          "x"), "A")
+
+        self.assertEqual(regex.sub(br"x", br"\x0A", b"x"), b"\n")
+
+    def test_bug_449964(self):
+        # Fails for group followed by other escape.
+        self.assertEqual(regex.sub(r'(?P<unk>x)', r'\g<1>\g<1>\b', 'xx'),
+          "xx\bxx\b")
+
+    def test_bug_449000(self):
+        # Test for sub() on escaped characters.
+        self.assertEqual(regex.sub(r'\r\n', r'\n', 'abc\r\ndef\r\n'),
+          "abc\ndef\n")
+        self.assertEqual(regex.sub('\r\n', r'\n', 'abc\r\ndef\r\n'),
+          "abc\ndef\n")
+        self.assertEqual(regex.sub(r'\r\n', '\n', 'abc\r\ndef\r\n'),
+          "abc\ndef\n")
+        self.assertEqual(regex.sub('\r\n', '\n', 'abc\r\ndef\r\n'),
+          "abc\ndef\n")
+
+    def test_bug_1661(self):
+        # Verify that flags do not get silently ignored with compiled patterns
+        pattern = regex.compile('.')
+        self.assertRaisesRegex(ValueError, self.FLAGS_WITH_COMPILED_PAT,
+          lambda: regex.match(pattern, 'A', regex.I))
+        self.assertRaisesRegex(ValueError, self.FLAGS_WITH_COMPILED_PAT,
+          lambda: regex.search(pattern, 'A', regex.I))
+        self.assertRaisesRegex(ValueError, self.FLAGS_WITH_COMPILED_PAT,
+          lambda: regex.findall(pattern, 'A', regex.I))
+        self.assertRaisesRegex(ValueError, self.FLAGS_WITH_COMPILED_PAT,
+          lambda: regex.compile(pattern, regex.I))
+
+    def test_bug_3629(self):
+        # A regex that triggered a bug in the sre-code validator
+        self.assertEqual(repr(type(regex.compile("(?P<quote>)(?(quote))"))),
+          self.PATTERN_CLASS)
+
+    def test_sub_template_numeric_escape(self):
+        # Bug 776311 and friends.
+        self.assertEqual(regex.sub('x', r'\0', 'x'), "\0")
+        self.assertEqual(regex.sub('x', r'\000', 'x'), "\000")
+        self.assertEqual(regex.sub('x', r'\001', 'x'), "\001")
+        self.assertEqual(regex.sub('x', r'\008', 'x'), "\0" + "8")
+        self.assertEqual(regex.sub('x', r'\009', 'x'), "\0" + "9")
+        self.assertEqual(regex.sub('x', r'\111', 'x'), "\111")
+        self.assertEqual(regex.sub('x', r'\117', 'x'), "\117")
+
+        self.assertEqual(regex.sub('x', r'\1111', 'x'), "\1111")
+        self.assertEqual(regex.sub('x', r'\1111', 'x'), "\111" + "1")
+
+        self.assertEqual(regex.sub('x', r'\00', 'x'), '\x00')
+        self.assertEqual(regex.sub('x', r'\07', 'x'), '\x07')
+        self.assertEqual(regex.sub('x', r'\08', 'x'), "\0" + "8")
+        self.assertEqual(regex.sub('x', r'\09', 'x'), "\0" + "9")
+        self.assertEqual(regex.sub('x', r'\0a', 'x'), "\0" + "a")
+
+        self.assertEqual(regex.sub('x', r'\400', 'x'), "\u0100")
+        self.assertEqual(regex.sub('x', r'\777', 'x'), "\u01FF")
+        self.assertEqual(regex.sub(b'x', br'\400', b'x'), b"\x00")
+        self.assertEqual(regex.sub(b'x', br'\777', b'x'), b"\xFF")
+
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\1', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\8', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\9', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\11', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\18', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\1a', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\90', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\99', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\118', 'x')) # r'\11' + '8'
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\11a', 'x'))
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\181', 'x')) # r'\18' + '1'
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.sub('x', r'\800', 'x')) # r'\80' + '0'
+
+        # In Python 2.3 (etc), these loop endlessly in sre_parser.py.
+        self.assertEqual(regex.sub('(((((((((((x)))))))))))', r'\11', 'x'),
+          'x')
+        self.assertEqual(regex.sub('((((((((((y))))))))))(.)', r'\118', 'xyz'),
+          'xz8')
+        self.assertEqual(regex.sub('((((((((((y))))))))))(.)', r'\11a', 'xyz'),
+          'xza')
+
+    def test_qualified_re_sub(self):
+        self.assertEqual(regex.sub('a', 'b', 'aaaaa'), 'bbbbb')
+        self.assertEqual(regex.sub('a', 'b', 'aaaaa', 1), 'baaaa')
+
+    def test_bug_114660(self):
+        self.assertEqual(regex.sub(r'(\S)\s+(\S)', r'\1 \2', 'hello  there'),
+          'hello there')
+
+    def test_bug_462270(self):
+        # Test for empty sub() behaviour, see SF bug #462270
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.sub('(?V0)x*', '-', 'abxd'), '-a-b--d-')
+        else:
+            self.assertEqual(regex.sub('(?V0)x*', '-', 'abxd'), '-a-b-d-')
+        self.assertEqual(regex.sub('(?V1)x*', '-', 'abxd'), '-a-b--d-')
+        self.assertEqual(regex.sub('x+', '-', 'abxd'), 'ab-d')
+
+    def test_bug_14462(self):
+        # chr(255) is a valid identifier in Python 3.
+        group_name = '\xFF'
+        self.assertEqual(regex.search(r'(?P<' + group_name + '>a)',
+          'abc').group(group_name), 'a')
+
+    def test_symbolic_refs(self):
+        self.assertRaisesRegex(regex.error, self.MISSING_GT, lambda:
+          regex.sub('(?P<a>x)', r'\g<a', 'xx'))
+        self.assertRaisesRegex(regex.error, self.MISSING_GROUP_NAME, lambda:
+          regex.sub('(?P<a>x)', r'\g<', 'xx'))
+        self.assertRaisesRegex(regex.error, self.MISSING_LT, lambda:
+          regex.sub('(?P<a>x)', r'\g', 'xx'))
+        self.assertRaisesRegex(regex.error, self.BAD_GROUP_NAME, lambda:
+          regex.sub('(?P<a>x)', r'\g<a a>', 'xx'))
+        self.assertRaisesRegex(regex.error, self.BAD_GROUP_NAME, lambda:
+          regex.sub('(?P<a>x)', r'\g<1a1>', 'xx'))
+        self.assertRaisesRegex(IndexError, self.UNKNOWN_GROUP_I, lambda:
+          regex.sub('(?P<a>x)', r'\g<ab>', 'xx'))
+
+        # The new behaviour of unmatched but valid groups is to treat them like
+        # empty matches in the replacement template, like in Perl.
+        self.assertEqual(regex.sub('(?P<a>x)|(?P<b>y)', r'\g<b>', 'xx'), '')
+        self.assertEqual(regex.sub('(?P<a>x)|(?P<b>y)', r'\2', 'xx'), '')
+
+        # The old behaviour was to raise it as an IndexError.
+        self.assertRaisesRegex(regex.error, self.BAD_GROUP_NAME, lambda:
+          regex.sub('(?P<a>x)', r'\g<-1>', 'xx'))
+
+    def test_re_subn(self):
+        self.assertEqual(regex.subn("(?i)b+", "x", "bbbb BBBB"), ('x x', 2))
+        self.assertEqual(regex.subn("b+", "x", "bbbb BBBB"), ('x BBBB', 1))
+        self.assertEqual(regex.subn("b+", "x", "xyz"), ('xyz', 0))
+        self.assertEqual(regex.subn("b*", "x", "xyz"), ('xxxyxzx', 4))
+        self.assertEqual(regex.subn("b*", "x", "xyz", 2), ('xxxyz', 2))
+
+    def test_re_split(self):
+        self.assertEqual(regex.split(":", ":a:b::c"), ['', 'a', 'b', '', 'c'])
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.split(":*", ":a:b::c"), ['', '', 'a', '',
+              'b', '', 'c', ''])
+            self.assertEqual(regex.split("(:*)", ":a:b::c"), ['', ':', '', '',
+              'a', ':', '', '', 'b', '::', '', '', 'c', '', ''])
+            self.assertEqual(regex.split("(?::*)", ":a:b::c"), ['', '', 'a',
+              '', 'b', '', 'c', ''])
+            self.assertEqual(regex.split("(:)*", ":a:b::c"), ['', ':', '',
+              None, 'a', ':', '', None, 'b', ':', '', None, 'c', None, ''])
+        else:
+            self.assertEqual(regex.split(":*", ":a:b::c"), ['', 'a', 'b', 'c'])
+            self.assertEqual(regex.split("(:*)", ":a:b::c"), ['', ':', 'a',
+              ':', 'b', '::', 'c'])
+            self.assertEqual(regex.split("(?::*)", ":a:b::c"), ['', 'a', 'b',
+              'c'])
+            self.assertEqual(regex.split("(:)*", ":a:b::c"), ['', ':', 'a',
+              ':', 'b', ':', 'c'])
+        self.assertEqual(regex.split("([b:]+)", ":a:b::c"), ['', ':', 'a',
+          ':b::', 'c'])
+        self.assertEqual(regex.split("(b)|(:+)", ":a:b::c"), ['', None, ':',
+          'a', None, ':', '', 'b', None, '', None, '::', 'c'])
+        self.assertEqual(regex.split("(?:b)|(?::+)", ":a:b::c"), ['', 'a', '',
+          '', 'c'])
+
+        self.assertEqual(regex.split("x", "xaxbxc"), ['', 'a', 'b', 'c'])
+        self.assertEqual([m for m in regex.splititer("x", "xaxbxc")], ['', 'a',
+          'b', 'c'])
+
+        self.assertEqual(regex.split("(?r)x", "xaxbxc"), ['c', 'b', 'a', ''])
+        self.assertEqual([m for m in regex.splititer("(?r)x", "xaxbxc")], ['c',
+          'b', 'a', ''])
+
+        self.assertEqual(regex.split("(x)|(y)", "xaxbxc"), ['', 'x', None, 'a',
+          'x', None, 'b', 'x', None, 'c'])
+        self.assertEqual([m for m in regex.splititer("(x)|(y)", "xaxbxc")],
+          ['', 'x', None, 'a', 'x', None, 'b', 'x', None, 'c'])
+
+        self.assertEqual(regex.split("(?r)(x)|(y)", "xaxbxc"), ['c', 'x', None,
+          'b', 'x', None, 'a', 'x', None, ''])
+        self.assertEqual([m for m in regex.splititer("(?r)(x)|(y)", "xaxbxc")],
+          ['c', 'x', None, 'b', 'x', None, 'a', 'x', None, ''])
+
+        self.assertEqual(regex.split(r"(?V1)\b", "a b c"), ['', 'a', ' ', 'b',
+          ' ', 'c', ''])
+        self.assertEqual(regex.split(r"(?V1)\m", "a b c"), ['', 'a ', 'b ',
+          'c'])
+        self.assertEqual(regex.split(r"(?V1)\M", "a b c"), ['a', ' b', ' c',
+          ''])
+
+    def test_qualified_re_split(self):
+        self.assertEqual(regex.split(":", ":a:b::c", 2), ['', 'a', 'b::c'])
+        self.assertEqual(regex.split(':', 'a:b:c:d', 2), ['a', 'b', 'c:d'])
+        self.assertEqual(regex.split("(:)", ":a:b::c", 2), ['', ':', 'a', ':',
+          'b::c'])
+
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.split("(:*)", ":a:b::c", 2), ['', ':', '',
+              '', 'a:b::c'])
+        else:
+            self.assertEqual(regex.split("(:*)", ":a:b::c", 2), ['', ':', 'a',
+              ':', 'b::c'])
+
+    def test_re_findall(self):
+        self.assertEqual(regex.findall(":+", "abc"), [])
+        self.assertEqual(regex.findall(":+", "a:b::c:::d"), [':', '::', ':::'])
+        self.assertEqual(regex.findall("(:+)", "a:b::c:::d"), [':', '::',
+          ':::'])
+        self.assertEqual(regex.findall("(:)(:*)", "a:b::c:::d"), [(':', ''),
+          (':', ':'), (':', '::')])
+
+        self.assertEqual(regex.findall(r"\((?P<test>.{0,5}?TEST)\)",
+          "(MY TEST)"), ["MY TEST"])
+        self.assertEqual(regex.findall(r"\((?P<test>.{0,3}?TEST)\)",
+          "(MY TEST)"), ["MY TEST"])
+        self.assertEqual(regex.findall(r"\((?P<test>.{0,3}?T)\)", "(MY T)"),
+          ["MY T"])
+
+        self.assertEqual(regex.findall(r"[^a]{2}[A-Z]", "\n  S"), ['  S'])
+        self.assertEqual(regex.findall(r"[^a]{2,3}[A-Z]", "\n  S"), ['\n  S'])
+        self.assertEqual(regex.findall(r"[^a]{2,3}[A-Z]", "\n   S"), ['   S'])
+
+        self.assertEqual(regex.findall(r"X(Y[^Y]+?){1,2}( |Q)+DEF",
+          "XYABCYPPQ\nQ DEF"), [('YPPQ\n', ' ')])
+
+        self.assertEqual(regex.findall(r"(\nTest(\n+.+?){0,2}?)?\n+End",
+          "\nTest\nxyz\nxyz\nEnd"), [('\nTest\nxyz\nxyz', '\nxyz')])
+
+    def test_bug_117612(self):
+        self.assertEqual(regex.findall(r"(a|(b))", "aba"), [('a', ''), ('b',
+          'b'), ('a', '')])
+
+    def test_re_match(self):
+        self.assertEqual(regex.match('a', 'a')[:], ('a',))
+        self.assertEqual(regex.match('(a)', 'a')[:], ('a', 'a'))
+        self.assertEqual(regex.match(r'(a)', 'a')[0], 'a')
+        self.assertEqual(regex.match(r'(a)', 'a')[1], 'a')
+        self.assertEqual(regex.match(r'(a)', 'a').group(1, 1), ('a', 'a'))
+
+        pat = regex.compile('((a)|(b))(c)?')
+        self.assertEqual(pat.match('a')[:], ('a', 'a', 'a', None, None))
+        self.assertEqual(pat.match('b')[:], ('b', 'b', None, 'b', None))
+        self.assertEqual(pat.match('ac')[:], ('ac', 'a', 'a', None, 'c'))
+        self.assertEqual(pat.match('bc')[:], ('bc', 'b', None, 'b', 'c'))
+        self.assertEqual(pat.match('bc')[:], ('bc', 'b', None, 'b', 'c'))
+
+        # A single group.
+        m = regex.match('(a)', 'a')
+        self.assertEqual(m.group(), 'a')
+        self.assertEqual(m.group(0), 'a')
+        self.assertEqual(m.group(1), 'a')
+        self.assertEqual(m.group(1, 1), ('a', 'a'))
+
+        pat = regex.compile('(?:(?P<a1>a)|(?P<b2>b))(?P<c3>c)?')
+        self.assertEqual(pat.match('a').group(1, 2, 3), ('a', None, None))
+        self.assertEqual(pat.match('b').group('a1', 'b2', 'c3'), (None, 'b',
+          None))
+        self.assertEqual(pat.match('ac').group(1, 'b2', 3), ('a', None, 'c'))
+
+    def test_re_groupref_exists(self):
+        self.assertEqual(regex.match(r'^(\()?([^()]+)(?(1)\))$', '(a)')[:],
+          ('(a)', '(', 'a'))
+        self.assertEqual(regex.match(r'^(\()?([^()]+)(?(1)\))$', 'a')[:], ('a',
+          None, 'a'))
+        self.assertEqual(regex.match(r'^(\()?([^()]+)(?(1)\))$', 'a)'), None)
+        self.assertEqual(regex.match(r'^(\()?([^()]+)(?(1)\))$', '(a'), None)
+        self.assertEqual(regex.match('^(?:(a)|c)((?(1)b|d))$', 'ab')[:], ('ab',
+          'a', 'b'))
+        self.assertEqual(regex.match('^(?:(a)|c)((?(1)b|d))$', 'cd')[:], ('cd',
+          None, 'd'))
+        self.assertEqual(regex.match('^(?:(a)|c)((?(1)|d))$', 'cd')[:], ('cd',
+          None, 'd'))
+        self.assertEqual(regex.match('^(?:(a)|c)((?(1)|d))$', 'a')[:], ('a',
+          'a', ''))
+
+        # Tests for bug #1177831: exercise groups other than the first group.
+        p = regex.compile('(?P<g1>a)(?P<g2>b)?((?(g2)c|d))')
+        self.assertEqual(p.match('abc')[:], ('abc', 'a', 'b', 'c'))
+        self.assertEqual(p.match('ad')[:], ('ad', 'a', None, 'd'))
+        self.assertEqual(p.match('abd'), None)
+        self.assertEqual(p.match('ac'), None)
+
+    def test_re_groupref(self):
+        self.assertEqual(regex.match(r'^(\|)?([^()]+)\1$', '|a|')[:], ('|a|',
+          '|', 'a'))
+        self.assertEqual(regex.match(r'^(\|)?([^()]+)\1?$', 'a')[:], ('a',
+          None, 'a'))
+        self.assertEqual(regex.match(r'^(\|)?([^()]+)\1$', 'a|'), None)
+        self.assertEqual(regex.match(r'^(\|)?([^()]+)\1$', '|a'), None)
+        self.assertEqual(regex.match(r'^(?:(a)|c)(\1)$', 'aa')[:], ('aa', 'a',
+          'a'))
+        self.assertEqual(regex.match(r'^(?:(a)|c)(\1)?$', 'c')[:], ('c', None,
+          None))
+
+        self.assertEqual(regex.findall(r"(?i)(.{1,40}?),(.{1,40}?)(?:;)+(.{1,80}).{1,40}?\3(\ |;)+(.{1,80}?)\1",
+          "TEST, BEST; LEST ; Lest 123 Test, Best"), [('TEST', ' BEST',
+          ' LEST', ' ', '123 ')])
+
+    def test_groupdict(self):
+        self.assertEqual(regex.match('(?P<first>first) (?P<second>second)',
+          'first second').groupdict(), {'first': 'first', 'second': 'second'})
+
+    def test_expand(self):
+        self.assertEqual(regex.match("(?P<first>first) (?P<second>second)",
+          "first second").expand(r"\2 \1 \g<second> \g<first>"),
+          'second first second first')
+
+    def test_repeat_minmax(self):
+        self.assertEqual(regex.match(r"^(\w){1}$", "abc"), None)
+        self.assertEqual(regex.match(r"^(\w){1}?$", "abc"), None)
+        self.assertEqual(regex.match(r"^(\w){1,2}$", "abc"), None)
+        self.assertEqual(regex.match(r"^(\w){1,2}?$", "abc"), None)
+
+        self.assertEqual(regex.match(r"^(\w){3}$", "abc")[1], 'c')
+        self.assertEqual(regex.match(r"^(\w){1,3}$", "abc")[1], 'c')
+        self.assertEqual(regex.match(r"^(\w){1,4}$", "abc")[1], 'c')
+        self.assertEqual(regex.match(r"^(\w){3,4}?$", "abc")[1], 'c')
+        self.assertEqual(regex.match(r"^(\w){3}?$", "abc")[1], 'c')
+        self.assertEqual(regex.match(r"^(\w){1,3}?$", "abc")[1], 'c')
+        self.assertEqual(regex.match(r"^(\w){1,4}?$", "abc")[1], 'c')
+        self.assertEqual(regex.match(r"^(\w){3,4}?$", "abc")[1], 'c')
+
+        self.assertEqual(regex.match("^x{1}$", "xxx"), None)
+        self.assertEqual(regex.match("^x{1}?$", "xxx"), None)
+        self.assertEqual(regex.match("^x{1,2}$", "xxx"), None)
+        self.assertEqual(regex.match("^x{1,2}?$", "xxx"), None)
+
+        self.assertEqual(regex.match("^x{1}", "xxx")[0], 'x')
+        self.assertEqual(regex.match("^x{1}?", "xxx")[0], 'x')
+        self.assertEqual(regex.match("^x{0,1}", "xxx")[0], 'x')
+        self.assertEqual(regex.match("^x{0,1}?", "xxx")[0], '')
+
+        self.assertEqual(bool(regex.match("^x{3}$", "xxx")), True)
+        self.assertEqual(bool(regex.match("^x{1,3}$", "xxx")), True)
+        self.assertEqual(bool(regex.match("^x{1,4}$", "xxx")), True)
+        self.assertEqual(bool(regex.match("^x{3,4}?$", "xxx")), True)
+        self.assertEqual(bool(regex.match("^x{3}?$", "xxx")), True)
+        self.assertEqual(bool(regex.match("^x{1,3}?$", "xxx")), True)
+        self.assertEqual(bool(regex.match("^x{1,4}?$", "xxx")), True)
+        self.assertEqual(bool(regex.match("^x{3,4}?$", "xxx")), True)
+
+        self.assertEqual(regex.match("^x{}$", "xxx"), None)
+        self.assertEqual(bool(regex.match("^x{}$", "x{}")), True)
+
+    def test_getattr(self):
+        self.assertEqual(regex.compile("(?i)(a)(b)").pattern, '(?i)(a)(b)')
+        self.assertEqual(regex.compile("(?i)(a)(b)").flags, regex.I | regex.U |
+          regex.DEFAULT_VERSION)
+        self.assertEqual(regex.compile(b"(?i)(a)(b)").flags, regex.A | regex.I
+          | regex.DEFAULT_VERSION)
+        self.assertEqual(regex.compile("(?i)(a)(b)").groups, 2)
+        self.assertEqual(regex.compile("(?i)(a)(b)").groupindex, {})
+
+        self.assertEqual(regex.compile("(?i)(?P<first>a)(?P<other>b)").groupindex,
+          {'first': 1, 'other': 2})
+
+        self.assertEqual(regex.match("(a)", "a").pos, 0)
+        self.assertEqual(regex.match("(a)", "a").endpos, 1)
+
+        self.assertEqual(regex.search("b(c)", "abcdef").pos, 0)
+        self.assertEqual(regex.search("b(c)", "abcdef").endpos, 6)
+        self.assertEqual(regex.search("b(c)", "abcdef").span(), (1, 3))
+        self.assertEqual(regex.search("b(c)", "abcdef").span(1), (2, 3))
+
+        self.assertEqual(regex.match("(a)", "a").string, 'a')
+        self.assertEqual(regex.match("(a)", "a").regs, ((0, 1), (0, 1)))
+        self.assertEqual(repr(type(regex.match("(a)", "a").re)),
+          self.PATTERN_CLASS)
+
+        # Issue 14260.
+        p = regex.compile(r'abc(?P<n>def)')
+        p.groupindex["n"] = 0
+        self.assertEqual(p.groupindex["n"], 1)
+
+    def test_special_escapes(self):
+        self.assertEqual(regex.search(r"\b(b.)\b", "abcd abc bcd bx")[1], 'bx')
+        self.assertEqual(regex.search(r"\B(b.)\B", "abc bcd bc abxd")[1], 'bx')
+        self.assertEqual(regex.search(br"\b(b.)\b", b"abcd abc bcd bx",
+          regex.LOCALE)[1], b'bx')
+        self.assertEqual(regex.search(br"\B(b.)\B", b"abc bcd bc abxd",
+          regex.LOCALE)[1], b'bx')
+        self.assertEqual(regex.search(r"\b(b.)\b", "abcd abc bcd bx",
+          regex.UNICODE)[1], 'bx')
+        self.assertEqual(regex.search(r"\B(b.)\B", "abc bcd bc abxd",
+          regex.UNICODE)[1], 'bx')
+
+        self.assertEqual(regex.search(r"^abc$", "\nabc\n", regex.M)[0], 'abc')
+        self.assertEqual(regex.search(r"^\Aabc\Z$", "abc", regex.M)[0], 'abc')
+        self.assertEqual(regex.search(r"^\Aabc\Z$", "\nabc\n", regex.M), None)
+
+        self.assertEqual(regex.search(br"\b(b.)\b", b"abcd abc bcd bx")[1],
+          b'bx')
+        self.assertEqual(regex.search(br"\B(b.)\B", b"abc bcd bc abxd")[1],
+          b'bx')
+        self.assertEqual(regex.search(br"^abc$", b"\nabc\n", regex.M)[0],
+          b'abc')
+        self.assertEqual(regex.search(br"^\Aabc\Z$", b"abc", regex.M)[0],
+          b'abc')
+        self.assertEqual(regex.search(br"^\Aabc\Z$", b"\nabc\n", regex.M),
+          None)
+
+        self.assertEqual(regex.search(r"\d\D\w\W\s\S", "1aa! a")[0], '1aa! a')
+        self.assertEqual(regex.search(br"\d\D\w\W\s\S", b"1aa! a",
+          regex.LOCALE)[0], b'1aa! a')
+        self.assertEqual(regex.search(r"\d\D\w\W\s\S", "1aa! a",
+          regex.UNICODE)[0], '1aa! a')
+
+    def test_bigcharset(self):
+        self.assertEqual(regex.match(r"([\u2222\u2223])", "\u2222")[1],
+          '\u2222')
+        self.assertEqual(regex.match(r"([\u2222\u2223])", "\u2222",
+          regex.UNICODE)[1], '\u2222')
+        self.assertEqual("".join(regex.findall(".",
+          "e\xe8\xe9\xea\xeb\u0113\u011b\u0117", flags=regex.UNICODE)),
+          'e\xe8\xe9\xea\xeb\u0113\u011b\u0117')
+        self.assertEqual("".join(regex.findall(r"[e\xe8\xe9\xea\xeb\u0113\u011b\u0117]",
+          "e\xe8\xe9\xea\xeb\u0113\u011b\u0117", flags=regex.UNICODE)),
+          'e\xe8\xe9\xea\xeb\u0113\u011b\u0117')
+        self.assertEqual("".join(regex.findall(r"e|\xe8|\xe9|\xea|\xeb|\u0113|\u011b|\u0117",
+          "e\xe8\xe9\xea\xeb\u0113\u011b\u0117", flags=regex.UNICODE)),
+          'e\xe8\xe9\xea\xeb\u0113\u011b\u0117')
+
+    def test_anyall(self):
+        self.assertEqual(regex.match("a.b", "a\nb", regex.DOTALL)[0], "a\nb")
+        self.assertEqual(regex.match("a.*b", "a\n\nb", regex.DOTALL)[0],
+          "a\n\nb")
+
+    def test_non_consuming(self):
+        self.assertEqual(regex.match(r"(a(?=\s[^a]))", "a b")[1], 'a')
+        self.assertEqual(regex.match(r"(a(?=\s[^a]*))", "a b")[1], 'a')
+        self.assertEqual(regex.match(r"(a(?=\s[abc]))", "a b")[1], 'a')
+        self.assertEqual(regex.match(r"(a(?=\s[abc]*))", "a bc")[1], 'a')
+        self.assertEqual(regex.match(r"(a)(?=\s\1)", "a a")[1], 'a')
+        self.assertEqual(regex.match(r"(a)(?=\s\1*)", "a aa")[1], 'a')
+        self.assertEqual(regex.match(r"(a)(?=\s(abc|a))", "a a")[1], 'a')
+
+        self.assertEqual(regex.match(r"(a(?!\s[^a]))", "a a")[1], 'a')
+        self.assertEqual(regex.match(r"(a(?!\s[abc]))", "a d")[1], 'a')
+        self.assertEqual(regex.match(r"(a)(?!\s\1)", "a b")[1], 'a')
+        self.assertEqual(regex.match(r"(a)(?!\s(abc|a))", "a b")[1], 'a')
+
+    def test_ignore_case(self):
+        self.assertEqual(regex.match("abc", "ABC", regex.I)[0], 'ABC')
+        self.assertEqual(regex.match(b"abc", b"ABC", regex.I)[0], b'ABC')
+
+        self.assertEqual(regex.match(r"(a\s[^a]*)", "a bb", regex.I)[1],
+          'a bb')
+        self.assertEqual(regex.match(r"(a\s[abc])", "a b", regex.I)[1], 'a b')
+        self.assertEqual(regex.match(r"(a\s[abc]*)", "a bb", regex.I)[1],
+          'a bb')
+        self.assertEqual(regex.match(r"((a)\s\2)", "a a", regex.I)[1], 'a a')
+        self.assertEqual(regex.match(r"((a)\s\2*)", "a aa", regex.I)[1],
+          'a aa')
+        self.assertEqual(regex.match(r"((a)\s(abc|a))", "a a", regex.I)[1],
+          'a a')
+        self.assertEqual(regex.match(r"((a)\s(abc|a)*)", "a aa", regex.I)[1],
+          'a aa')
+
+        # Issue 3511.
+        self.assertEqual(regex.match(r"[Z-a]", "_").span(), (0, 1))
+        self.assertEqual(regex.match(r"(?i)[Z-a]", "_").span(), (0, 1))
+
+        self.assertEqual(bool(regex.match(r"(?i)nao", "nAo")), True)
+        self.assertEqual(bool(regex.match(r"(?i)n\xE3o", "n\xC3o")), True)
+        self.assertEqual(bool(regex.match(r"(?i)n\xE3o", "N\xC3O")), True)
+        self.assertEqual(bool(regex.match(r"(?i)s", "\u017F")), True)
+
+    def test_case_folding(self):
+        self.assertEqual(regex.search(r"(?fi)ss", "SS").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?fi)SS", "ss").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?fi)SS",
+          "\N{LATIN SMALL LETTER SHARP S}").span(), (0, 1))
+        self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LETTER SHARP S}",
+          "SS").span(), (0, 2))
+
+        self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LIGATURE ST}",
+          "ST").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?fi)ST",
+          "\N{LATIN SMALL LIGATURE ST}").span(), (0, 1))
+        self.assertEqual(regex.search(r"(?fi)ST",
+          "\N{LATIN SMALL LIGATURE LONG S T}").span(), (0, 1))
+
+        self.assertEqual(regex.search(r"(?fi)SST",
+          "\N{LATIN SMALL LETTER SHARP S}t").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?fi)SST",
+          "s\N{LATIN SMALL LIGATURE LONG S T}").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?fi)SST",
+          "s\N{LATIN SMALL LIGATURE ST}").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LIGATURE ST}",
+          "SST").span(), (1, 3))
+        self.assertEqual(regex.search(r"(?fi)SST",
+          "s\N{LATIN SMALL LIGATURE ST}").span(), (0, 2))
+
+        self.assertEqual(regex.search(r"(?fi)FFI",
+          "\N{LATIN SMALL LIGATURE FFI}").span(), (0, 1))
+        self.assertEqual(regex.search(r"(?fi)FFI",
+          "\N{LATIN SMALL LIGATURE FF}i").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?fi)FFI",
+          "f\N{LATIN SMALL LIGATURE FI}").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LIGATURE FFI}",
+          "FFI").span(), (0, 3))
+        self.assertEqual(regex.search(r"(?fi)\N{LATIN SMALL LIGATURE FF}i",
+          "FFI").span(), (0, 3))
+        self.assertEqual(regex.search(r"(?fi)f\N{LATIN SMALL LIGATURE FI}",
+          "FFI").span(), (0, 3))
+
+        sigma = "\u03A3\u03C3\u03C2"
+        for ch1 in sigma:
+            for ch2 in sigma:
+                if not regex.match(r"(?fi)" + ch1, ch2):
+                    self.fail()
+
+        self.assertEqual(bool(regex.search(r"(?iV1)ff", "\uFB00\uFB01")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)ff", "\uFB01\uFB00")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)fi", "\uFB00\uFB01")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)fi", "\uFB01\uFB00")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)fffi", "\uFB00\uFB01")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)f\uFB03",
+          "\uFB00\uFB01")), True)
+        self.assertEqual(bool(regex.search(r"(?iV1)ff", "\uFB00\uFB01")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)fi", "\uFB00\uFB01")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)fffi", "\uFB00\uFB01")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)f\uFB03",
+          "\uFB00\uFB01")), True)
+        self.assertEqual(bool(regex.search(r"(?iV1)f\uFB01", "\uFB00i")),
+          True)
+        self.assertEqual(bool(regex.search(r"(?iV1)f\uFB01", "\uFB00i")),
+          True)
+
+        self.assertEqual(regex.findall(r"(?iV0)\m(?:word){e<=3}\M(?<!\m(?:word){e<=1}\M)",
+          "word word2 word word3 word word234 word23 word"), ["word234",
+          "word23"])
+        self.assertEqual(regex.findall(r"(?iV1)\m(?:word){e<=3}\M(?<!\m(?:word){e<=1}\M)",
+          "word word2 word word3 word word234 word23 word"), ["word234",
+          "word23"])
+
+        self.assertEqual(regex.search(r"(?fi)a\N{LATIN SMALL LIGATURE FFI}ne",
+          "  affine  ").span(), (2, 8))
+        self.assertEqual(regex.search(r"(?fi)a(?:\N{LATIN SMALL LIGATURE FFI}|x)ne",
+           "  affine  ").span(), (2, 8))
+        self.assertEqual(regex.search(r"(?fi)a(?:\N{LATIN SMALL LIGATURE FFI}|xy)ne",
+           "  affine  ").span(), (2, 8))
+        self.assertEqual(regex.search(r"(?fi)a\L<options>ne", "affine",
+          options=["\N{LATIN SMALL LIGATURE FFI}"]).span(), (0, 6))
+        self.assertEqual(regex.search(r"(?fi)a\L<options>ne",
+          "a\N{LATIN SMALL LIGATURE FFI}ne", options=["ffi"]).span(), (0, 4))
+
+    def test_category(self):
+        self.assertEqual(regex.match(r"(\s)", " ")[1], ' ')
+
+    def test_not_literal(self):
+        self.assertEqual(regex.search(r"\s([^a])", " b")[1], 'b')
+        self.assertEqual(regex.search(r"\s([^a]*)", " bb")[1], 'bb')
+
+    def test_search_coverage(self):
+        self.assertEqual(regex.search(r"\s(b)", " b")[1], 'b')
+        self.assertEqual(regex.search(r"a\s", "a ")[0], 'a ')
+
+    def test_re_escape(self):
+        p = ""
+        self.assertEqual(regex.escape(p), p)
+        for i in range(0, 256):
+            p += chr(i)
+            self.assertEqual(bool(regex.match(regex.escape(chr(i)), chr(i))),
+              True)
+            self.assertEqual(regex.match(regex.escape(chr(i)), chr(i)).span(),
+              (0, 1))
+
+        pat = regex.compile(regex.escape(p))
+        self.assertEqual(pat.match(p).span(), (0, 256))
+
+    def test_re_escape_byte(self):
+        p = b""
+        self.assertEqual(regex.escape(p), p)
+        for i in range(0, 256):
+            b = bytes([i])
+            p += b
+            self.assertEqual(bool(regex.match(regex.escape(b), b)), True)
+            self.assertEqual(regex.match(regex.escape(b), b).span(), (0, 1))
+
+        pat = regex.compile(regex.escape(p))
+        self.assertEqual(pat.match(p).span(), (0, 256))
+
+    def test_constants(self):
+        if regex.I != regex.IGNORECASE:
+            self.fail()
+        if regex.L != regex.LOCALE:
+            self.fail()
+        if regex.M != regex.MULTILINE:
+            self.fail()
+        if regex.S != regex.DOTALL:
+            self.fail()
+        if regex.X != regex.VERBOSE:
+            self.fail()
+
+    def test_flags(self):
+        for flag in [regex.I, regex.M, regex.X, regex.S, regex.L]:
+            self.assertEqual(repr(type(regex.compile('^pattern$', flag))),
+              self.PATTERN_CLASS)
+
+    def test_sre_character_literals(self):
+        for i in [0, 8, 16, 32, 64, 127, 128, 255]:
+            self.assertEqual(bool(regex.match(r"\%03o" % i, chr(i))), True)
+            self.assertEqual(bool(regex.match(r"\%03o0" % i, chr(i) + "0")),
+              True)
+            self.assertEqual(bool(regex.match(r"\%03o8" % i, chr(i) + "8")),
+              True)
+            self.assertEqual(bool(regex.match(r"\x%02x" % i, chr(i))), True)
+            self.assertEqual(bool(regex.match(r"\x%02x0" % i, chr(i) + "0")),
+              True)
+            self.assertEqual(bool(regex.match(r"\x%02xz" % i, chr(i) + "z")),
+              True)
+
+        self.assertRaisesRegex(regex.error, self.INVALID_GROUP_REF, lambda:
+          regex.match(r"\911", ""))
+
+    def test_sre_character_class_literals(self):
+        for i in [0, 8, 16, 32, 64, 127, 128, 255]:
+            self.assertEqual(bool(regex.match(r"[\%03o]" % i, chr(i))), True)
+            self.assertEqual(bool(regex.match(r"[\%03o0]" % i, chr(i))), True)
+            self.assertEqual(bool(regex.match(r"[\%03o8]" % i, chr(i))), True)
+            self.assertEqual(bool(regex.match(r"[\x%02x]" % i, chr(i))), True)
+            self.assertEqual(bool(regex.match(r"[\x%02x0]" % i, chr(i))), True)
+            self.assertEqual(bool(regex.match(r"[\x%02xz]" % i, chr(i))), True)
+
+        self.assertRaisesRegex(regex.error, self.BAD_OCTAL_ESCAPE, lambda:
+          regex.match(r"[\911]", ""))
+
+    def test_bug_113254(self):
+        self.assertEqual(regex.match(r'(a)|(b)', 'b').start(1), -1)
+        self.assertEqual(regex.match(r'(a)|(b)', 'b').end(1), -1)
+        self.assertEqual(regex.match(r'(a)|(b)', 'b').span(1), (-1, -1))
+
+    def test_bug_527371(self):
+        # Bug described in patches 527371/672491.
+        self.assertEqual(regex.match(r'(a)?a','a').lastindex, None)
+        self.assertEqual(regex.match(r'(a)(b)?b','ab').lastindex, 1)
+        self.assertEqual(regex.match(r'(?P<a>a)(?P<b>b)?b','ab').lastgroup,
+          'a')
+        self.assertEqual(regex.match("(?P<a>a(b))", "ab").lastgroup, 'a')
+        self.assertEqual(regex.match("((a))", "a").lastindex, 1)
+
+    def test_bug_545855(self):
+        # Bug 545855 -- This pattern failed to cause a compile error as it
+        # should, instead provoking a TypeError.
+        self.assertRaisesRegex(regex.error, self.BAD_SET, lambda:
+          regex.compile('foo[a-'))
+
+    def test_bug_418626(self):
+        # Bugs 418626 at al. -- Testing Greg Chapman's addition of op code
+        # SRE_OP_MIN_REPEAT_ONE for eliminating recursion on simple uses of
+        # pattern '*?' on a long string.
+        self.assertEqual(regex.match('.*?c', 10000 * 'ab' + 'cd').end(0),
+          20001)
+        self.assertEqual(regex.match('.*?cd', 5000 * 'ab' + 'c' + 5000 * 'ab' +
+          'cde').end(0), 20003)
+        self.assertEqual(regex.match('.*?cd', 20000 * 'abc' + 'de').end(0),
+          60001)
+        # Non-simple '*?' still used to hit the recursion limit, before the
+        # non-recursive scheme was implemented.
+        self.assertEqual(regex.search('(a|b)*?c', 10000 * 'ab' + 'cd').end(0),
+          20001)
+
+    def test_bug_612074(self):
+        pat = "[" + regex.escape("\u2039") + "]"
+        self.assertEqual(regex.compile(pat) and 1, 1)
+
+    def test_stack_overflow(self):
+        # Nasty cases that used to overflow the straightforward recursive
+        # implementation of repeated groups.
+        self.assertEqual(regex.match('(x)*', 50000 * 'x')[1], 'x')
+        self.assertEqual(regex.match('(x)*y', 50000 * 'x' + 'y')[1], 'x')
+        self.assertEqual(regex.match('(x)*?y', 50000 * 'x' + 'y')[1], 'x')
+
+    def test_scanner(self):
+        def s_ident(scanner, token): return token
+        def s_operator(scanner, token): return "op%s" % token
+        def s_float(scanner, token): return float(token)
+        def s_int(scanner, token): return int(token)
+
+        scanner = regex.Scanner([(r"[a-zA-Z_]\w*", s_ident), (r"\d+\.\d*",
+          s_float), (r"\d+", s_int), (r"=|\+|-|\*|/", s_operator), (r"\s+",
+            None), ])
+
+        self.assertEqual(repr(type(scanner.scanner.scanner("").pattern)),
+          self.PATTERN_CLASS)
+
+        self.assertEqual(scanner.scan("sum = 3*foo + 312.50 + bar"), (['sum',
+          'op=', 3, 'op*', 'foo', 'op+', 312.5, 'op+', 'bar'], ''))
+
+    def test_bug_448951(self):
+        # Bug 448951 (similar to 429357, but with single char match).
+        # (Also test greedy matches.)
+        for op in '', '?', '*':
+            self.assertEqual(regex.match(r'((.%s):)?z' % op, 'z')[:], ('z',
+              None, None))
+            self.assertEqual(regex.match(r'((.%s):)?z' % op, 'a:z')[:], ('a:z',
+              'a:', 'a'))
+
+    def test_bug_725106(self):
+        # Capturing groups in alternatives in repeats.
+        self.assertEqual(regex.match('^((a)|b)*', 'abc')[:], ('ab', 'b', 'a'))
+        self.assertEqual(regex.match('^(([ab])|c)*', 'abc')[:], ('abc', 'c',
+          'b'))
+        self.assertEqual(regex.match('^((d)|[ab])*', 'abc')[:], ('ab', 'b',
+          None))
+        self.assertEqual(regex.match('^((a)c|[ab])*', 'abc')[:], ('ab', 'b',
+          None))
+        self.assertEqual(regex.match('^((a)|b)*?c', 'abc')[:], ('abc', 'b',
+          'a'))
+        self.assertEqual(regex.match('^(([ab])|c)*?d', 'abcd')[:], ('abcd',
+          'c', 'b'))
+        self.assertEqual(regex.match('^((d)|[ab])*?c', 'abc')[:], ('abc', 'b',
+          None))
+        self.assertEqual(regex.match('^((a)c|[ab])*?c', 'abc')[:], ('abc', 'b',
+          None))
+
+    def test_bug_725149(self):
+        # Mark_stack_base restoring before restoring marks.
+        self.assertEqual(regex.match('(a)(?:(?=(b)*)c)*', 'abb')[:], ('a', 'a',
+          None))
+        self.assertEqual(regex.match('(a)((?!(b)*))*', 'abb')[:], ('a', 'a',
+          None, None))
+
+    def test_bug_764548(self):
+        # Bug 764548, regex.compile() barfs on str/unicode subclasses.
+        class my_unicode(str): pass
+        pat = regex.compile(my_unicode("abc"))
+        self.assertEqual(pat.match("xyz"), None)
+
+    def test_finditer(self):
+        it = regex.finditer(r":+", "a:b::c:::d")
+        self.assertEqual([item[0] for item in it], [':', '::', ':::'])
+
+    def test_bug_926075(self):
+        if regex.compile('bug_926075') is regex.compile(b'bug_926075'):
+            self.fail()
+
+    def test_bug_931848(self):
+        pattern = "[\u002E\u3002\uFF0E\uFF61]"
+        self.assertEqual(regex.compile(pattern).split("a.b.c"), ['a', 'b',
+          'c'])
+
+    def test_bug_581080(self):
+        it = regex.finditer(r"\s", "a b")
+        self.assertEqual(next(it).span(), (1, 2))
+        self.assertRaises(StopIteration, lambda: next(it))
+
+        scanner = regex.compile(r"\s").scanner("a b")
+        self.assertEqual(scanner.search().span(), (1, 2))
+        self.assertEqual(scanner.search(), None)
+
+    def test_bug_817234(self):
+        it = regex.finditer(r".*", "asdf")
+        self.assertEqual(next(it).span(), (0, 4))
+        self.assertEqual(next(it).span(), (4, 4))
+        self.assertRaises(StopIteration, lambda: next(it))
+
+    def test_empty_array(self):
+        # SF buf 1647541.
+        import array
+        for typecode in 'bBuhHiIlLfd':
+            a = array.array(typecode)
+            self.assertEqual(regex.compile(b"bla").match(a), None)
+            self.assertEqual(regex.compile(b"").match(a)[1 : ], ())
+
+    def test_inline_flags(self):
+        # Bug #1700.
+        upper_char = chr(0x1ea0) # Latin Capital Letter A with Dot Below
+        lower_char = chr(0x1ea1) # Latin Small Letter A with Dot Below
+
+        p = regex.compile(upper_char, regex.I | regex.U)
+        self.assertEqual(bool(p.match(lower_char)), True)
+
+        p = regex.compile(lower_char, regex.I | regex.U)
+        self.assertEqual(bool(p.match(upper_char)), True)
+
+        p = regex.compile('(?i)' + upper_char, regex.U)
+        self.assertEqual(bool(p.match(lower_char)), True)
+
+        p = regex.compile('(?i)' + lower_char, regex.U)
+        self.assertEqual(bool(p.match(upper_char)), True)
+
+        p = regex.compile('(?iu)' + upper_char)
+        self.assertEqual(bool(p.match(lower_char)), True)
+
+        p = regex.compile('(?iu)' + lower_char)
+        self.assertEqual(bool(p.match(upper_char)), True)
+
+        # Changed to positional flags in regex 2023.12.23.
+        self.assertEqual(bool(regex.match(r"(?i)a", "A")), True)
+        self.assertEqual(regex.match(r"a(?i)", "A"), None)
+
+    def test_dollar_matches_twice(self):
+        # $ matches the end of string, and just before the terminating \n.
+        pattern = regex.compile('$')
+        self.assertEqual(pattern.sub('#', 'a\nb\n'), 'a\nb#\n#')
+        self.assertEqual(pattern.sub('#', 'a\nb\nc'), 'a\nb\nc#')
+        self.assertEqual(pattern.sub('#', '\n'), '#\n#')
+
+        pattern = regex.compile('$', regex.MULTILINE)
+        self.assertEqual(pattern.sub('#', 'a\nb\n' ), 'a#\nb#\n#')
+        self.assertEqual(pattern.sub('#', 'a\nb\nc'), 'a#\nb#\nc#')
+        self.assertEqual(pattern.sub('#', '\n'), '#\n#')
+
+    def test_bytes_str_mixing(self):
+        # Mixing str and bytes is disallowed.
+        pat = regex.compile('.')
+        bpat = regex.compile(b'.')
+        self.assertRaisesRegex(TypeError, self.STR_PAT_ON_BYTES, lambda:
+          pat.match(b'b'))
+        self.assertRaisesRegex(TypeError, self.BYTES_PAT_ON_STR, lambda:
+          bpat.match('b'))
+        self.assertRaisesRegex(TypeError, self.STR_PAT_BYTES_TEMPL, lambda:
+          pat.sub(b'b', 'c'))
+        self.assertRaisesRegex(TypeError, self.STR_PAT_ON_BYTES, lambda:
+          pat.sub('b', b'c'))
+        self.assertRaisesRegex(TypeError, self.STR_PAT_ON_BYTES, lambda:
+          pat.sub(b'b', b'c'))
+        self.assertRaisesRegex(TypeError, self.BYTES_PAT_ON_STR, lambda:
+          bpat.sub(b'b', 'c'))
+        self.assertRaisesRegex(TypeError, self.BYTES_PAT_STR_TEMPL, lambda:
+          bpat.sub('b', b'c'))
+        self.assertRaisesRegex(TypeError, self.BYTES_PAT_ON_STR, lambda:
+          bpat.sub('b', 'c'))
+
+        self.assertRaisesRegex(ValueError, self.BYTES_PAT_UNI_FLAG, lambda:
+          regex.compile(br'\w', regex.UNICODE))
+        self.assertRaisesRegex(ValueError, self.BYTES_PAT_UNI_FLAG, lambda:
+          regex.compile(br'(?u)\w'))
+        self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda:
+          regex.compile(r'\w', regex.UNICODE | regex.ASCII))
+        self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda:
+          regex.compile(r'(?u)\w', regex.ASCII))
+        self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda:
+          regex.compile(r'(?a)\w', regex.UNICODE))
+        self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda:
+          regex.compile(r'(?au)\w'))
+
+    def test_ascii_and_unicode_flag(self):
+        # String patterns.
+        for flags in (0, regex.UNICODE):
+            pat = regex.compile('\xc0', flags | regex.IGNORECASE)
+            self.assertEqual(bool(pat.match('\xe0')), True)
+            pat = regex.compile(r'\w', flags)
+            self.assertEqual(bool(pat.match('\xe0')), True)
+
+        pat = regex.compile('\xc0', regex.ASCII | regex.IGNORECASE)
+        self.assertEqual(pat.match('\xe0'), None)
+        pat = regex.compile('(?a)\xc0', regex.IGNORECASE)
+        self.assertEqual(pat.match('\xe0'), None)
+        pat = regex.compile(r'\w', regex.ASCII)
+        self.assertEqual(pat.match('\xe0'), None)
+        pat = regex.compile(r'(?a)\w')
+        self.assertEqual(pat.match('\xe0'), None)
+
+        # Bytes patterns.
+        for flags in (0, regex.ASCII):
+            pat = regex.compile(b'\xc0', flags | regex.IGNORECASE)
+            self.assertEqual(pat.match(b'\xe0'), None)
+            pat = regex.compile(br'\w')
+            self.assertEqual(pat.match(b'\xe0'), None)
+
+        self.assertRaisesRegex(ValueError, self.MIXED_FLAGS, lambda:
+          regex.compile(r'(?au)\w'))
+
+    def test_subscripting_match(self):
+        m = regex.match(r'(?<a>\w)', 'xy')
+        if not m:
+            self.fail("Failed: expected match but returned None")
+        elif not m or m[0] != m.group(0) or m[1] != m.group(1):
+            self.fail("Failed")
+        if not m:
+            self.fail("Failed: expected match but returned None")
+        elif m[:] != ('x', 'x'):
+            self.fail("Failed: expected \"('x', 'x')\" but got {} instead".format(ascii(m[:])))
+
+    def test_new_named_groups(self):
+        m0 = regex.match(r'(?P<a>\w)', 'x')
+        m1 = regex.match(r'(?<a>\w)', 'x')
+        if not (m0 and m1 and m0[:] == m1[:]):
+            self.fail("Failed")
+
+    def test_properties(self):
+        self.assertEqual(regex.match(b'(?ai)\xC0', b'\xE0'), None)
+        self.assertEqual(regex.match(br'(?ai)\xC0', b'\xE0'), None)
+        self.assertEqual(regex.match(br'(?a)\w', b'\xE0'), None)
+        self.assertEqual(bool(regex.match(r'\w', '\xE0')), True)
+
+        # Dropped the following test. It's not possible to determine what the
+        # correct result should be in the general case.
+#        self.assertEqual(bool(regex.match(br'(?L)\w', b'\xE0')),
+#          b'\xE0'.isalnum())
+
+        self.assertEqual(bool(regex.match(br'(?L)\d', b'0')), True)
+        self.assertEqual(bool(regex.match(br'(?L)\s', b' ')), True)
+        self.assertEqual(bool(regex.match(br'(?L)\w', b'a')), True)
+        self.assertEqual(regex.match(br'(?L)\d', b'?'), None)
+        self.assertEqual(regex.match(br'(?L)\s', b'?'), None)
+        self.assertEqual(regex.match(br'(?L)\w', b'?'), None)
+
+        self.assertEqual(regex.match(br'(?L)\D', b'0'), None)
+        self.assertEqual(regex.match(br'(?L)\S', b' '), None)
+        self.assertEqual(regex.match(br'(?L)\W', b'a'), None)
+        self.assertEqual(bool(regex.match(br'(?L)\D', b'?')), True)
+        self.assertEqual(bool(regex.match(br'(?L)\S', b'?')), True)
+        self.assertEqual(bool(regex.match(br'(?L)\W', b'?')), True)
+
+        self.assertEqual(bool(regex.match(r'\p{Cyrillic}',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'(?i)\p{Cyrillic}',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{IsCyrillic}',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{Script=Cyrillic}',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{InCyrillic}',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{Block=Cyrillic}',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:Cyrillic:]]',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:IsCyrillic:]]',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:Script=Cyrillic:]]',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:InCyrillic:]]',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:Block=Cyrillic:]]',
+          '\N{CYRILLIC CAPITAL LETTER A}')), True)
+
+        self.assertEqual(bool(regex.match(r'\P{Cyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\P{IsCyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\P{Script=Cyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\P{InCyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\P{Block=Cyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{^Cyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{^IsCyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{^Script=Cyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{^InCyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'\p{^Block=Cyrillic}',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:^Cyrillic:]]',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:^IsCyrillic:]]',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:^Script=Cyrillic:]]',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:^InCyrillic:]]',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+        self.assertEqual(bool(regex.match(r'[[:^Block=Cyrillic:]]',
+          '\N{LATIN CAPITAL LETTER A}')), True)
+
+        self.assertEqual(bool(regex.match(r'\d', '0')), True)
+        self.assertEqual(bool(regex.match(r'\s', ' ')), True)
+        self.assertEqual(bool(regex.match(r'\w', 'A')), True)
+        self.assertEqual(regex.match(r"\d", "?"), None)
+        self.assertEqual(regex.match(r"\s", "?"), None)
+        self.assertEqual(regex.match(r"\w", "?"), None)
+        self.assertEqual(regex.match(r"\D", "0"), None)
+        self.assertEqual(regex.match(r"\S", " "), None)
+        self.assertEqual(regex.match(r"\W", "A"), None)
+        self.assertEqual(bool(regex.match(r'\D', '?')), True)
+        self.assertEqual(bool(regex.match(r'\S', '?')), True)
+        self.assertEqual(bool(regex.match(r'\W', '?')), True)
+
+        self.assertEqual(bool(regex.match(r'\p{L}', 'A')), True)
+        self.assertEqual(bool(regex.match(r'\p{L}', 'a')), True)
+        self.assertEqual(bool(regex.match(r'\p{Lu}', 'A')), True)
+        self.assertEqual(bool(regex.match(r'\p{Ll}', 'a')), True)
+
+        self.assertEqual(bool(regex.match(r'(?i)a', 'a')), True)
+        self.assertEqual(bool(regex.match(r'(?i)a', 'A')), True)
+
+        self.assertEqual(bool(regex.match(r'\w', '0')), True)
+        self.assertEqual(bool(regex.match(r'\w', 'a')), True)
+        self.assertEqual(bool(regex.match(r'\w', '_')), True)
+
+        self.assertEqual(regex.match(r"\X", "\xE0").span(), (0, 1))
+        self.assertEqual(regex.match(r"\X", "a\u0300").span(), (0, 2))
+        self.assertEqual(regex.findall(r"\X",
+          "a\xE0a\u0300e\xE9e\u0301"), ['a', '\xe0', 'a\u0300', 'e',
+          '\xe9', 'e\u0301'])
+        self.assertEqual(regex.findall(r"\X{3}",
+          "a\xE0a\u0300e\xE9e\u0301"), ['a\xe0a\u0300', 'e\xe9e\u0301'])
+        self.assertEqual(regex.findall(r"\X", "\r\r\n\u0301A\u0301"),
+          ['\r', '\r\n', '\u0301', 'A\u0301'])
+
+        self.assertEqual(bool(regex.match(r'\p{Ll}', 'a')), True)
+
+        chars_u = "-09AZaz_\u0393\u03b3"
+        chars_b = b"-09AZaz_"
+        word_set = set("Ll Lm Lo Lt Lu Mc Me Mn Nd Nl No Pc".split())
+
+        tests = [
+            (r"\w", chars_u, "09AZaz_\u0393\u03b3"),
+            (r"[[:word:]]", chars_u, "09AZaz_\u0393\u03b3"),
+            (r"\W", chars_u, "-"),
+            (r"[[:^word:]]", chars_u, "-"),
+            (r"\d", chars_u, "09"),
+            (r"[[:digit:]]", chars_u, "09"),
+            (r"\D", chars_u, "-AZaz_\u0393\u03b3"),
+            (r"[[:^digit:]]", chars_u, "-AZaz_\u0393\u03b3"),
+            (r"[[:alpha:]]", chars_u, "AZaz\u0393\u03b3"),
+            (r"[[:^alpha:]]", chars_u, "-09_"),
+            (r"[[:alnum:]]", chars_u, "09AZaz\u0393\u03b3"),
+            (r"[[:^alnum:]]", chars_u, "-_"),
+            (r"[[:xdigit:]]", chars_u, "09Aa"),
+            (r"[[:^xdigit:]]", chars_u, "-Zz_\u0393\u03b3"),
+            (r"\p{InBasicLatin}", "a\xE1", "a"),
+            (r"\P{InBasicLatin}", "a\xE1", "\xE1"),
+            (r"(?i)\p{InBasicLatin}", "a\xE1", "a"),
+            (r"(?i)\P{InBasicLatin}", "a\xE1", "\xE1"),
+
+            (br"(?L)\w", chars_b, b"09AZaz_"),
+            (br"(?L)[[:word:]]", chars_b, b"09AZaz_"),
+            (br"(?L)\W", chars_b, b"-"),
+            (br"(?L)[[:^word:]]", chars_b, b"-"),
+            (br"(?L)\d", chars_b, b"09"),
+            (br"(?L)[[:digit:]]", chars_b, b"09"),
+            (br"(?L)\D", chars_b, b"-AZaz_"),
+            (br"(?L)[[:^digit:]]", chars_b, b"-AZaz_"),
+            (br"(?L)[[:alpha:]]", chars_b, b"AZaz"),
+            (br"(?L)[[:^alpha:]]", chars_b, b"-09_"),
+            (br"(?L)[[:alnum:]]", chars_b, b"09AZaz"),
+            (br"(?L)[[:^alnum:]]", chars_b, b"-_"),
+            (br"(?L)[[:xdigit:]]", chars_b, b"09Aa"),
+            (br"(?L)[[:^xdigit:]]", chars_b, b"-Zz_"),
+
+            (br"(?a)\w", chars_b, b"09AZaz_"),
+            (br"(?a)[[:word:]]", chars_b, b"09AZaz_"),
+            (br"(?a)\W", chars_b, b"-"),
+            (br"(?a)[[:^word:]]", chars_b, b"-"),
+            (br"(?a)\d", chars_b, b"09"),
+            (br"(?a)[[:digit:]]", chars_b, b"09"),
+            (br"(?a)\D", chars_b, b"-AZaz_"),
+            (br"(?a)[[:^digit:]]", chars_b, b"-AZaz_"),
+            (br"(?a)[[:alpha:]]", chars_b, b"AZaz"),
+            (br"(?a)[[:^alpha:]]", chars_b, b"-09_"),
+            (br"(?a)[[:alnum:]]", chars_b, b"09AZaz"),
+            (br"(?a)[[:^alnum:]]", chars_b, b"-_"),
+            (br"(?a)[[:xdigit:]]", chars_b, b"09Aa"),
+            (br"(?a)[[:^xdigit:]]", chars_b, b"-Zz_"),
+        ]
+        for pattern, chars, expected in tests:
+            try:
+                if chars[ : 0].join(regex.findall(pattern, chars)) != expected:
+                    self.fail("Failed: {}".format(pattern))
+            except Exception as e:
+                self.fail("Failed: {} raised {}".format(pattern, ascii(e)))
+
+        self.assertEqual(bool(regex.match(r"\p{NumericValue=0}", "0")),
+          True)
+        self.assertEqual(bool(regex.match(r"\p{NumericValue=1/2}",
+          "\N{VULGAR FRACTION ONE HALF}")), True)
+        self.assertEqual(bool(regex.match(r"\p{NumericValue=0.5}",
+          "\N{VULGAR FRACTION ONE HALF}")), True)
+
+    def test_word_class(self):
+        self.assertEqual(regex.findall(r"\w+",
+          " \u0939\u093f\u0928\u094d\u0926\u0940,"),
+          ['\u0939\u093f\u0928\u094d\u0926\u0940'])
+        self.assertEqual(regex.findall(r"\W+",
+          " \u0939\u093f\u0928\u094d\u0926\u0940,"), [' ', ','])
+        self.assertEqual(regex.split(r"(?V1)\b",
+          " \u0939\u093f\u0928\u094d\u0926\u0940,"), [' ',
+          '\u0939\u093f\u0928\u094d\u0926\u0940', ','])
+        self.assertEqual(regex.split(r"(?V1)\B",
+          " \u0939\u093f\u0928\u094d\u0926\u0940,"), ['', ' \u0939',
+          '\u093f', '\u0928', '\u094d', '\u0926', '\u0940,', ''])
+
+    def test_search_anchor(self):
+        self.assertEqual(regex.findall(r"\G\w{2}", "abcd ef"), ['ab', 'cd'])
+
+    def test_search_reverse(self):
+        self.assertEqual(regex.findall(r"(?r).", "abc"), ['c', 'b', 'a'])
+        self.assertEqual(regex.findall(r"(?r).", "abc", overlapped=True), ['c',
+          'b', 'a'])
+        self.assertEqual(regex.findall(r"(?r)..", "abcde"), ['de', 'bc'])
+        self.assertEqual(regex.findall(r"(?r)..", "abcde", overlapped=True),
+          ['de', 'cd', 'bc', 'ab'])
+        self.assertEqual(regex.findall(r"(?r)(.)(-)(.)", "a-b-c",
+          overlapped=True), [("b", "-", "c"), ("a", "-", "b")])
+
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r).", "abc")], ['c',
+          'b', 'a'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r)..", "abcde",
+          overlapped=True)], ['de', 'cd', 'bc', 'ab'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r).", "abc")], ['c',
+          'b', 'a'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r)..", "abcde",
+          overlapped=True)], ['de', 'cd', 'bc', 'ab'])
+
+        self.assertEqual(regex.findall(r"^|\w+", "foo bar"), ['', 'foo',
+          'bar'])
+        self.assertEqual(regex.findall(r"(?V1)^|\w+", "foo bar"), ['', 'foo',
+          'bar'])
+        self.assertEqual(regex.findall(r"(?r)^|\w+", "foo bar"), ['bar', 'foo',
+          ''])
+        self.assertEqual(regex.findall(r"(?rV1)^|\w+", "foo bar"), ['bar',
+          'foo', ''])
+
+        self.assertEqual([m[0] for m in regex.finditer(r"^|\w+", "foo bar")],
+          ['', 'foo', 'bar'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?V1)^|\w+",
+          "foo bar")], ['', 'foo', 'bar'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r)^|\w+",
+          "foo bar")], ['bar', 'foo', ''])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?rV1)^|\w+",
+          "foo bar")], ['bar', 'foo', ''])
+
+        self.assertEqual(regex.findall(r"\G\w{2}", "abcd ef"), ['ab', 'cd'])
+        self.assertEqual(regex.findall(r".{2}(?<=\G.*)", "abcd"), ['ab', 'cd'])
+        self.assertEqual(regex.findall(r"(?r)\G\w{2}", "abcd ef"), [])
+        self.assertEqual(regex.findall(r"(?r)\w{2}\G", "abcd ef"), ['ef'])
+
+        self.assertEqual(regex.findall(r"q*", "qqwe"), ['qq', '', '', ''])
+        self.assertEqual(regex.findall(r"(?V1)q*", "qqwe"), ['qq', '', '', ''])
+        self.assertEqual(regex.findall(r"(?r)q*", "qqwe"), ['', '', 'qq', ''])
+        self.assertEqual(regex.findall(r"(?rV1)q*", "qqwe"), ['', '', 'qq',
+          ''])
+
+        self.assertEqual(regex.findall(".", "abcd", pos=1, endpos=3), ['b',
+          'c'])
+        self.assertEqual(regex.findall(".", "abcd", pos=1, endpos=-1), ['b',
+          'c'])
+        self.assertEqual([m[0] for m in regex.finditer(".", "abcd", pos=1,
+          endpos=3)], ['b', 'c'])
+        self.assertEqual([m[0] for m in regex.finditer(".", "abcd", pos=1,
+          endpos=-1)], ['b', 'c'])
+
+        self.assertEqual([m[0] for m in regex.finditer("(?r).", "abcd", pos=1,
+          endpos=3)], ['c', 'b'])
+        self.assertEqual([m[0] for m in regex.finditer("(?r).", "abcd", pos=1,
+          endpos=-1)], ['c', 'b'])
+        self.assertEqual(regex.findall("(?r).", "abcd", pos=1, endpos=3), ['c',
+          'b'])
+        self.assertEqual(regex.findall("(?r).", "abcd", pos=1, endpos=-1),
+          ['c', 'b'])
+
+        self.assertEqual(regex.findall(r"[ab]", "aB", regex.I), ['a', 'B'])
+        self.assertEqual(regex.findall(r"(?r)[ab]", "aB", regex.I), ['B', 'a'])
+
+        self.assertEqual(regex.findall(r"(?r).{2}", "abc"), ['bc'])
+        self.assertEqual(regex.findall(r"(?r).{2}", "abc", overlapped=True),
+          ['bc', 'ab'])
+        self.assertEqual(regex.findall(r"(\w+) (\w+)",
+          "first second third fourth fifth"), [('first', 'second'), ('third',
+          'fourth')])
+        self.assertEqual(regex.findall(r"(?r)(\w+) (\w+)",
+          "first second third fourth fifth"), [('fourth', 'fifth'), ('second',
+          'third')])
+
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r).{2}", "abc")],
+          ['bc'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r).{2}", "abc",
+          overlapped=True)], ['bc', 'ab'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(\w+) (\w+)",
+          "first second third fourth fifth")], ['first second',
+          'third fourth'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r)(\w+) (\w+)",
+          "first second third fourth fifth")], ['fourth fifth',
+          'second third'])
+
+        self.assertEqual(regex.search("abcdef", "abcdef").span(), (0, 6))
+        self.assertEqual(regex.search("(?r)abcdef", "abcdef").span(), (0, 6))
+        self.assertEqual(regex.search("(?i)abcdef", "ABCDEF").span(), (0, 6))
+        self.assertEqual(regex.search("(?ir)abcdef", "ABCDEF").span(), (0, 6))
+
+        self.assertEqual(regex.sub(r"(.)", r"\1", "abc"), 'abc')
+        self.assertEqual(regex.sub(r"(?r)(.)", r"\1", "abc"), 'abc')
+
+    def test_atomic(self):
+        # Issue 433030.
+        self.assertEqual(regex.search(r"(?>a*)a", "aa"), None)
+
+    def test_possessive(self):
+        # Single-character non-possessive.
+        self.assertEqual(regex.search(r"a?a", "a").span(), (0, 1))
+        self.assertEqual(regex.search(r"a*a", "aaa").span(), (0, 3))
+        self.assertEqual(regex.search(r"a+a", "aaa").span(), (0, 3))
+        self.assertEqual(regex.search(r"a{1,3}a", "aaa").span(), (0, 3))
+
+        # Multiple-character non-possessive.
+        self.assertEqual(regex.search(r"(?:ab)?ab", "ab").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?:ab)*ab", "ababab").span(), (0, 6))
+        self.assertEqual(regex.search(r"(?:ab)+ab", "ababab").span(), (0, 6))
+        self.assertEqual(regex.search(r"(?:ab){1,3}ab", "ababab").span(), (0,
+          6))
+
+        # Single-character possessive.
+        self.assertEqual(regex.search(r"a?+a", "a"), None)
+        self.assertEqual(regex.search(r"a*+a", "aaa"), None)
+        self.assertEqual(regex.search(r"a++a", "aaa"), None)
+        self.assertEqual(regex.search(r"a{1,3}+a", "aaa"), None)
+
+        # Multiple-character possessive.
+        self.assertEqual(regex.search(r"(?:ab)?+ab", "ab"), None)
+        self.assertEqual(regex.search(r"(?:ab)*+ab", "ababab"), None)
+        self.assertEqual(regex.search(r"(?:ab)++ab", "ababab"), None)
+        self.assertEqual(regex.search(r"(?:ab){1,3}+ab", "ababab"), None)
+
+    def test_zerowidth(self):
+        # Issue 3262.
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.split(r"\b", "a b"), ['', 'a', ' ', 'b',
+              ''])
+        else:
+            self.assertEqual(regex.split(r"\b", "a b"), ['a b'])
+        self.assertEqual(regex.split(r"(?V1)\b", "a b"), ['', 'a', ' ', 'b',
+          ''])
+
+        # Issue 1647489.
+        self.assertEqual(regex.findall(r"^|\w+", "foo bar"), ['', 'foo',
+          'bar'])
+        self.assertEqual([m[0] for m in regex.finditer(r"^|\w+", "foo bar")],
+          ['', 'foo', 'bar'])
+        self.assertEqual(regex.findall(r"(?r)^|\w+", "foo bar"), ['bar',
+          'foo', ''])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r)^|\w+",
+          "foo bar")], ['bar', 'foo', ''])
+        self.assertEqual(regex.findall(r"(?V1)^|\w+", "foo bar"), ['', 'foo',
+          'bar'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?V1)^|\w+",
+          "foo bar")], ['', 'foo', 'bar'])
+        self.assertEqual(regex.findall(r"(?rV1)^|\w+", "foo bar"), ['bar',
+          'foo', ''])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?rV1)^|\w+",
+          "foo bar")], ['bar', 'foo', ''])
+
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.split("", "xaxbxc"), ['', 'x', 'a', 'x',
+              'b', 'x', 'c', ''])
+            self.assertEqual([m for m in regex.splititer("", "xaxbxc")], ['',
+              'x', 'a', 'x', 'b', 'x', 'c', ''])
+        else:
+            self.assertEqual(regex.split("", "xaxbxc"), ['xaxbxc'])
+            self.assertEqual([m for m in regex.splititer("", "xaxbxc")],
+              ['xaxbxc'])
+
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.split("(?r)", "xaxbxc"), ['', 'c', 'x', 'b',
+              'x', 'a', 'x', ''])
+            self.assertEqual([m for m in regex.splititer("(?r)", "xaxbxc")],
+              ['', 'c', 'x', 'b', 'x', 'a', 'x', ''])
+        else:
+            self.assertEqual(regex.split("(?r)", "xaxbxc"), ['xaxbxc'])
+            self.assertEqual([m for m in regex.splititer("(?r)", "xaxbxc")],
+              ['xaxbxc'])
+
+        self.assertEqual(regex.split("(?V1)", "xaxbxc"), ['', 'x', 'a', 'x',
+          'b', 'x', 'c', ''])
+        self.assertEqual([m for m in regex.splititer("(?V1)", "xaxbxc")], ['',
+          'x', 'a', 'x', 'b', 'x', 'c', ''])
+
+        self.assertEqual(regex.split("(?rV1)", "xaxbxc"), ['', 'c', 'x', 'b',
+          'x', 'a', 'x', ''])
+        self.assertEqual([m for m in regex.splititer("(?rV1)", "xaxbxc")], ['',
+          'c', 'x', 'b', 'x', 'a', 'x', ''])
+
+    def test_scoped_and_inline_flags(self):
+        # Issues 433028, 433024, 433027.
+        self.assertEqual(regex.search(r"(?i)Ab", "ab").span(), (0, 2))
+        self.assertEqual(regex.search(r"(?i:A)b", "ab").span(), (0, 2))
+        # Changed to positional flags in regex 2023.12.23.
+        self.assertEqual(regex.search(r"A(?i)b", "ab"), None)
+
+        self.assertEqual(regex.search(r"(?V0)Ab", "ab"), None)
+        self.assertEqual(regex.search(r"(?V1)Ab", "ab"), None)
+        self.assertEqual(regex.search(r"(?-i)Ab", "ab", flags=regex.I), None)
+        self.assertEqual(regex.search(r"(?-i:A)b", "ab", flags=regex.I), None)
+        self.assertEqual(regex.search(r"A(?-i)b", "ab", flags=regex.I).span(),
+          (0, 2))
+
+    def test_repeated_repeats(self):
+        # Issue 2537.
+        self.assertEqual(regex.search(r"(?:a+)+", "aaa").span(), (0, 3))
+        self.assertEqual(regex.search(r"(?:(?:ab)+c)+", "abcabc").span(), (0,
+          6))
+
+        # Hg issue 286.
+        self.assertEqual(regex.search(r"(?:a+){2,}", "aaa").span(), (0, 3))
+
+    def test_lookbehind(self):
+        self.assertEqual(regex.search(r"123(?<=a\d+)", "a123").span(), (1, 4))
+        self.assertEqual(regex.search(r"123(?<=a\d+)", "b123"), None)
+        self.assertEqual(regex.search(r"123(?<!a\d+)", "a123"), None)
+        self.assertEqual(regex.search(r"123(?<!a\d+)", "b123").span(), (1, 4))
+
+        self.assertEqual(bool(regex.match("(a)b(?<=b)(c)", "abc")), True)
+        self.assertEqual(regex.match("(a)b(?<=c)(c)", "abc"), None)
+        self.assertEqual(bool(regex.match("(a)b(?=c)(c)", "abc")), True)
+        self.assertEqual(regex.match("(a)b(?=b)(c)", "abc"), None)
+
+        self.assertEqual(regex.match("(?:(a)|(x))b(?<=(?(2)x|c))c", "abc"),
+          None)
+        self.assertEqual(regex.match("(?:(a)|(x))b(?<=(?(2)b|x))c", "abc"),
+          None)
+        self.assertEqual(bool(regex.match("(?:(a)|(x))b(?<=(?(2)x|b))c",
+          "abc")), True)
+        self.assertEqual(regex.match("(?:(a)|(x))b(?<=(?(1)c|x))c", "abc"),
+          None)
+        self.assertEqual(bool(regex.match("(?:(a)|(x))b(?<=(?(1)b|x))c",
+          "abc")), True)
+
+        self.assertEqual(bool(regex.match("(?:(a)|(x))b(?=(?(2)x|c))c",
+          "abc")), True)
+        self.assertEqual(regex.match("(?:(a)|(x))b(?=(?(2)c|x))c", "abc"),
+          None)
+        self.assertEqual(bool(regex.match("(?:(a)|(x))b(?=(?(2)x|c))c",
+          "abc")), True)
+        self.assertEqual(regex.match("(?:(a)|(x))b(?=(?(1)b|x))c", "abc"),
+          None)
+        self.assertEqual(bool(regex.match("(?:(a)|(x))b(?=(?(1)c|x))c",
+          "abc")), True)
+
+        self.assertEqual(regex.match("(a)b(?<=(?(2)x|c))(c)", "abc"), None)
+        self.assertEqual(regex.match("(a)b(?<=(?(2)b|x))(c)", "abc"), None)
+        self.assertEqual(regex.match("(a)b(?<=(?(1)c|x))(c)", "abc"), None)
+        self.assertEqual(bool(regex.match("(a)b(?<=(?(1)b|x))(c)", "abc")),
+          True)
+
+        self.assertEqual(bool(regex.match("(a)b(?=(?(2)x|c))(c)", "abc")),
+          True)
+        self.assertEqual(regex.match("(a)b(?=(?(2)b|x))(c)", "abc"), None)
+        self.assertEqual(bool(regex.match("(a)b(?=(?(1)c|x))(c)", "abc")),
+          True)
+
+        self.assertEqual(repr(type(regex.compile(r"(a)\2(b)"))),
+          self.PATTERN_CLASS)
+
+    def test_unmatched_in_sub(self):
+        # Issue 1519638.
+
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "xy"),
+              'y-x-')
+        else:
+            self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "xy"),
+              'y-x')
+        self.assertEqual(regex.sub(r"(?V1)(x)?(y)?", r"\2-\1", "xy"), 'y-x-')
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "x"), '-x-')
+        else:
+            self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "x"), '-x')
+        self.assertEqual(regex.sub(r"(?V1)(x)?(y)?", r"\2-\1", "x"), '-x-')
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "y"), 'y--')
+        else:
+            self.assertEqual(regex.sub(r"(?V0)(x)?(y)?", r"\2-\1", "y"), 'y-')
+        self.assertEqual(regex.sub(r"(?V1)(x)?(y)?", r"\2-\1", "y"), 'y--')
+
+    def test_bug_10328 (self):
+        # Issue 10328.
+        pat = regex.compile(r'(?mV0)(?P<trailing_ws>[ \t]+\r*$)|(?P<no_final_newline>(?<=[^\n])\Z)')
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(pat.subn(lambda m: '<' + m.lastgroup + '>',
+              'foobar '), ('foobar<trailing_ws><no_final_newline>', 2))
+        else:
+            self.assertEqual(pat.subn(lambda m: '<' + m.lastgroup + '>',
+              'foobar '), ('foobar<trailing_ws>', 1))
+        self.assertEqual([m.group() for m in pat.finditer('foobar ')], [' ',
+          ''])
+        pat = regex.compile(r'(?mV1)(?P<trailing_ws>[ \t]+\r*$)|(?P<no_final_newline>(?<=[^\n])\Z)')
+        self.assertEqual(pat.subn(lambda m: '<' + m.lastgroup + '>',
+          'foobar '), ('foobar<trailing_ws><no_final_newline>', 2))
+        self.assertEqual([m.group() for m in pat.finditer('foobar ')], [' ',
+          ''])
+
+    def test_overlapped(self):
+        self.assertEqual(regex.findall(r"..", "abcde"), ['ab', 'cd'])
+        self.assertEqual(regex.findall(r"..", "abcde", overlapped=True), ['ab',
+          'bc', 'cd', 'de'])
+        self.assertEqual(regex.findall(r"(?r)..", "abcde"), ['de', 'bc'])
+        self.assertEqual(regex.findall(r"(?r)..", "abcde", overlapped=True),
+          ['de', 'cd', 'bc', 'ab'])
+        self.assertEqual(regex.findall(r"(.)(-)(.)", "a-b-c", overlapped=True),
+          [("a", "-", "b"), ("b", "-", "c")])
+
+        self.assertEqual([m[0] for m in regex.finditer(r"..", "abcde")], ['ab',
+          'cd'])
+        self.assertEqual([m[0] for m in regex.finditer(r"..", "abcde",
+          overlapped=True)], ['ab', 'bc', 'cd', 'de'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r)..", "abcde")],
+          ['de', 'bc'])
+        self.assertEqual([m[0] for m in regex.finditer(r"(?r)..", "abcde",
+          overlapped=True)], ['de', 'cd', 'bc', 'ab'])
+
+        self.assertEqual([m.groups() for m in regex.finditer(r"(.)(-)(.)",
+          "a-b-c", overlapped=True)], [("a", "-", "b"), ("b", "-", "c")])
+        self.assertEqual([m.groups() for m in regex.finditer(r"(?r)(.)(-)(.)",
+          "a-b-c", overlapped=True)], [("b", "-", "c"), ("a", "-", "b")])
+
+    def test_splititer(self):
+        self.assertEqual(regex.split(r",", "a,b,,c,"), ['a', 'b', '', 'c', ''])
+        self.assertEqual([m for m in regex.splititer(r",", "a,b,,c,")], ['a',
+          'b', '', 'c', ''])
+
+    def test_grapheme(self):
+        self.assertEqual(regex.match(r"\X", "\xE0").span(), (0, 1))
+        self.assertEqual(regex.match(r"\X", "a\u0300").span(), (0, 2))
+
+        self.assertEqual(regex.findall(r"\X",
+          "a\xE0a\u0300e\xE9e\u0301"), ['a', '\xe0', 'a\u0300', 'e',
+          '\xe9', 'e\u0301'])
+        self.assertEqual(regex.findall(r"\X{3}",
+          "a\xE0a\u0300e\xE9e\u0301"), ['a\xe0a\u0300', 'e\xe9e\u0301'])
+        self.assertEqual(regex.findall(r"\X", "\r\r\n\u0301A\u0301"),
+          ['\r', '\r\n', '\u0301', 'A\u0301'])
+
+    def test_word_boundary(self):
+        text = 'The quick ("brown") fox can\'t jump 32.3 feet, right?'
+        self.assertEqual(regex.split(r'(?V1)\b', text), ['', 'The', ' ',
+          'quick', ' ("', 'brown', '") ', 'fox', ' ', 'can', "'", 't',
+          ' ', 'jump', ' ', '32', '.', '3', ' ', 'feet', ', ',
+          'right', '?'])
+        self.assertEqual(regex.split(r'(?V1w)\b', text), ['', 'The', ' ',
+          'quick', ' ', '(', '"', 'brown', '"', ')', ' ', 'fox', ' ',
+          "can't", ' ', 'jump', ' ', '32.3', ' ', 'feet', ',', ' ',
+          'right', '?', ''])
+
+        text = "The  fox"
+        self.assertEqual(regex.split(r'(?V1)\b', text), ['', 'The', '  ',
+          'fox', ''])
+        self.assertEqual(regex.split(r'(?V1w)\b', text), ['', 'The', '  ',
+          'fox', ''])
+
+        text = "can't aujourd'hui l'objectif"
+        self.assertEqual(regex.split(r'(?V1)\b', text), ['', 'can', "'",
+          't', ' ', 'aujourd', "'", 'hui', ' ', 'l', "'", 'objectif',
+          ''])
+        self.assertEqual(regex.split(r'(?V1w)\b', text), ['', "can't", ' ',
+          "aujourd'hui", ' ', "l'objectif", ''])
+
+    def test_line_boundary(self):
+        self.assertEqual(regex.findall(r".+", "Line 1\nLine 2\n"), ["Line 1",
+          "Line 2"])
+        self.assertEqual(regex.findall(r".+", "Line 1\rLine 2\r"),
+          ["Line 1\rLine 2\r"])
+        self.assertEqual(regex.findall(r".+", "Line 1\r\nLine 2\r\n"),
+          ["Line 1\r", "Line 2\r"])
+        self.assertEqual(regex.findall(r"(?w).+", "Line 1\nLine 2\n"),
+          ["Line 1", "Line 2"])
+        self.assertEqual(regex.findall(r"(?w).+", "Line 1\rLine 2\r"),
+          ["Line 1", "Line 2"])
+        self.assertEqual(regex.findall(r"(?w).+", "Line 1\r\nLine 2\r\n"),
+          ["Line 1", "Line 2"])
+
+        self.assertEqual(regex.search(r"^abc", "abc").start(), 0)
+        self.assertEqual(regex.search(r"^abc", "\nabc"), None)
+        self.assertEqual(regex.search(r"^abc", "\rabc"), None)
+        self.assertEqual(regex.search(r"(?w)^abc", "abc").start(), 0)
+        self.assertEqual(regex.search(r"(?w)^abc", "\nabc"), None)
+        self.assertEqual(regex.search(r"(?w)^abc", "\rabc"), None)
+
+        self.assertEqual(regex.search(r"abc$", "abc").start(), 0)
+        self.assertEqual(regex.search(r"abc$", "abc\n").start(), 0)
+        self.assertEqual(regex.search(r"abc$", "abc\r"), None)
+        self.assertEqual(regex.search(r"(?w)abc$", "abc").start(), 0)
+        self.assertEqual(regex.search(r"(?w)abc$", "abc\n").start(), 0)
+        self.assertEqual(regex.search(r"(?w)abc$", "abc\r").start(), 0)
+
+        self.assertEqual(regex.search(r"(?m)^abc", "abc").start(), 0)
+        self.assertEqual(regex.search(r"(?m)^abc", "\nabc").start(), 1)
+        self.assertEqual(regex.search(r"(?m)^abc", "\rabc"), None)
+        self.assertEqual(regex.search(r"(?mw)^abc", "abc").start(), 0)
+        self.assertEqual(regex.search(r"(?mw)^abc", "\nabc").start(), 1)
+        self.assertEqual(regex.search(r"(?mw)^abc", "\rabc").start(), 1)
+
+        self.assertEqual(regex.search(r"(?m)abc$", "abc").start(), 0)
+        self.assertEqual(regex.search(r"(?m)abc$", "abc\n").start(), 0)
+        self.assertEqual(regex.search(r"(?m)abc$", "abc\r"), None)
+        self.assertEqual(regex.search(r"(?mw)abc$", "abc").start(), 0)
+        self.assertEqual(regex.search(r"(?mw)abc$", "abc\n").start(), 0)
+        self.assertEqual(regex.search(r"(?mw)abc$", "abc\r").start(), 0)
+
+    def test_branch_reset(self):
+        self.assertEqual(regex.match(r"(?:(a)|(b))(c)", "ac").groups(), ('a',
+          None, 'c'))
+        self.assertEqual(regex.match(r"(?:(a)|(b))(c)", "bc").groups(), (None,
+          'b', 'c'))
+        self.assertEqual(regex.match(r"(?:(?<a>a)|(?<b>b))(?<c>c)",
+          "ac").groups(), ('a', None, 'c'))
+        self.assertEqual(regex.match(r"(?:(?<a>a)|(?<b>b))(?<c>c)",
+          "bc").groups(), (None, 'b', 'c'))
+
+        self.assertEqual(regex.match(r"(?<a>a)(?:(?<b>b)|(?<c>c))(?<d>d)",
+          "abd").groups(), ('a', 'b', None, 'd'))
+        self.assertEqual(regex.match(r"(?<a>a)(?:(?<b>b)|(?<c>c))(?<d>d)",
+          "acd").groups(), ('a', None, 'c', 'd'))
+        self.assertEqual(regex.match(r"(a)(?:(b)|(c))(d)", "abd").groups(),
+          ('a', 'b', None, 'd'))
+
+        self.assertEqual(regex.match(r"(a)(?:(b)|(c))(d)", "acd").groups(),
+          ('a', None, 'c', 'd'))
+        self.assertEqual(regex.match(r"(a)(?|(b)|(b))(d)", "abd").groups(),
+          ('a', 'b', 'd'))
+        self.assertEqual(regex.match(r"(?|(?<a>a)|(?<b>b))(c)", "ac").groups(),
+          ('a', None, 'c'))
+        self.assertEqual(regex.match(r"(?|(?<a>a)|(?<b>b))(c)", "bc").groups(),
+          (None, 'b', 'c'))
+        self.assertEqual(regex.match(r"(?|(?<a>a)|(?<a>b))(c)", "ac").groups(),
+          ('a', 'c'))
+
+        self.assertEqual(regex.match(r"(?|(?<a>a)|(?<a>b))(c)", "bc").groups(),
+          ('b', 'c'))
+
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(?<b>c)(?<a>d))(e)",
+          "abe").groups(), ('a', 'b', 'e'))
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(?<b>c)(?<a>d))(e)",
+          "cde").groups(), ('d', 'c', 'e'))
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(?<b>c)(d))(e)",
+          "abe").groups(), ('a', 'b', 'e'))
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(?<b>c)(d))(e)",
+          "cde").groups(), ('d', 'c', 'e'))
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(d))(e)",
+          "abe").groups(), ('a', 'b', 'e'))
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(d))(e)",
+          "cde").groups(), ('c', 'd', 'e'))
+
+        # Hg issue 87: Allow duplicate names of groups
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(?<a>d))(e)",
+          "abe").groups(), ("a", "b", "e"))
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(?<a>d))(e)",
+          "abe").capturesdict(), {"a": ["a"], "b": ["b"]})
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(?<a>d))(e)",
+          "cde").groups(), ("d", None, "e"))
+        self.assertEqual(regex.match(r"(?|(?<a>a)(?<b>b)|(c)(?<a>d))(e)",
+          "cde").capturesdict(), {"a": ["c", "d"], "b": []})
+
+    def test_set(self):
+        self.assertEqual(regex.match(r"[a]", "a").span(), (0, 1))
+        self.assertEqual(regex.match(r"(?i)[a]", "A").span(), (0, 1))
+        self.assertEqual(regex.match(r"[a-b]", r"a").span(), (0, 1))
+        self.assertEqual(regex.match(r"(?i)[a-b]", r"A").span(), (0, 1))
+
+        self.assertEqual(regex.sub(r"(?V0)([][])", r"-", "a[b]c"), "a-b-c")
+
+        self.assertEqual(regex.findall(r"[\p{Alpha}]", "a0"), ["a"])
+        self.assertEqual(regex.findall(r"(?i)[\p{Alpha}]", "A0"), ["A"])
+
+        self.assertEqual(regex.findall(r"[a\p{Alpha}]", "ab0"), ["a", "b"])
+        self.assertEqual(regex.findall(r"[a\P{Alpha}]", "ab0"), ["a", "0"])
+        self.assertEqual(regex.findall(r"(?i)[a\p{Alpha}]", "ab0"), ["a",
+          "b"])
+        self.assertEqual(regex.findall(r"(?i)[a\P{Alpha}]", "ab0"), ["a",
+          "0"])
+
+        self.assertEqual(regex.findall(r"[a-b\p{Alpha}]", "abC0"), ["a",
+          "b", "C"])
+        self.assertEqual(regex.findall(r"(?i)[a-b\p{Alpha}]", "AbC0"), ["A",
+          "b", "C"])
+
+        self.assertEqual(regex.findall(r"[\p{Alpha}]", "a0"), ["a"])
+        self.assertEqual(regex.findall(r"[\P{Alpha}]", "a0"), ["0"])
+        self.assertEqual(regex.findall(r"[^\p{Alpha}]", "a0"), ["0"])
+        self.assertEqual(regex.findall(r"[^\P{Alpha}]", "a0"), ["a"])
+
+        self.assertEqual("".join(regex.findall(r"[^\d-h]", "a^b12c-h")),
+          'a^bc')
+        self.assertEqual("".join(regex.findall(r"[^\dh]", "a^b12c-h")),
+          'a^bc-')
+        self.assertEqual("".join(regex.findall(r"[^h\s\db]", "a^b 12c-h")),
+          'a^c-')
+        self.assertEqual("".join(regex.findall(r"[^b\w]", "a b")), ' ')
+        self.assertEqual("".join(regex.findall(r"[^b\S]", "a b")), ' ')
+        self.assertEqual("".join(regex.findall(r"[^8\d]", "a 1b2")), 'a b')
+
+        all_chars = "".join(chr(c) for c in range(0x100))
+        self.assertEqual(len(regex.findall(r"\p{ASCII}", all_chars)), 128)
+        self.assertEqual(len(regex.findall(r"\p{Letter}", all_chars)),
+          117)
+        self.assertEqual(len(regex.findall(r"\p{Digit}", all_chars)), 10)
+
+        # Set operators
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Letter}]",
+          all_chars)), 52)
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Alnum}&&\p{Letter}]",
+          all_chars)), 52)
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Alnum}&&\p{Digit}]",
+          all_chars)), 10)
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Cc}]",
+          all_chars)), 33)
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}&&\p{Graph}]",
+          all_chars)), 94)
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{ASCII}--\p{Cc}]",
+          all_chars)), 95)
+        self.assertEqual(len(regex.findall(r"[\p{Letter}\p{Digit}]",
+          all_chars)), 127)
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{Letter}||\p{Digit}]",
+          all_chars)), 127)
+        self.assertEqual(len(regex.findall(r"\p{HexDigit}", all_chars)),
+          22)
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{HexDigit}~~\p{Digit}]",
+          all_chars)), 12)
+        self.assertEqual(len(regex.findall(r"(?V1)[\p{Digit}~~\p{HexDigit}]",
+          all_chars)), 12)
+
+        self.assertEqual(repr(type(regex.compile(r"(?V0)([][-])"))),
+          self.PATTERN_CLASS)
+        self.assertEqual(regex.findall(r"(?V1)[[a-z]--[aei]]", "abc"), ["b",
+          "c"])
+        self.assertEqual(regex.findall(r"(?iV1)[[a-z]--[aei]]", "abc"), ["b",
+          "c"])
+        self.assertEqual(regex.findall(r"(?V1)[\w--a]","abc"), ["b", "c"])
+        self.assertEqual(regex.findall(r"(?iV1)[\w--a]","abc"), ["b", "c"])
+
+    def test_various(self):
+        tests = [
+            # Test ?P< and ?P= extensions.
+            ('(?P<foo_123', '', '', regex.error, self.MISSING_GT),      # Unterminated group identifier.
+            ('(?P<1>a)', '', '', regex.error, self.BAD_GROUP_NAME),     # Begins with a digit.
+            ('(?P<!>a)', '', '', regex.error, self.BAD_GROUP_NAME),     # Begins with an illegal char.
+            ('(?P<foo!>a)', '', '', regex.error, self.BAD_GROUP_NAME),  # Begins with an illegal char.
+
+            # Same tests, for the ?P= form.
+            ('(?P<foo_123>a)(?P=foo_123', 'aa', '', regex.error,
+              self.MISSING_RPAREN),
+            ('(?P<foo_123>a)(?P=1)', 'aa', '1', ascii('a')),
+            ('(?P<foo_123>a)(?P=0)', 'aa', '', regex.error,
+              self.BAD_GROUP_NAME),
+            ('(?P<foo_123>a)(?P=-1)', 'aa', '', regex.error,
+              self.BAD_GROUP_NAME),
+            ('(?P<foo_123>a)(?P=!)', 'aa', '', regex.error,
+              self.BAD_GROUP_NAME),
+            ('(?P<foo_123>a)(?P=foo_124)', 'aa', '', regex.error,
+              self.UNKNOWN_GROUP),  # Backref to undefined group.
+
+            ('(?P<foo_123>a)', 'a', '1', ascii('a')),
+            ('(?P<foo_123>a)(?P=foo_123)', 'aa', '1', ascii('a')),
+
+            # Mal-formed \g in pattern treated as literal for compatibility.
+            (r'(?<foo_123>a)\g<foo_123', 'aa', '', ascii(None)),
+            (r'(?<foo_123>a)\g<1>', 'aa', '1', ascii('a')),
+            (r'(?<foo_123>a)\g<!>', 'aa', '', ascii(None)),
+            (r'(?<foo_123>a)\g<foo_124>', 'aa', '', regex.error,
+              self.UNKNOWN_GROUP),  # Backref to undefined group.
+
+            ('(?<foo_123>a)', 'a', '1', ascii('a')),
+            (r'(?<foo_123>a)\g<foo_123>', 'aa', '1', ascii('a')),
+
+            # Test octal escapes.
+            ('\\1', 'a', '', regex.error, self.INVALID_GROUP_REF),    # Backreference.
+            ('[\\1]', '\1', '0', "'\\x01'"),  # Character.
+            ('\\09', chr(0) + '9', '0', ascii(chr(0) + '9')),
+            ('\\141', 'a', '0', ascii('a')),
+            ('(a)(b)(c)(d)(e)(f)(g)(h)(i)(j)(k)(l)\\119', 'abcdefghijklk9',
+              '0,11', ascii(('abcdefghijklk9', 'k'))),
+
+            # Test \0 is handled everywhere.
+            (r'\0', '\0', '0', ascii('\0')),
+            (r'[\0a]', '\0', '0', ascii('\0')),
+            (r'[a\0]', '\0', '0', ascii('\0')),
+            (r'[^a\0]', '\0', '', ascii(None)),
+
+            # Test various letter escapes.
+            (r'\a[\b]\f\n\r\t\v', '\a\b\f\n\r\t\v', '0',
+              ascii('\a\b\f\n\r\t\v')),
+            (r'[\a][\b][\f][\n][\r][\t][\v]', '\a\b\f\n\r\t\v', '0',
+              ascii('\a\b\f\n\r\t\v')),
+            (r'\xff', '\377', '0', ascii(chr(255))),
+
+            # New \x semantics.
+            (r'\x00ffffffffffffff', '\377', '', ascii(None)),
+            (r'\x00f', '\017', '', ascii(None)),
+            (r'\x00fe', '\376', '', ascii(None)),
+
+            (r'\x00ff', '\377', '', ascii(None)),
+            (r'\t\n\v\r\f\a\g', '\t\n\v\r\f\ag', '0', ascii('\t\n\v\r\f\ag')),
+            ('\t\n\v\r\f\a\\g', '\t\n\v\r\f\ag', '0', ascii('\t\n\v\r\f\ag')),
+            (r'\t\n\v\r\f\a', '\t\n\v\r\f\a', '0', ascii(chr(9) + chr(10) +
+              chr(11) + chr(13) + chr(12) + chr(7))),
+            (r'[\t][\n][\v][\r][\f][\b]', '\t\n\v\r\f\b', '0',
+              ascii('\t\n\v\r\f\b')),
+
+            (r"^\w+=(\\[\000-\277]|[^\n\\])*",
+              "SRC=eval.c g.c blah blah blah \\\\\n\tapes.c", '0',
+              ascii("SRC=eval.c g.c blah blah blah \\\\")),
+
+            # Test that . only matches \n in DOTALL mode.
+            ('a.b', 'acb', '0', ascii('acb')),
+            ('a.b', 'a\nb', '', ascii(None)),
+            ('a.*b', 'acc\nccb', '', ascii(None)),
+            ('a.{4,5}b', 'acc\nccb', '', ascii(None)),
+            ('a.b', 'a\rb', '0', ascii('a\rb')),
+            # Changed to positional flags in regex 2023.12.23.
+            ('a.b(?s)', 'a\nb', '', ascii(None)),
+            ('(?s)a.b', 'a\nb', '0', ascii('a\nb')),
+            ('a.*(?s)b', 'acc\nccb', '', ascii(None)),
+            ('(?s)a.*b', 'acc\nccb', '0', ascii('acc\nccb')),
+            ('(?s)a.{4,5}b', 'acc\nccb', '0', ascii('acc\nccb')),
+
+            (')', '', '', regex.error, self.TRAILING_CHARS),           # Unmatched right bracket.
+            ('', '', '0', "''"),    # Empty pattern.
+            ('abc', 'abc', '0', ascii('abc')),
+            ('abc', 'xbc', '', ascii(None)),
+            ('abc', 'axc', '', ascii(None)),
+            ('abc', 'abx', '', ascii(None)),
+            ('abc', 'xabcy', '0', ascii('abc')),
+            ('abc', 'ababc', '0', ascii('abc')),
+            ('ab*c', 'abc', '0', ascii('abc')),
+            ('ab*bc', 'abc', '0', ascii('abc')),
+
+            ('ab*bc', 'abbc', '0', ascii('abbc')),
+            ('ab*bc', 'abbbbc', '0', ascii('abbbbc')),
+            ('ab+bc', 'abbc', '0', ascii('abbc')),
+            ('ab+bc', 'abc', '', ascii(None)),
+            ('ab+bc', 'abq', '', ascii(None)),
+            ('ab+bc', 'abbbbc', '0', ascii('abbbbc')),
+            ('ab?bc', 'abbc', '0', ascii('abbc')),
+            ('ab?bc', 'abc', '0', ascii('abc')),
+            ('ab?bc', 'abbbbc', '', ascii(None)),
+            ('ab?c', 'abc', '0', ascii('abc')),
+
+            ('^abc$', 'abc', '0', ascii('abc')),
+            ('^abc$', 'abcc', '', ascii(None)),
+            ('^abc', 'abcc', '0', ascii('abc')),
+            ('^abc$', 'aabc', '', ascii(None)),
+            ('abc$', 'aabc', '0', ascii('abc')),
+            ('^', 'abc', '0', ascii('')),
+            ('$', 'abc', '0', ascii('')),
+            ('a.c', 'abc', '0', ascii('abc')),
+            ('a.c', 'axc', '0', ascii('axc')),
+            ('a.*c', 'axyzc', '0', ascii('axyzc')),
+
+            ('a.*c', 'axyzd', '', ascii(None)),
+            ('a[bc]d', 'abc', '', ascii(None)),
+            ('a[bc]d', 'abd', '0', ascii('abd')),
+            ('a[b-d]e', 'abd', '', ascii(None)),
+            ('a[b-d]e', 'ace', '0', ascii('ace')),
+            ('a[b-d]', 'aac', '0', ascii('ac')),
+            ('a[-b]', 'a-', '0', ascii('a-')),
+            ('a[\\-b]', 'a-', '0', ascii('a-')),
+            ('a[b-]', 'a-', '0', ascii('a-')),
+            ('a[]b', '-', '', regex.error, self.BAD_SET),
+
+            ('a[', '-', '', regex.error, self.BAD_SET),
+            ('a\\', '-', '', regex.error, self.BAD_ESCAPE),
+            ('abc)', '-', '', regex.error, self.TRAILING_CHARS),
+            ('(abc', '-', '', regex.error, self.MISSING_RPAREN),
+            ('a]', 'a]', '0', ascii('a]')),
+            ('a[]]b', 'a]b', '0', ascii('a]b')),
+            ('a[]]b', 'a]b', '0', ascii('a]b')),
+            ('a[^bc]d', 'aed', '0', ascii('aed')),
+            ('a[^bc]d', 'abd', '', ascii(None)),
+            ('a[^-b]c', 'adc', '0', ascii('adc')),
+
+            ('a[^-b]c', 'a-c', '', ascii(None)),
+            ('a[^]b]c', 'a]c', '', ascii(None)),
+            ('a[^]b]c', 'adc', '0', ascii('adc')),
+            ('\\ba\\b', 'a-', '0', ascii('a')),
+            ('\\ba\\b', '-a', '0', ascii('a')),
+            ('\\ba\\b', '-a-', '0', ascii('a')),
+            ('\\by\\b', 'xy', '', ascii(None)),
+            ('\\by\\b', 'yz', '', ascii(None)),
+            ('\\by\\b', 'xyz', '', ascii(None)),
+            ('x\\b', 'xyz', '', ascii(None)),
+
+            ('x\\B', 'xyz', '0', ascii('x')),
+            ('\\Bz', 'xyz', '0', ascii('z')),
+            ('z\\B', 'xyz', '', ascii(None)),
+            ('\\Bx', 'xyz', '', ascii(None)),
+            ('\\Ba\\B', 'a-', '', ascii(None)),
+            ('\\Ba\\B', '-a', '', ascii(None)),
+            ('\\Ba\\B', '-a-', '', ascii(None)),
+            ('\\By\\B', 'xy', '', ascii(None)),
+            ('\\By\\B', 'yz', '', ascii(None)),
+            ('\\By\\b', 'xy', '0', ascii('y')),
+
+            ('\\by\\B', 'yz', '0', ascii('y')),
+            ('\\By\\B', 'xyz', '0', ascii('y')),
+            ('ab|cd', 'abc', '0', ascii('ab')),
+            ('ab|cd', 'abcd', '0', ascii('ab')),
+            ('()ef', 'def', '0,1', ascii(('ef', ''))),
+            ('$b', 'b', '', ascii(None)),
+            ('a\\(b', 'a(b', '', ascii(('a(b',))),
+            ('a\\(*b', 'ab', '0', ascii('ab')),
+            ('a\\(*b', 'a((b', '0', ascii('a((b')),
+            ('a\\\\b', 'a\\b', '0', ascii('a\\b')),
+
+            ('((a))', 'abc', '0,1,2', ascii(('a', 'a', 'a'))),
+            ('(a)b(c)', 'abc', '0,1,2', ascii(('abc', 'a', 'c'))),
+            ('a+b+c', 'aabbabc', '0', ascii('abc')),
+            ('(a+|b)*', 'ab', '0,1', ascii(('ab', 'b'))),
+            ('(a+|b)+', 'ab', '0,1', ascii(('ab', 'b'))),
+            ('(a+|b)?', 'ab', '0,1', ascii(('a', 'a'))),
+            (')(', '-', '', regex.error, self.TRAILING_CHARS),
+            ('[^ab]*', 'cde', '0', ascii('cde')),
+            ('abc', '', '', ascii(None)),
+            ('a*', '', '0', ascii('')),
+
+            ('a|b|c|d|e', 'e', '0', ascii('e')),
+            ('(a|b|c|d|e)f', 'ef', '0,1', ascii(('ef', 'e'))),
+            ('abcd*efg', 'abcdefg', '0', ascii('abcdefg')),
+            ('ab*', 'xabyabbbz', '0', ascii('ab')),
+            ('ab*', 'xayabbbz', '0', ascii('a')),
+            ('(ab|cd)e', 'abcde', '0,1', ascii(('cde', 'cd'))),
+            ('[abhgefdc]ij', 'hij', '0', ascii('hij')),
+            ('^(ab|cd)e', 'abcde', '', ascii(None)),
+            ('(abc|)ef', 'abcdef', '0,1', ascii(('ef', ''))),
+            ('(a|b)c*d', 'abcd', '0,1', ascii(('bcd', 'b'))),
+
+            ('(ab|ab*)bc', 'abc', '0,1', ascii(('abc', 'a'))),
+            ('a([bc]*)c*', 'abc', '0,1', ascii(('abc', 'bc'))),
+            ('a([bc]*)(c*d)', 'abcd', '0,1,2', ascii(('abcd', 'bc', 'd'))),
+            ('a([bc]+)(c*d)', 'abcd', '0,1,2', ascii(('abcd', 'bc', 'd'))),
+            ('a([bc]*)(c+d)', 'abcd', '0,1,2', ascii(('abcd', 'b', 'cd'))),
+            ('a[bcd]*dcdcde', 'adcdcde', '0', ascii('adcdcde')),
+            ('a[bcd]+dcdcde', 'adcdcde', '', ascii(None)),
+            ('(ab|a)b*c', 'abc', '0,1', ascii(('abc', 'ab'))),
+            ('((a)(b)c)(d)', 'abcd', '1,2,3,4', ascii(('abc', 'a', 'b', 'd'))),
+            ('[a-zA-Z_][a-zA-Z0-9_]*', 'alpha', '0', ascii('alpha')),
+
+            ('^a(bc+|b[eh])g|.h$', 'abh', '0,1', ascii(('bh', None))),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'effgz', '0,1,2', ascii(('effgz',
+              'effgz', None))),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'ij', '0,1,2', ascii(('ij', 'ij',
+              'j'))),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'effg', '', ascii(None)),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'bcdd', '', ascii(None)),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'reffgz', '0,1,2', ascii(('effgz',
+              'effgz', None))),
+            ('(((((((((a)))))))))', 'a', '0', ascii('a')),
+            ('multiple words of text', 'uh-uh', '', ascii(None)),
+            ('multiple words', 'multiple words, yeah', '0',
+              ascii('multiple words')),
+            ('(.*)c(.*)', 'abcde', '0,1,2', ascii(('abcde', 'ab', 'de'))),
+
+            ('\\((.*), (.*)\\)', '(a, b)', '2,1', ascii(('b', 'a'))),
+            ('[k]', 'ab', '', ascii(None)),
+            ('a[-]?c', 'ac', '0', ascii('ac')),
+            ('(abc)\\1', 'abcabc', '1', ascii('abc')),
+            ('([a-c]*)\\1', 'abcabc', '1', ascii('abc')),
+            ('^(.+)?B', 'AB', '1', ascii('A')),
+            ('(a+).\\1$', 'aaaaa', '0,1', ascii(('aaaaa', 'aa'))),
+            ('^(a+).\\1$', 'aaaa', '', ascii(None)),
+            ('(abc)\\1', 'abcabc', '0,1', ascii(('abcabc', 'abc'))),
+            ('([a-c]+)\\1', 'abcabc', '0,1', ascii(('abcabc', 'abc'))),
+
+            ('(a)\\1', 'aa', '0,1', ascii(('aa', 'a'))),
+            ('(a+)\\1', 'aa', '0,1', ascii(('aa', 'a'))),
+            ('(a+)+\\1', 'aa', '0,1', ascii(('aa', 'a'))),
+            ('(a).+\\1', 'aba', '0,1', ascii(('aba', 'a'))),
+            ('(a)ba*\\1', 'aba', '0,1', ascii(('aba', 'a'))),
+            ('(aa|a)a\\1$', 'aaa', '0,1', ascii(('aaa', 'a'))),
+            ('(a|aa)a\\1$', 'aaa', '0,1', ascii(('aaa', 'a'))),
+            ('(a+)a\\1$', 'aaa', '0,1', ascii(('aaa', 'a'))),
+            ('([abc]*)\\1', 'abcabc', '0,1', ascii(('abcabc', 'abc'))),
+            ('(a)(b)c|ab', 'ab', '0,1,2', ascii(('ab', None, None))),
+
+            ('(a)+x', 'aaax', '0,1', ascii(('aaax', 'a'))),
+            ('([ac])+x', 'aacx', '0,1', ascii(('aacx', 'c'))),
+            ('([^/]*/)*sub1/', 'd:msgs/tdir/sub1/trial/away.cpp', '0,1',
+              ascii(('d:msgs/tdir/sub1/', 'tdir/'))),
+            ('([^.]*)\\.([^:]*):[T ]+(.*)', 'track1.title:TBlah blah blah',
+              '0,1,2,3', ascii(('track1.title:TBlah blah blah', 'track1',
+              'title', 'Blah blah blah'))),
+            ('([^N]*N)+', 'abNNxyzN', '0,1', ascii(('abNNxyzN', 'xyzN'))),
+            ('([^N]*N)+', 'abNNxyz', '0,1', ascii(('abNN', 'N'))),
+            ('([abc]*)x', 'abcx', '0,1', ascii(('abcx', 'abc'))),
+            ('([abc]*)x', 'abc', '', ascii(None)),
+            ('([xyz]*)x', 'abcx', '0,1', ascii(('x', ''))),
+            ('(a)+b|aac', 'aac', '0,1', ascii(('aac', None))),
+
+            # Test symbolic groups.
+            ('(?P<i d>aaa)a', 'aaaa', '', regex.error, self.BAD_GROUP_NAME),
+            ('(?P<id>aaa)a', 'aaaa', '0,id', ascii(('aaaa', 'aaa'))),
+            ('(?P<id>aa)(?P=id)', 'aaaa', '0,id', ascii(('aaaa', 'aa'))),
+            ('(?P<id>aa)(?P=xd)', 'aaaa', '', regex.error, self.UNKNOWN_GROUP),
+
+            # Character properties.
+            (r"\g", "g", '0', ascii('g')),
+            (r"\g<1>", "g", '', regex.error, self.INVALID_GROUP_REF),
+            (r"(.)\g<1>", "gg", '0', ascii('gg')),
+            (r"(.)\g<1>", "gg", '', ascii(('gg', 'g'))),
+            (r"\N", "N", '0', ascii('N')),
+            (r"\N{LATIN SMALL LETTER A}", "a", '0', ascii('a')),
+            (r"\p", "p", '0', ascii('p')),
+            (r"\p{Ll}", "a", '0', ascii('a')),
+            (r"\P", "P", '0', ascii('P')),
+            (r"\P{Lu}", "p", '0', ascii('p')),
+
+            # All tests from Perl.
+            ('abc', 'abc', '0', ascii('abc')),
+            ('abc', 'xbc', '', ascii(None)),
+            ('abc', 'axc', '', ascii(None)),
+            ('abc', 'abx', '', ascii(None)),
+            ('abc', 'xabcy', '0', ascii('abc')),
+            ('abc', 'ababc', '0', ascii('abc')),
+
+            ('ab*c', 'abc', '0', ascii('abc')),
+            ('ab*bc', 'abc', '0', ascii('abc')),
+            ('ab*bc', 'abbc', '0', ascii('abbc')),
+            ('ab*bc', 'abbbbc', '0', ascii('abbbbc')),
+            ('ab{0,}bc', 'abbbbc', '0', ascii('abbbbc')),
+            ('ab+bc', 'abbc', '0', ascii('abbc')),
+            ('ab+bc', 'abc', '', ascii(None)),
+            ('ab+bc', 'abq', '', ascii(None)),
+            ('ab{1,}bc', 'abq', '', ascii(None)),
+            ('ab+bc', 'abbbbc', '0', ascii('abbbbc')),
+
+            ('ab{1,}bc', 'abbbbc', '0', ascii('abbbbc')),
+            ('ab{1,3}bc', 'abbbbc', '0', ascii('abbbbc')),
+            ('ab{3,4}bc', 'abbbbc', '0', ascii('abbbbc')),
+            ('ab{4,5}bc', 'abbbbc', '', ascii(None)),
+            ('ab?bc', 'abbc', '0', ascii('abbc')),
+            ('ab?bc', 'abc', '0', ascii('abc')),
+            ('ab{0,1}bc', 'abc', '0', ascii('abc')),
+            ('ab?bc', 'abbbbc', '', ascii(None)),
+            ('ab?c', 'abc', '0', ascii('abc')),
+            ('ab{0,1}c', 'abc', '0', ascii('abc')),
+
+            ('^abc$', 'abc', '0', ascii('abc')),
+            ('^abc$', 'abcc', '', ascii(None)),
+            ('^abc', 'abcc', '0', ascii('abc')),
+            ('^abc$', 'aabc', '', ascii(None)),
+            ('abc$', 'aabc', '0', ascii('abc')),
+            ('^', 'abc', '0', ascii('')),
+            ('$', 'abc', '0', ascii('')),
+            ('a.c', 'abc', '0', ascii('abc')),
+            ('a.c', 'axc', '0', ascii('axc')),
+            ('a.*c', 'axyzc', '0', ascii('axyzc')),
+
+            ('a.*c', 'axyzd', '', ascii(None)),
+            ('a[bc]d', 'abc', '', ascii(None)),
+            ('a[bc]d', 'abd', '0', ascii('abd')),
+            ('a[b-d]e', 'abd', '', ascii(None)),
+            ('a[b-d]e', 'ace', '0', ascii('ace')),
+            ('a[b-d]', 'aac', '0', ascii('ac')),
+            ('a[-b]', 'a-', '0', ascii('a-')),
+            ('a[b-]', 'a-', '0', ascii('a-')),
+            ('a[b-a]', '-', '', regex.error, self.BAD_CHAR_RANGE),
+            ('a[]b', '-', '', regex.error, self.BAD_SET),
+
+            ('a[', '-', '', regex.error, self.BAD_SET),
+            ('a]', 'a]', '0', ascii('a]')),
+            ('a[]]b', 'a]b', '0', ascii('a]b')),
+            ('a[^bc]d', 'aed', '0', ascii('aed')),
+            ('a[^bc]d', 'abd', '', ascii(None)),
+            ('a[^-b]c', 'adc', '0', ascii('adc')),
+            ('a[^-b]c', 'a-c', '', ascii(None)),
+            ('a[^]b]c', 'a]c', '', ascii(None)),
+            ('a[^]b]c', 'adc', '0', ascii('adc')),
+            ('ab|cd', 'abc', '0', ascii('ab')),
+
+            ('ab|cd', 'abcd', '0', ascii('ab')),
+            ('()ef', 'def', '0,1', ascii(('ef', ''))),
+            ('*a', '-', '', regex.error, self.NOTHING_TO_REPEAT),
+            ('(*)b', '-', '', regex.error, self.NOTHING_TO_REPEAT),
+            ('$b', 'b', '', ascii(None)),
+            ('a\\', '-', '', regex.error, self.BAD_ESCAPE),
+            ('a\\(b', 'a(b', '', ascii(('a(b',))),
+            ('a\\(*b', 'ab', '0', ascii('ab')),
+            ('a\\(*b', 'a((b', '0', ascii('a((b')),
+            ('a\\\\b', 'a\\b', '0', ascii('a\\b')),
+
+            ('abc)', '-', '', regex.error, self.TRAILING_CHARS),
+            ('(abc', '-', '', regex.error, self.MISSING_RPAREN),
+            ('((a))', 'abc', '0,1,2', ascii(('a', 'a', 'a'))),
+            ('(a)b(c)', 'abc', '0,1,2', ascii(('abc', 'a', 'c'))),
+            ('a+b+c', 'aabbabc', '0', ascii('abc')),
+            ('a{1,}b{1,}c', 'aabbabc', '0', ascii('abc')),
+            ('a**', '-', '', regex.error, self.MULTIPLE_REPEAT),
+            ('a.+?c', 'abcabc', '0', ascii('abc')),
+            ('(a+|b)*', 'ab', '0,1', ascii(('ab', 'b'))),
+            ('(a+|b){0,}', 'ab', '0,1', ascii(('ab', 'b'))),
+
+            ('(a+|b)+', 'ab', '0,1', ascii(('ab', 'b'))),
+            ('(a+|b){1,}', 'ab', '0,1', ascii(('ab', 'b'))),
+            ('(a+|b)?', 'ab', '0,1', ascii(('a', 'a'))),
+            ('(a+|b){0,1}', 'ab', '0,1', ascii(('a', 'a'))),
+            (')(', '-', '', regex.error, self.TRAILING_CHARS),
+            ('[^ab]*', 'cde', '0', ascii('cde')),
+            ('abc', '', '', ascii(None)),
+            ('a*', '', '0', ascii('')),
+            ('([abc])*d', 'abbbcd', '0,1', ascii(('abbbcd', 'c'))),
+            ('([abc])*bcd', 'abcd', '0,1', ascii(('abcd', 'a'))),
+
+            ('a|b|c|d|e', 'e', '0', ascii('e')),
+            ('(a|b|c|d|e)f', 'ef', '0,1', ascii(('ef', 'e'))),
+            ('abcd*efg', 'abcdefg', '0', ascii('abcdefg')),
+            ('ab*', 'xabyabbbz', '0', ascii('ab')),
+            ('ab*', 'xayabbbz', '0', ascii('a')),
+            ('(ab|cd)e', 'abcde', '0,1', ascii(('cde', 'cd'))),
+            ('[abhgefdc]ij', 'hij', '0', ascii('hij')),
+            ('^(ab|cd)e', 'abcde', '', ascii(None)),
+            ('(abc|)ef', 'abcdef', '0,1', ascii(('ef', ''))),
+            ('(a|b)c*d', 'abcd', '0,1', ascii(('bcd', 'b'))),
+
+            ('(ab|ab*)bc', 'abc', '0,1', ascii(('abc', 'a'))),
+            ('a([bc]*)c*', 'abc', '0,1', ascii(('abc', 'bc'))),
+            ('a([bc]*)(c*d)', 'abcd', '0,1,2', ascii(('abcd', 'bc', 'd'))),
+            ('a([bc]+)(c*d)', 'abcd', '0,1,2', ascii(('abcd', 'bc', 'd'))),
+            ('a([bc]*)(c+d)', 'abcd', '0,1,2', ascii(('abcd', 'b', 'cd'))),
+            ('a[bcd]*dcdcde', 'adcdcde', '0', ascii('adcdcde')),
+            ('a[bcd]+dcdcde', 'adcdcde', '', ascii(None)),
+            ('(ab|a)b*c', 'abc', '0,1', ascii(('abc', 'ab'))),
+            ('((a)(b)c)(d)', 'abcd', '1,2,3,4', ascii(('abc', 'a', 'b', 'd'))),
+            ('[a-zA-Z_][a-zA-Z0-9_]*', 'alpha', '0', ascii('alpha')),
+
+            ('^a(bc+|b[eh])g|.h$', 'abh', '0,1', ascii(('bh', None))),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'effgz', '0,1,2', ascii(('effgz',
+              'effgz', None))),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'ij', '0,1,2', ascii(('ij', 'ij',
+              'j'))),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'effg', '', ascii(None)),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'bcdd', '', ascii(None)),
+            ('(bc+d$|ef*g.|h?i(j|k))', 'reffgz', '0,1,2', ascii(('effgz',
+              'effgz', None))),
+            ('((((((((((a))))))))))', 'a', '10', ascii('a')),
+            ('((((((((((a))))))))))\\10', 'aa', '0', ascii('aa')),
+
+            # Python does not have the same rules for \\41 so this is a syntax error
+            #    ('((((((((((a))))))))))\\41', 'aa', '', ascii(None)),
+            #    ('((((((((((a))))))))))\\41', 'a!', '0', ascii('a!')),
+            ('((((((((((a))))))))))\\41', '', '', regex.error,
+              self.INVALID_GROUP_REF),
+            ('(?i)((((((((((a))))))))))\\41', '', '', regex.error,
+              self.INVALID_GROUP_REF),
+
+            ('(((((((((a)))))))))', 'a', '0', ascii('a')),
+            ('multiple words of text', 'uh-uh', '', ascii(None)),
+            ('multiple words', 'multiple words, yeah', '0',
+              ascii('multiple words')),
+            ('(.*)c(.*)', 'abcde', '0,1,2', ascii(('abcde', 'ab', 'de'))),
+            ('\\((.*), (.*)\\)', '(a, b)', '2,1', ascii(('b', 'a'))),
+            ('[k]', 'ab', '', ascii(None)),
+            ('a[-]?c', 'ac', '0', ascii('ac')),
+            ('(abc)\\1', 'abcabc', '1', ascii('abc')),
+            ('([a-c]*)\\1', 'abcabc', '1', ascii('abc')),
+            ('(?i)abc', 'ABC', '0', ascii('ABC')),
+
+            ('(?i)abc', 'XBC', '', ascii(None)),
+            ('(?i)abc', 'AXC', '', ascii(None)),
+            ('(?i)abc', 'ABX', '', ascii(None)),
+            ('(?i)abc', 'XABCY', '0', ascii('ABC')),
+            ('(?i)abc', 'ABABC', '0', ascii('ABC')),
+            ('(?i)ab*c', 'ABC', '0', ascii('ABC')),
+            ('(?i)ab*bc', 'ABC', '0', ascii('ABC')),
+            ('(?i)ab*bc', 'ABBC', '0', ascii('ABBC')),
+            ('(?i)ab*?bc', 'ABBBBC', '0', ascii('ABBBBC')),
+            ('(?i)ab{0,}?bc', 'ABBBBC', '0', ascii('ABBBBC')),
+
+            ('(?i)ab+?bc', 'ABBC', '0', ascii('ABBC')),
+            ('(?i)ab+bc', 'ABC', '', ascii(None)),
+            ('(?i)ab+bc', 'ABQ', '', ascii(None)),
+            ('(?i)ab{1,}bc', 'ABQ', '', ascii(None)),
+            ('(?i)ab+bc', 'ABBBBC', '0', ascii('ABBBBC')),
+            ('(?i)ab{1,}?bc', 'ABBBBC', '0', ascii('ABBBBC')),
+            ('(?i)ab{1,3}?bc', 'ABBBBC', '0', ascii('ABBBBC')),
+            ('(?i)ab{3,4}?bc', 'ABBBBC', '0', ascii('ABBBBC')),
+            ('(?i)ab{4,5}?bc', 'ABBBBC', '', ascii(None)),
+            ('(?i)ab??bc', 'ABBC', '0', ascii('ABBC')),
+
+            ('(?i)ab??bc', 'ABC', '0', ascii('ABC')),
+            ('(?i)ab{0,1}?bc', 'ABC', '0', ascii('ABC')),
+            ('(?i)ab??bc', 'ABBBBC', '', ascii(None)),
+            ('(?i)ab??c', 'ABC', '0', ascii('ABC')),
+            ('(?i)ab{0,1}?c', 'ABC', '0', ascii('ABC')),
+            ('(?i)^abc$', 'ABC', '0', ascii('ABC')),
+            ('(?i)^abc$', 'ABCC', '', ascii(None)),
+            ('(?i)^abc', 'ABCC', '0', ascii('ABC')),
+            ('(?i)^abc$', 'AABC', '', ascii(None)),
+            ('(?i)abc$', 'AABC', '0', ascii('ABC')),
+
+            ('(?i)^', 'ABC', '0', ascii('')),
+            ('(?i)$', 'ABC', '0', ascii('')),
+            ('(?i)a.c', 'ABC', '0', ascii('ABC')),
+            ('(?i)a.c', 'AXC', '0', ascii('AXC')),
+            ('(?i)a.*?c', 'AXYZC', '0', ascii('AXYZC')),
+            ('(?i)a.*c', 'AXYZD', '', ascii(None)),
+            ('(?i)a[bc]d', 'ABC', '', ascii(None)),
+            ('(?i)a[bc]d', 'ABD', '0', ascii('ABD')),
+            ('(?i)a[b-d]e', 'ABD', '', ascii(None)),
+            ('(?i)a[b-d]e', 'ACE', '0', ascii('ACE')),
+
+            ('(?i)a[b-d]', 'AAC', '0', ascii('AC')),
+            ('(?i)a[-b]', 'A-', '0', ascii('A-')),
+            ('(?i)a[b-]', 'A-', '0', ascii('A-')),
+            ('(?i)a[b-a]', '-', '', regex.error, self.BAD_CHAR_RANGE),
+            ('(?i)a[]b', '-', '', regex.error, self.BAD_SET),
+            ('(?i)a[', '-', '', regex.error, self.BAD_SET),
+            ('(?i)a]', 'A]', '0', ascii('A]')),
+            ('(?i)a[]]b', 'A]B', '0', ascii('A]B')),
+            ('(?i)a[^bc]d', 'AED', '0', ascii('AED')),
+            ('(?i)a[^bc]d', 'ABD', '', ascii(None)),
+
+            ('(?i)a[^-b]c', 'ADC', '0', ascii('ADC')),
+            ('(?i)a[^-b]c', 'A-C', '', ascii(None)),
+            ('(?i)a[^]b]c', 'A]C', '', ascii(None)),
+            ('(?i)a[^]b]c', 'ADC', '0', ascii('ADC')),
+            ('(?i)ab|cd', 'ABC', '0', ascii('AB')),
+            ('(?i)ab|cd', 'ABCD', '0', ascii('AB')),
+            ('(?i)()ef', 'DEF', '0,1', ascii(('EF', ''))),
+            ('(?i)*a', '-', '', regex.error, self.NOTHING_TO_REPEAT),
+            ('(?i)(*)b', '-', '', regex.error, self.NOTHING_TO_REPEAT),
+            ('(?i)$b', 'B', '', ascii(None)),
+
+            ('(?i)a\\', '-', '', regex.error, self.BAD_ESCAPE),
+            ('(?i)a\\(b', 'A(B', '', ascii(('A(B',))),
+            ('(?i)a\\(*b', 'AB', '0', ascii('AB')),
+            ('(?i)a\\(*b', 'A((B', '0', ascii('A((B')),
+            ('(?i)a\\\\b', 'A\\B', '0', ascii('A\\B')),
+            ('(?i)abc)', '-', '', regex.error, self.TRAILING_CHARS),
+            ('(?i)(abc', '-', '', regex.error, self.MISSING_RPAREN),
+            ('(?i)((a))', 'ABC', '0,1,2', ascii(('A', 'A', 'A'))),
+            ('(?i)(a)b(c)', 'ABC', '0,1,2', ascii(('ABC', 'A', 'C'))),
+            ('(?i)a+b+c', 'AABBABC', '0', ascii('ABC')),
+
+            ('(?i)a{1,}b{1,}c', 'AABBABC', '0', ascii('ABC')),
+            ('(?i)a**', '-', '', regex.error, self.MULTIPLE_REPEAT),
+            ('(?i)a.+?c', 'ABCABC', '0', ascii('ABC')),
+            ('(?i)a.*?c', 'ABCABC', '0', ascii('ABC')),
+            ('(?i)a.{0,5}?c', 'ABCABC', '0', ascii('ABC')),
+            ('(?i)(a+|b)*', 'AB', '0,1', ascii(('AB', 'B'))),
+            ('(?i)(a+|b){0,}', 'AB', '0,1', ascii(('AB', 'B'))),
+            ('(?i)(a+|b)+', 'AB', '0,1', ascii(('AB', 'B'))),
+            ('(?i)(a+|b){1,}', 'AB', '0,1', ascii(('AB', 'B'))),
+            ('(?i)(a+|b)?', 'AB', '0,1', ascii(('A', 'A'))),
+
+            ('(?i)(a+|b){0,1}', 'AB', '0,1', ascii(('A', 'A'))),
+            ('(?i)(a+|b){0,1}?', 'AB', '0,1', ascii(('', None))),
+            ('(?i))(', '-', '', regex.error, self.TRAILING_CHARS),
+            ('(?i)[^ab]*', 'CDE', '0', ascii('CDE')),
+            ('(?i)abc', '', '', ascii(None)),
+            ('(?i)a*', '', '0', ascii('')),
+            ('(?i)([abc])*d', 'ABBBCD', '0,1', ascii(('ABBBCD', 'C'))),
+            ('(?i)([abc])*bcd', 'ABCD', '0,1', ascii(('ABCD', 'A'))),
+            ('(?i)a|b|c|d|e', 'E', '0', ascii('E')),
+            ('(?i)(a|b|c|d|e)f', 'EF', '0,1', ascii(('EF', 'E'))),
+
+            ('(?i)abcd*efg', 'ABCDEFG', '0', ascii('ABCDEFG')),
+            ('(?i)ab*', 'XABYABBBZ', '0', ascii('AB')),
+            ('(?i)ab*', 'XAYABBBZ', '0', ascii('A')),
+            ('(?i)(ab|cd)e', 'ABCDE', '0,1', ascii(('CDE', 'CD'))),
+            ('(?i)[abhgefdc]ij', 'HIJ', '0', ascii('HIJ')),
+            ('(?i)^(ab|cd)e', 'ABCDE', '', ascii(None)),
+            ('(?i)(abc|)ef', 'ABCDEF', '0,1', ascii(('EF', ''))),
+            ('(?i)(a|b)c*d', 'ABCD', '0,1', ascii(('BCD', 'B'))),
+            ('(?i)(ab|ab*)bc', 'ABC', '0,1', ascii(('ABC', 'A'))),
+            ('(?i)a([bc]*)c*', 'ABC', '0,1', ascii(('ABC', 'BC'))),
+
+            ('(?i)a([bc]*)(c*d)', 'ABCD', '0,1,2', ascii(('ABCD', 'BC', 'D'))),
+            ('(?i)a([bc]+)(c*d)', 'ABCD', '0,1,2', ascii(('ABCD', 'BC', 'D'))),
+            ('(?i)a([bc]*)(c+d)', 'ABCD', '0,1,2', ascii(('ABCD', 'B', 'CD'))),
+            ('(?i)a[bcd]*dcdcde', 'ADCDCDE', '0', ascii('ADCDCDE')),
+            ('(?i)a[bcd]+dcdcde', 'ADCDCDE', '', ascii(None)),
+            ('(?i)(ab|a)b*c', 'ABC', '0,1', ascii(('ABC', 'AB'))),
+            ('(?i)((a)(b)c)(d)', 'ABCD', '1,2,3,4', ascii(('ABC', 'A', 'B',
+              'D'))),
+            ('(?i)[a-zA-Z_][a-zA-Z0-9_]*', 'ALPHA', '0', ascii('ALPHA')),
+            ('(?i)^a(bc+|b[eh])g|.h$', 'ABH', '0,1', ascii(('BH', None))),
+            ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'EFFGZ', '0,1,2', ascii(('EFFGZ',
+              'EFFGZ', None))),
+
+            ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'IJ', '0,1,2', ascii(('IJ', 'IJ',
+              'J'))),
+            ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'EFFG', '', ascii(None)),
+            ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'BCDD', '', ascii(None)),
+            ('(?i)(bc+d$|ef*g.|h?i(j|k))', 'REFFGZ', '0,1,2', ascii(('EFFGZ',
+              'EFFGZ', None))),
+            ('(?i)((((((((((a))))))))))', 'A', '10', ascii('A')),
+            ('(?i)((((((((((a))))))))))\\10', 'AA', '0', ascii('AA')),
+            #('(?i)((((((((((a))))))))))\\41', 'AA', '', ascii(None)),
+            #('(?i)((((((((((a))))))))))\\41', 'A!', '0', ascii('A!')),
+            ('(?i)(((((((((a)))))))))', 'A', '0', ascii('A')),
+            ('(?i)(?:(?:(?:(?:(?:(?:(?:(?:(?:(a))))))))))', 'A', '1',
+              ascii('A')),
+            ('(?i)(?:(?:(?:(?:(?:(?:(?:(?:(?:(a|b|c))))))))))', 'C', '1',
+              ascii('C')),
+            ('(?i)multiple words of text', 'UH-UH', '', ascii(None)),
+
+            ('(?i)multiple words', 'MULTIPLE WORDS, YEAH', '0',
+             ascii('MULTIPLE WORDS')),
+            ('(?i)(.*)c(.*)', 'ABCDE', '0,1,2', ascii(('ABCDE', 'AB', 'DE'))),
+            ('(?i)\\((.*), (.*)\\)', '(A, B)', '2,1', ascii(('B', 'A'))),
+            ('(?i)[k]', 'AB', '', ascii(None)),
+        #    ('(?i)abcd', 'ABCD', SUCCEED, 'found+"-"+\\found+"-"+\\\\found', ascii(ABCD-$&-\\ABCD)),
+        #    ('(?i)a(bc)d', 'ABCD', SUCCEED, 'g1+"-"+\\g1+"-"+\\\\g1', ascii(BC-$1-\\BC)),
+            ('(?i)a[-]?c', 'AC', '0', ascii('AC')),
+            ('(?i)(abc)\\1', 'ABCABC', '1', ascii('ABC')),
+            ('(?i)([a-c]*)\\1', 'ABCABC', '1', ascii('ABC')),
+            ('a(?!b).', 'abad', '0', ascii('ad')),
+            ('a(?=d).', 'abad', '0', ascii('ad')),
+            ('a(?=c|d).', 'abad', '0', ascii('ad')),
+
+            ('a(?:b|c|d)(.)', 'ace', '1', ascii('e')),
+            ('a(?:b|c|d)*(.)', 'ace', '1', ascii('e')),
+            ('a(?:b|c|d)+?(.)', 'ace', '1', ascii('e')),
+            ('a(?:b|(c|e){1,2}?|d)+?(.)', 'ace', '1,2', ascii(('c', 'e'))),
+
+            # Lookbehind: split by : but not if it is escaped by -.
+            ('(?<!-):(.*?)(?<!-):', 'a:bc-:de:f', '1', ascii('bc-:de')),
+            # Escaping with \ as we know it.
+            ('(?<!\\\\):(.*?)(?<!\\\\):', 'a:bc\\:de:f', '1', ascii('bc\\:de')),
+            # Terminating with ' and escaping with ? as in edifact.
+            ("(?<!\\?)'(.*?)(?<!\\?)'", "a'bc?'de'f", '1', ascii("bc?'de")),
+
+            # Comments using the (?#...) syntax.
+
+            ('w(?# comment', 'w', '', regex.error, self.MISSING_RPAREN),
+            ('w(?# comment 1)xy(?# comment 2)z', 'wxyz', '0', ascii('wxyz')),
+
+            # Check odd placement of embedded pattern modifiers.
+
+            # Not an error under PCRE/PRE:
+            # When the new behaviour is turned on positional inline flags affect
+            # only what follows.
+            ('w(?i)', 'W', '0', ascii(None)),
+            ('w(?i)', 'w', '0', ascii('w')),
+            ('(?i)w', 'W', '0', ascii('W')),
+
+            # Comments using the x embedded pattern modifier.
+            ("""(?x)w# comment 1
+x y
+# comment 2
+z""", 'wxyz', '0', ascii('wxyz')),
+
+            # Using the m embedded pattern modifier.
+            ('^abc', """jkl
+abc
+xyz""", '', ascii(None)),
+            ('(?m)^abc', """jkl
+abc
+xyz""", '0', ascii('abc')),
+
+            ('(?m)abc$', """jkl
+xyzabc
+123""", '0', ascii('abc')),
+
+            # Using the s embedded pattern modifier.
+            ('a.b', 'a\nb', '', ascii(None)),
+            ('(?s)a.b', 'a\nb', '0', ascii('a\nb')),
+
+            # Test \w, etc. both inside and outside character classes.
+            ('\\w+', '--ab_cd0123--', '0', ascii('ab_cd0123')),
+            ('[\\w]+', '--ab_cd0123--', '0', ascii('ab_cd0123')),
+            ('\\D+', '1234abc5678', '0', ascii('abc')),
+            ('[\\D]+', '1234abc5678', '0', ascii('abc')),
+            ('[\\da-fA-F]+', '123abc', '0', ascii('123abc')),
+            # Not an error under PCRE/PRE:
+            # ('[\\d-x]', '-', '', regex.error, self.BAD_CHAR_RANGE),
+            (r'([\s]*)([\S]*)([\s]*)', ' testing!1972', '3,2,1', ascii(('',
+              'testing!1972', ' '))),
+            (r'(\s*)(\S*)(\s*)', ' testing!1972', '3,2,1', ascii(('',
+              'testing!1972', ' '))),
+
+            #
+            # Post-1.5.2 additions.
+
+            # xmllib problem.
+            (r'(([a-z]+):)?([a-z]+)$', 'smil', '1,2,3', ascii((None, None,
+              'smil'))),
+            # Bug 110866: reference to undefined group.
+            (r'((.)\1+)', '', '', regex.error, self.OPEN_GROUP),
+            # Bug 111869: search (PRE/PCRE fails on this one, SRE doesn't).
+            (r'.*d', 'abc\nabd', '0', ascii('abd')),
+            # Bug 112468: various expected syntax errors.
+            (r'(', '', '', regex.error, self.MISSING_RPAREN),
+            (r'[\41]', '!', '0', ascii('!')),
+            # Bug 114033: nothing to repeat.
+            (r'(x?)?', 'x', '0', ascii('x')),
+            # Bug 115040: rescan if flags are modified inside pattern.
+            # Changed to positional flags in regex 2023.12.23.
+            (r' (?x)foo ', 'foo', '0', ascii(None)),
+            (r'(?x) foo ', 'foo', '0', ascii('foo')),
+            (r'(?x)foo ', 'foo', '0', ascii('foo')),
+            # Bug 115618: negative lookahead.
+            (r'(?<!abc)(d.f)', 'abcdefdof', '0', ascii('dof')),
+            # Bug 116251: character class bug.
+            (r'[\w-]+', 'laser_beam', '0', ascii('laser_beam')),
+            # Bug 123769+127259: non-greedy backtracking bug.
+            (r'.*?\S *:', 'xx:', '0', ascii('xx:')),
+            (r'a[ ]*?\ (\d+).*', 'a   10', '0', ascii('a   10')),
+            (r'a[ ]*?\ (\d+).*', 'a    10', '0', ascii('a    10')),
+            # Bug 127259: \Z shouldn't depend on multiline mode.
+            (r'(?ms).*?x\s*\Z(.*)','xx\nx\n', '1', ascii('')),
+            # Bug 128899: uppercase literals under the ignorecase flag.
+            (r'(?i)M+', 'MMM', '0', ascii('MMM')),
+            (r'(?i)m+', 'MMM', '0', ascii('MMM')),
+            (r'(?i)[M]+', 'MMM', '0', ascii('MMM')),
+            (r'(?i)[m]+', 'MMM', '0', ascii('MMM')),
+            # Bug 130748: ^* should be an error (nothing to repeat).
+            # In 'regex' we won't bother to complain about this.
+            # (r'^*', '', '', regex.error, self.NOTHING_TO_REPEAT),
+            # Bug 133283: minimizing repeat problem.
+            (r'"(?:\\"|[^"])*?"', r'"\""', '0', ascii(r'"\""')),
+            # Bug 477728: minimizing repeat problem.
+            (r'^.*?$', 'one\ntwo\nthree\n', '', ascii(None)),
+            # Bug 483789: minimizing repeat problem.
+            (r'a[^>]*?b', 'a>b', '', ascii(None)),
+            # Bug 490573: minimizing repeat problem.
+            (r'^a*?$', 'foo', '', ascii(None)),
+            # Bug 470582: nested groups problem.
+            (r'^((a)c)?(ab)$', 'ab', '1,2,3', ascii((None, None, 'ab'))),
+            # Another minimizing repeat problem (capturing groups in assertions).
+            ('^([ab]*?)(?=(b)?)c', 'abc', '1,2', ascii(('ab', None))),
+            ('^([ab]*?)(?!(b))c', 'abc', '1,2', ascii(('ab', None))),
+            ('^([ab]*?)(?<!(a))c', 'abc', '1,2', ascii(('ab', None))),
+            # Bug 410271: \b broken under locales.
+            (r'\b.\b', 'a', '0', ascii('a')),
+            (r'\b.\b', '\N{LATIN CAPITAL LETTER A WITH DIAERESIS}', '0',
+              ascii('\xc4')),
+            (r'\w', '\N{LATIN CAPITAL LETTER A WITH DIAERESIS}', '0',
+              ascii('\xc4')),
+        ]
+
+        for t in tests:
+            excval = None
+            try:
+                if len(t) == 4:
+                    pattern, string, groups, expected = t
+                else:
+                    pattern, string, groups, expected, excval = t
+            except ValueError:
+                fields = ", ".join([ascii(f) for f in t[ : 3]] + ["..."])
+                self.fail("Incorrect number of test fields: ({})".format(fields))
+            else:
+                group_list = []
+                if groups:
+                    for group in groups.split(","):
+                        try:
+                            group_list.append(int(group))
+                        except ValueError:
+                            group_list.append(group)
+
+                if excval is not None:
+                    with self.subTest(pattern=pattern, string=string):
+                        self.assertRaisesRegex(expected, excval, regex.search,
+                          pattern, string)
+                else:
+                    m = regex.search(pattern, string)
+                    if m:
+                        if group_list:
+                            actual = ascii(m.group(*group_list))
+                        else:
+                            actual = ascii(m[:])
+                    else:
+                        actual = ascii(m)
+
+                    self.assertEqual(actual, expected)
+
+    def test_replacement(self):
+        self.assertEqual(regex.sub(r"test\?", "result\\?\\.\a\n", "test?"),
+          "result\\?\\.\a\n")
+
+        self.assertEqual(regex.sub('(.)', r"\1\1", 'x'), 'xx')
+        self.assertEqual(regex.sub('(.)', regex.escape(r"\1\1"), 'x'), r"\1\1")
+        self.assertEqual(regex.sub('(.)', r"\\1\\1", 'x'), r"\1\1")
+        self.assertEqual(regex.sub('(.)', lambda m: r"\1\1", 'x'), r"\1\1")
+
+    def test_common_prefix(self):
+        # Very long common prefix
+        all = string.ascii_lowercase + string.digits + string.ascii_uppercase
+        side = all * 4
+        regexp = '(' + side + '|' + side + ')'
+        self.assertEqual(repr(type(regex.compile(regexp))), self.PATTERN_CLASS)
+
+    def test_captures(self):
+        self.assertEqual(regex.search(r"(\w)+", "abc").captures(1), ['a', 'b',
+          'c'])
+        self.assertEqual(regex.search(r"(\w{3})+", "abcdef").captures(0, 1),
+          (['abcdef'], ['abc', 'def']))
+        self.assertEqual(regex.search(r"^(\d{1,3})(?:\.(\d{1,3})){3}$",
+          "192.168.0.1").captures(1, 2), (['192', ], ['168', '0', '1']))
+        self.assertEqual(regex.match(r"^([0-9A-F]{2}){4} ([a-z]\d){5}$",
+          "3FB52A0C a2c4g3k9d3").captures(1, 2), (['3F', 'B5', '2A', '0C'],
+          ['a2', 'c4', 'g3', 'k9', 'd3']))
+        self.assertEqual(regex.match("([a-z]W)([a-z]X)+([a-z]Y)",
+          "aWbXcXdXeXfY").captures(1, 2, 3), (['aW'], ['bX', 'cX', 'dX', 'eX'],
+          ['fY']))
+
+        self.assertEqual(regex.search(r".*?(?=(.)+)b", "ab").captures(1),
+          ['b'])
+        self.assertEqual(regex.search(r".*?(?>(.){0,2})d", "abcd").captures(1),
+          ['b', 'c'])
+        self.assertEqual(regex.search(r"(.)+", "a").captures(1), ['a'])
+
+    def test_guards(self):
+        m = regex.search(r"(X.*?Y\s*){3}(X\s*)+AB:",
+          "XY\nX Y\nX  Y\nXY\nXX AB:")
+        self.assertEqual(m.span(0, 1, 2), ((3, 21), (12, 15), (16, 18)))
+
+        m = regex.search(r"(X.*?Y\s*){3,}(X\s*)+AB:",
+          "XY\nX Y\nX  Y\nXY\nXX AB:")
+        self.assertEqual(m.span(0, 1, 2), ((0, 21), (12, 15), (16, 18)))
+
+        m = regex.search(r'\d{4}(\s*\w)?\W*((?!\d)\w){2}', "9999XX")
+        self.assertEqual(m.span(0, 1, 2), ((0, 6), (-1, -1), (5, 6)))
+
+        m = regex.search(r'A\s*?.*?(\n+.*?\s*?){0,2}\(X', 'A\n1\nS\n1 (X')
+        self.assertEqual(m.span(0, 1), ((0, 10), (5, 8)))
+
+        m = regex.search(r'Derde\s*:', 'aaaaaa:\nDerde:')
+        self.assertEqual(m.span(), (8, 14))
+        m = regex.search(r'Derde\s*:', 'aaaaa:\nDerde:')
+        self.assertEqual(m.span(), (7, 13))
+
+    def test_turkic(self):
+        # Turkish has dotted and dotless I/i.
+        pairs = "I=i;I=\u0131;i=\u0130"
+
+        all_chars = set()
+        matching = set()
+        for pair in pairs.split(";"):
+            ch1, ch2 = pair.split("=")
+            all_chars.update((ch1, ch2))
+            matching.add((ch1, ch1))
+            matching.add((ch1, ch2))
+            matching.add((ch2, ch1))
+            matching.add((ch2, ch2))
+
+        for ch1 in all_chars:
+            for ch2 in all_chars:
+                m = regex.match(r"(?i)\A" + ch1 + r"\Z", ch2)
+                if m:
+                    if (ch1, ch2) not in matching:
+                        self.fail("{} matching {}".format(ascii(ch1),
+                          ascii(ch2)))
+                else:
+                    if (ch1, ch2) in matching:
+                        self.fail("{} not matching {}".format(ascii(ch1),
+                          ascii(ch2)))
+
+    def test_named_lists(self):
+        options = ["one", "two", "three"]
+        self.assertEqual(regex.match(r"333\L<bar>444", "333one444",
+          bar=options).group(), "333one444")
+        self.assertEqual(regex.match(r"(?i)333\L<bar>444", "333TWO444",
+          bar=options).group(), "333TWO444")
+        self.assertEqual(regex.match(r"333\L<bar>444", "333four444",
+          bar=options), None)
+
+        options = [b"one", b"two", b"three"]
+        self.assertEqual(regex.match(br"333\L<bar>444", b"333one444",
+          bar=options).group(), b"333one444")
+        self.assertEqual(regex.match(br"(?i)333\L<bar>444", b"333TWO444",
+          bar=options).group(), b"333TWO444")
+        self.assertEqual(regex.match(br"333\L<bar>444", b"333four444",
+          bar=options), None)
+
+        self.assertEqual(repr(type(regex.compile(r"3\L<bar>4\L<bar>+5",
+          bar=["one", "two", "three"]))), self.PATTERN_CLASS)
+
+        self.assertEqual(regex.findall(r"^\L<options>", "solid QWERT",
+          options=set(['good', 'brilliant', '+s\\ol[i}d'])), [])
+        self.assertEqual(regex.findall(r"^\L<options>", "+solid QWERT",
+          options=set(['good', 'brilliant', '+solid'])), ['+solid'])
+
+        options = ["STRASSE"]
+        self.assertEqual(regex.match(r"(?fi)\L<words>",
+          "stra\N{LATIN SMALL LETTER SHARP S}e", words=options).span(), (0,
+          6))
+
+        options = ["STRASSE", "stress"]
+        self.assertEqual(regex.match(r"(?fi)\L<words>",
+          "stra\N{LATIN SMALL LETTER SHARP S}e", words=options).span(), (0,
+          6))
+
+        options = ["stra\N{LATIN SMALL LETTER SHARP S}e"]
+        self.assertEqual(regex.match(r"(?fi)\L<words>", "STRASSE",
+          words=options).span(), (0, 7))
+
+        options = ["kit"]
+        self.assertEqual(regex.search(r"(?i)\L<words>", "SKITS",
+          words=options).span(), (1, 4))
+        self.assertEqual(regex.search(r"(?i)\L<words>",
+          "SK\N{LATIN CAPITAL LETTER I WITH DOT ABOVE}TS",
+          words=options).span(), (1, 4))
+
+        self.assertEqual(regex.search(r"(?fi)\b(\w+) +\1\b",
+          " stra\N{LATIN SMALL LETTER SHARP S}e STRASSE ").span(), (1, 15))
+        self.assertEqual(regex.search(r"(?fi)\b(\w+) +\1\b",
+          " STRASSE stra\N{LATIN SMALL LETTER SHARP S}e ").span(), (1, 15))
+
+        self.assertEqual(regex.search(r"^\L<options>$", "", options=[]).span(),
+          (0, 0))
+
+    def test_fuzzy(self):
+        # Some tests borrowed from TRE library tests.
+        self.assertEqual(repr(type(regex.compile('(fou){s,e<=1}'))),
+          self.PATTERN_CLASS)
+        self.assertEqual(repr(type(regex.compile('(fuu){s}'))),
+          self.PATTERN_CLASS)
+        self.assertEqual(repr(type(regex.compile('(fuu){s,e}'))),
+          self.PATTERN_CLASS)
+        self.assertEqual(repr(type(regex.compile('(anaconda){1i+1d<1,s<=1}'))),
+          self.PATTERN_CLASS)
+        self.assertEqual(repr(type(regex.compile('(anaconda){1i+1d<1,s<=1,e<=10}'))),
+          self.PATTERN_CLASS)
+        self.assertEqual(repr(type(regex.compile('(anaconda){s<=1,e<=1,1i+1d<1}'))),
+          self.PATTERN_CLASS)
+
+        text = 'molasses anaconda foo bar baz smith anderson '
+        self.assertEqual(regex.search('(znacnda){s<=1,e<=3,1i+1d<1}', text),
+          None)
+        self.assertEqual(regex.search('(znacnda){s<=1,e<=3,1i+1d<2}',
+          text).span(0, 1), ((9, 17), (9, 17)))
+        self.assertEqual(regex.search('(ananda){1i+1d<2}', text), None)
+        self.assertEqual(regex.search(r"(?:\bznacnda){e<=2}", text)[0],
+          "anaconda")
+        self.assertEqual(regex.search(r"(?:\bnacnda){e<=2}", text)[0],
+          "anaconda")
+
+        text = 'anaconda foo bar baz smith anderson'
+        self.assertEqual(regex.search('(fuu){i<=3,d<=3,e<=5}', text).span(0,
+          1), ((0, 0), (0, 0)))
+        self.assertEqual(regex.search('(?b)(fuu){i<=3,d<=3,e<=5}',
+          text).span(0, 1), ((9, 10), (9, 10)))
+        self.assertEqual(regex.search('(fuu){i<=2,d<=2,e<=5}', text).span(0,
+          1), ((7, 10), (7, 10)))
+        self.assertEqual(regex.search('(?e)(fuu){i<=2,d<=2,e<=5}',
+          text).span(0, 1), ((9, 10), (9, 10)))
+        self.assertEqual(regex.search('(fuu){i<=3,d<=3,e}', text).span(0, 1),
+          ((0, 0), (0, 0)))
+        self.assertEqual(regex.search('(?b)(fuu){i<=3,d<=3,e}', text).span(0,
+          1), ((9, 10), (9, 10)))
+
+        self.assertEqual(repr(type(regex.compile('(approximate){s<=3,1i+1d<3}'))),
+          self.PATTERN_CLASS)
+
+        # No cost limit.
+        self.assertEqual(regex.search('(foobar){e}',
+          'xirefoabralfobarxie').span(0, 1), ((0, 6), (0, 6)))
+        self.assertEqual(regex.search('(?e)(foobar){e}',
+          'xirefoabralfobarxie').span(0, 1), ((0, 3), (0, 3)))
+        self.assertEqual(regex.search('(?b)(foobar){e}',
+          'xirefoabralfobarxie').span(0, 1), ((11, 16), (11, 16)))
+
+        # At most two errors.
+        self.assertEqual(regex.search('(foobar){e<=2}',
+          'xirefoabrzlfd').span(0, 1), ((4, 9), (4, 9)))
+        self.assertEqual(regex.search('(foobar){e<=2}', 'xirefoabzlfd'), None)
+
+        # At most two inserts or substitutions and max two errors total.
+        self.assertEqual(regex.search('(foobar){i<=2,s<=2,e<=2}',
+          'oobargoobaploowap').span(0, 1), ((5, 11), (5, 11)))
+
+        # Find best whole word match for "foobar".
+        self.assertEqual(regex.search('\\b(foobar){e}\\b', 'zfoobarz').span(0,
+          1), ((0, 8), (0, 8)))
+        self.assertEqual(regex.search('\\b(foobar){e}\\b',
+          'boing zfoobarz goobar woop').span(0, 1), ((0, 6), (0, 6)))
+        self.assertEqual(regex.search('(?b)\\b(foobar){e}\\b',
+          'boing zfoobarz goobar woop').span(0, 1), ((15, 21), (15, 21)))
+
+        # Match whole string, allow only 1 error.
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'foobar').span(0, 1),
+          ((0, 6), (0, 6)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'xfoobar').span(0,
+          1), ((0, 7), (0, 7)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'foobarx').span(0,
+          1), ((0, 7), (0, 7)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'fooxbar').span(0,
+          1), ((0, 7), (0, 7)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'foxbar').span(0, 1),
+          ((0, 6), (0, 6)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'xoobar').span(0, 1),
+          ((0, 6), (0, 6)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'foobax').span(0, 1),
+          ((0, 6), (0, 6)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'oobar').span(0, 1),
+          ((0, 5), (0, 5)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'fobar').span(0, 1),
+          ((0, 5), (0, 5)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'fooba').span(0, 1),
+          ((0, 5), (0, 5)))
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'xfoobarx'), None)
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'foobarxx'), None)
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'xxfoobar'), None)
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'xfoxbar'), None)
+        self.assertEqual(regex.search('^(foobar){e<=1}$', 'foxbarx'), None)
+
+        # At most one insert, two deletes, and three substitutions.
+        # Additionally, deletes cost two and substitutes one, and total
+        # cost must be less than 4.
+        self.assertEqual(regex.search('(foobar){i<=1,d<=2,s<=3,2d+1s<4}',
+          '3oifaowefbaoraofuiebofasebfaobfaorfeoaro').span(0, 1), ((6, 13), (6,
+          13)))
+        self.assertEqual(regex.search('(?b)(foobar){i<=1,d<=2,s<=3,2d+1s<4}',
+          '3oifaowefbaoraofuiebofasebfaobfaorfeoaro').span(0, 1), ((34, 39),
+          (34, 39)))
+
+        # Partially fuzzy matches.
+        self.assertEqual(regex.search('foo(bar){e<=1}zap', 'foobarzap').span(0,
+          1), ((0, 9), (3, 6)))
+        self.assertEqual(regex.search('foo(bar){e<=1}zap', 'fobarzap'), None)
+        self.assertEqual(regex.search('foo(bar){e<=1}zap', 'foobrzap').span(0,
+          1), ((0, 8), (3, 5)))
+
+        text = ('www.cnn.com 64.236.16.20\nwww.slashdot.org 66.35.250.150\n'
+          'For useful information, use www.slashdot.org\nthis is demo data!\n')
+        self.assertEqual(regex.search(r'(?s)^.*(dot.org){e}.*$', text).span(0,
+          1), ((0, 120), (120, 120)))
+        self.assertEqual(regex.search(r'(?es)^.*(dot.org){e}.*$', text).span(0,
+          1), ((0, 120), (93, 100)))
+        self.assertEqual(regex.search(r'^.*(dot.org){e}.*$', text).span(0, 1),
+          ((0, 119), (24, 101)))
+
+        # Behaviour is unexpected, but arguably not wrong. It first finds the
+        # best match, then the best in what follows, etc.
+        self.assertEqual(regex.findall(r"\b\L<words>{e<=1}\b",
+          " book cot dog desk ", words="cat dog".split()), ["cot", "dog"])
+        self.assertEqual(regex.findall(r"\b\L<words>{e<=1}\b",
+          " book dog cot desk ", words="cat dog".split()), [" dog", "cot"])
+        self.assertEqual(regex.findall(r"(?e)\b\L<words>{e<=1}\b",
+          " book dog cot desk ", words="cat dog".split()), ["dog", "cot"])
+        self.assertEqual(regex.findall(r"(?r)\b\L<words>{e<=1}\b",
+          " book cot dog desk ", words="cat dog".split()), ["dog ", "cot"])
+        self.assertEqual(regex.findall(r"(?er)\b\L<words>{e<=1}\b",
+          " book cot dog desk ", words="cat dog".split()), ["dog", "cot"])
+        self.assertEqual(regex.findall(r"(?r)\b\L<words>{e<=1}\b",
+          " book dog cot desk ", words="cat dog".split()), ["cot", "dog"])
+        self.assertEqual(regex.findall(br"\b\L<words>{e<=1}\b",
+          b" book cot dog desk ", words=b"cat dog".split()), [b"cot", b"dog"])
+        self.assertEqual(regex.findall(br"\b\L<words>{e<=1}\b",
+          b" book dog cot desk ", words=b"cat dog".split()), [b" dog", b"cot"])
+        self.assertEqual(regex.findall(br"(?e)\b\L<words>{e<=1}\b",
+          b" book dog cot desk ", words=b"cat dog".split()), [b"dog", b"cot"])
+        self.assertEqual(regex.findall(br"(?r)\b\L<words>{e<=1}\b",
+          b" book cot dog desk ", words=b"cat dog".split()), [b"dog ", b"cot"])
+        self.assertEqual(regex.findall(br"(?er)\b\L<words>{e<=1}\b",
+          b" book cot dog desk ", words=b"cat dog".split()), [b"dog", b"cot"])
+        self.assertEqual(regex.findall(br"(?r)\b\L<words>{e<=1}\b",
+          b" book dog cot desk ", words=b"cat dog".split()), [b"cot", b"dog"])
+
+        self.assertEqual(regex.search(r"(\w+) (\1{e<=1})", "foo fou").groups(),
+          ("foo", "fou"))
+        self.assertEqual(regex.search(r"(?r)(\2{e<=1}) (\w+)",
+          "foo fou").groups(), ("foo", "fou"))
+        self.assertEqual(regex.search(br"(\w+) (\1{e<=1})",
+          b"foo fou").groups(), (b"foo", b"fou"))
+
+        self.assertEqual(regex.findall(r"(?:(?:QR)+){e}", "abcde"), ["abcde",
+          ""])
+        self.assertEqual(regex.findall(r"(?:Q+){e}", "abc"), ["abc", ""])
+
+        # Hg issue 41: = for fuzzy matches
+        self.assertEqual(regex.match(r"(?:service detection){0<e<5}",
+          "servic detection").span(), (0, 16))
+        self.assertEqual(regex.match(r"(?:service detection){0<e<5}",
+          "service detect").span(), (0, 14))
+        self.assertEqual(regex.match(r"(?:service detection){0<e<5}",
+          "service detecti").span(), (0, 15))
+        self.assertEqual(regex.match(r"(?:service detection){0<e<5}",
+          "service detection"), None)
+        self.assertEqual(regex.match(r"(?:service detection){0<e<5}",
+          "in service detection").span(), (0, 20))
+
+        # Hg issue 109: Edit distance of fuzzy match
+        self.assertEqual(regex.fullmatch(r"(?:cats|cat){e<=1}",
+          "cat").fuzzy_counts, (0, 0, 1))
+        self.assertEqual(regex.fullmatch(r"(?e)(?:cats|cat){e<=1}",
+          "cat").fuzzy_counts, (0, 0, 0))
+
+        self.assertEqual(regex.fullmatch(r"(?:cat|cats){e<=1}",
+          "cats").fuzzy_counts, (0, 1, 0))
+        self.assertEqual(regex.fullmatch(r"(?e)(?:cat|cats){e<=1}",
+          "cats").fuzzy_counts, (0, 0, 0))
+
+        self.assertEqual(regex.fullmatch(r"(?:cat){e<=1} (?:cat){e<=1}",
+          "cat cot").fuzzy_counts, (1, 0, 0))
+
+        # Incorrect fuzzy changes
+        self.assertEqual(regex.search(r"(?e)(GTTTTCATTCCTCATA){i<=4,d<=4,s<=4,i+d+s<=8}",
+          "ATTATTTATTTTTCATA").fuzzy_changes, ([0, 6, 10, 11], [3], []))
+
+        # Fuzzy constraints ignored when checking for prefix/suffix in branches
+        self.assertEqual(bool(regex.match('(?:fo){e<=1}|(?:fo){e<=2}', 'FO')),
+          True)
+
+    def test_recursive(self):
+        self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "xx")[ : ],
+          ("xx", "x", ""))
+        self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "aba")[ : ],
+          ("aba", "a", "b"))
+        self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "abba")[ : ],
+          ("abba", "a", None))
+        self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "kayak")[ : ],
+          ("kayak", "k", None))
+        self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "paper")[ : ],
+          ("pap", "p", "a"))
+        self.assertEqual(regex.search(r"(\w)(?:(?R)|(\w?))\1", "dontmatchme"),
+          None)
+
+        self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "xx")[ : ],
+          ("xx", "", "x"))
+        self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "aba")[ : ],
+          ("aba", "b", "a"))
+        self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "abba")[ :
+          ], ("abba", None, "a"))
+        self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "kayak")[ :
+          ], ("kayak", None, "k"))
+        self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)", "paper")[ :
+          ], ("pap", "a", "p"))
+        self.assertEqual(regex.search(r"(?r)\2(?:(\w?)|(?R))(\w)",
+          "dontmatchme"), None)
+
+        self.assertEqual(regex.search(r"\(((?>[^()]+)|(?R))*\)", "(ab(cd)ef)")[
+          : ], ("(ab(cd)ef)", "ef"))
+        self.assertEqual(regex.search(r"\(((?>[^()]+)|(?R))*\)",
+          "(ab(cd)ef)").captures(1), ["ab", "cd", "(cd)", "ef"])
+
+        self.assertEqual(regex.search(r"(?r)\(((?R)|(?>[^()]+))*\)",
+          "(ab(cd)ef)")[ : ], ("(ab(cd)ef)", "ab"))
+        self.assertEqual(regex.search(r"(?r)\(((?R)|(?>[^()]+))*\)",
+          "(ab(cd)ef)").captures(1), ["ef", "cd", "(cd)", "ab"])
+
+        self.assertEqual(regex.search(r"\(([^()]+|(?R))*\)",
+          "some text (a(b(c)d)e) more text")[ : ], ("(a(b(c)d)e)", "e"))
+
+        self.assertEqual(regex.search(r"(?r)\(((?R)|[^()]+)*\)",
+          "some text (a(b(c)d)e) more text")[ : ], ("(a(b(c)d)e)", "a"))
+
+        self.assertEqual(regex.search(r"(foo(\(((?:(?>[^()]+)|(?2))*)\)))",
+          "foo(bar(baz)+baz(bop))")[ : ], ("foo(bar(baz)+baz(bop))",
+          "foo(bar(baz)+baz(bop))", "(bar(baz)+baz(bop))",
+          "bar(baz)+baz(bop)"))
+
+        self.assertEqual(regex.search(r"(?r)(foo(\(((?:(?2)|(?>[^()]+))*)\)))",
+          "foo(bar(baz)+baz(bop))")[ : ], ("foo(bar(baz)+baz(bop))",
+          "foo(bar(baz)+baz(bop))", "(bar(baz)+baz(bop))",
+          "bar(baz)+baz(bop)"))
+
+        rgx = regex.compile(r"""^\s*(<\s*([a-zA-Z:]+)(?:\s*[a-zA-Z:]*\s*=\s*(?:'[^']*'|"[^"]*"))*\s*(/\s*)?>(?:[^<>]*|(?1))*(?(3)|<\s*/\s*\2\s*>))\s*$""")
+        self.assertEqual(bool(rgx.search('<foo><bar></bar></foo>')), True)
+        self.assertEqual(bool(rgx.search('<foo><bar></foo></bar>')), False)
+        self.assertEqual(bool(rgx.search('<foo><bar/></foo>')), True)
+        self.assertEqual(bool(rgx.search('<foo><bar></foo>')), False)
+        self.assertEqual(bool(rgx.search('<foo bar=baz/>')), False)
+
+        self.assertEqual(bool(rgx.search('<foo bar="baz">')), False)
+        self.assertEqual(bool(rgx.search('<foo bar="baz"/>')), True)
+        self.assertEqual(bool(rgx.search('<    fooo   /  >')), True)
+        # The next regex should and does match. Perl 5.14 agrees.
+        #self.assertEqual(bool(rgx.search('<foo/>foo')), False)
+        self.assertEqual(bool(rgx.search('foo<foo/>')), False)
+
+        self.assertEqual(bool(rgx.search('<foo>foo</foo>')), True)
+        self.assertEqual(bool(rgx.search('<foo><bar/>foo</foo>')), True)
+        self.assertEqual(bool(rgx.search('<a><b><c></c></b></a>')), True)
+
+    def test_copy(self):
+        # PatternObjects are immutable, therefore there's no need to clone them.
+        r = regex.compile("a")
+        self.assertTrue(copy.copy(r) is r)
+        self.assertTrue(copy.deepcopy(r) is r)
+
+        # MatchObjects are normally mutable because the target string can be
+        # detached. However, after the target string has been detached, a
+        # MatchObject becomes immutable, so there's no need to clone it.
+        m = r.match("a")
+        self.assertTrue(copy.copy(m) is not m)
+        self.assertTrue(copy.deepcopy(m) is not m)
+
+        self.assertTrue(m.string is not None)
+        m2 = copy.copy(m)
+        m2.detach_string()
+        self.assertTrue(m.string is not None)
+        self.assertTrue(m2.string is None)
+
+        # The following behaviour matches that of the re module.
+        it = regex.finditer(".", "ab")
+        it2 = copy.copy(it)
+        self.assertEqual(next(it).group(), "a")
+        self.assertEqual(next(it2).group(), "b")
+
+        # The following behaviour matches that of the re module.
+        it = regex.finditer(".", "ab")
+        it2 = copy.deepcopy(it)
+        self.assertEqual(next(it).group(), "a")
+        self.assertEqual(next(it2).group(), "b")
+
+        # The following behaviour is designed to match that of copying 'finditer'.
+        it = regex.splititer(" ", "a b")
+        it2 = copy.copy(it)
+        self.assertEqual(next(it), "a")
+        self.assertEqual(next(it2), "b")
+
+        # The following behaviour is designed to match that of copying 'finditer'.
+        it = regex.splititer(" ", "a b")
+        it2 = copy.deepcopy(it)
+        self.assertEqual(next(it), "a")
+        self.assertEqual(next(it2), "b")
+
+    def test_format(self):
+        self.assertEqual(regex.subf(r"(\w+) (\w+)", "{0} => {2} {1}",
+          "foo bar"), "foo bar => bar foo")
+        self.assertEqual(regex.subf(r"(?<word1>\w+) (?<word2>\w+)",
+          "{word2} {word1}", "foo bar"), "bar foo")
+
+        self.assertEqual(regex.subfn(r"(\w+) (\w+)", "{0} => {2} {1}",
+          "foo bar"), ("foo bar => bar foo", 1))
+        self.assertEqual(regex.subfn(r"(?<word1>\w+) (?<word2>\w+)",
+          "{word2} {word1}", "foo bar"), ("bar foo", 1))
+
+        self.assertEqual(regex.match(r"(\w+) (\w+)",
+          "foo bar").expandf("{0} => {2} {1}"), "foo bar => bar foo")
+
+    def test_fullmatch(self):
+        self.assertEqual(bool(regex.fullmatch(r"abc", "abc")), True)
+        self.assertEqual(bool(regex.fullmatch(r"abc", "abcx")), False)
+        self.assertEqual(bool(regex.fullmatch(r"abc", "abcx", endpos=3)), True)
+
+        self.assertEqual(bool(regex.fullmatch(r"abc", "xabc", pos=1)), True)
+        self.assertEqual(bool(regex.fullmatch(r"abc", "xabcy", pos=1)), False)
+        self.assertEqual(bool(regex.fullmatch(r"abc", "xabcy", pos=1,
+          endpos=4)), True)
+
+        self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "abc")), True)
+        self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "abcx")), False)
+        self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "abcx", endpos=3)),
+          True)
+
+        self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "xabc", pos=1)),
+          True)
+        self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "xabcy", pos=1)),
+          False)
+        self.assertEqual(bool(regex.fullmatch(r"(?r)abc", "xabcy", pos=1,
+          endpos=4)), True)
+
+    def test_issue_18468(self):
+        self.assertTypedEqual(regex.sub('y', 'a', 'xyz'), 'xaz')
+        self.assertTypedEqual(regex.sub('y', StrSubclass('a'),
+          StrSubclass('xyz')), 'xaz')
+        self.assertTypedEqual(regex.sub(b'y', b'a', b'xyz'), b'xaz')
+        self.assertTypedEqual(regex.sub(b'y', BytesSubclass(b'a'),
+          BytesSubclass(b'xyz')), b'xaz')
+        self.assertTypedEqual(regex.sub(b'y', bytearray(b'a'),
+          bytearray(b'xyz')), b'xaz')
+        self.assertTypedEqual(regex.sub(b'y', memoryview(b'a'),
+          memoryview(b'xyz')), b'xaz')
+
+        for string in ":a:b::c", StrSubclass(":a:b::c"):
+            self.assertTypedEqual(regex.split(":", string), ['', 'a', 'b', '',
+              'c'])
+            if sys.version_info >= (3, 7, 0):
+                self.assertTypedEqual(regex.split(":*", string), ['', '', 'a',
+                  '', 'b', '', 'c', ''])
+                self.assertTypedEqual(regex.split("(:*)", string), ['', ':',
+                  '', '', 'a', ':', '', '', 'b', '::', '', '', 'c', '', ''])
+            else:
+                self.assertTypedEqual(regex.split(":*", string), ['', 'a', 'b',
+                  'c'])
+                self.assertTypedEqual(regex.split("(:*)", string), ['', ':',
+                  'a', ':', 'b', '::', 'c'])
+
+        for string in (b":a:b::c", BytesSubclass(b":a:b::c"),
+          bytearray(b":a:b::c"), memoryview(b":a:b::c")):
+            self.assertTypedEqual(regex.split(b":", string), [b'', b'a', b'b',
+              b'', b'c'])
+            if sys.version_info >= (3, 7, 0):
+                self.assertTypedEqual(regex.split(b":*", string), [b'', b'',
+                  b'a', b'', b'b', b'', b'c', b''])
+                self.assertTypedEqual(regex.split(b"(:*)", string), [b'', b':',
+                  b'', b'', b'a', b':', b'', b'', b'b', b'::', b'', b'', b'c',
+                  b'', b''])
+            else:
+                self.assertTypedEqual(regex.split(b":*", string), [b'', b'a',
+                  b'b', b'c'])
+                self.assertTypedEqual(regex.split(b"(:*)", string), [b'', b':',
+                  b'a', b':', b'b', b'::', b'c'])
+
+        for string in "a:b::c:::d", StrSubclass("a:b::c:::d"):
+            self.assertTypedEqual(regex.findall(":+", string), [":", "::",
+              ":::"])
+            self.assertTypedEqual(regex.findall("(:+)", string), [":", "::",
+              ":::"])
+            self.assertTypedEqual(regex.findall("(:)(:*)", string), [(":", ""),
+              (":", ":"), (":", "::")])
+
+        for string in (b"a:b::c:::d", BytesSubclass(b"a:b::c:::d"),
+          bytearray(b"a:b::c:::d"), memoryview(b"a:b::c:::d")):
+            self.assertTypedEqual(regex.findall(b":+", string), [b":", b"::",
+              b":::"])
+            self.assertTypedEqual(regex.findall(b"(:+)", string), [b":", b"::",
+              b":::"])
+            self.assertTypedEqual(regex.findall(b"(:)(:*)", string), [(b":",
+              b""), (b":", b":"), (b":", b"::")])
+
+        for string in 'a', StrSubclass('a'):
+            self.assertEqual(regex.match('a', string).groups(), ())
+            self.assertEqual(regex.match('(a)', string).groups(), ('a',))
+            self.assertEqual(regex.match('(a)', string).group(0), 'a')
+            self.assertEqual(regex.match('(a)', string).group(1), 'a')
+            self.assertEqual(regex.match('(a)', string).group(1, 1), ('a',
+              'a'))
+
+        for string in (b'a', BytesSubclass(b'a'), bytearray(b'a'),
+          memoryview(b'a')):
+            self.assertEqual(regex.match(b'a', string).groups(), ())
+            self.assertEqual(regex.match(b'(a)', string).groups(), (b'a',))
+            self.assertEqual(regex.match(b'(a)', string).group(0), b'a')
+            self.assertEqual(regex.match(b'(a)', string).group(1), b'a')
+            self.assertEqual(regex.match(b'(a)', string).group(1, 1), (b'a',
+              b'a'))
+
+    def test_partial(self):
+        self.assertEqual(regex.match('ab', 'a', partial=True).partial, True)
+        self.assertEqual(regex.match('ab', 'a', partial=True).span(), (0, 1))
+        self.assertEqual(regex.match(r'cats', 'cat', partial=True).partial,
+          True)
+        self.assertEqual(regex.match(r'cats', 'cat', partial=True).span(), (0,
+          3))
+        self.assertEqual(regex.match(r'cats', 'catch', partial=True), None)
+        self.assertEqual(regex.match(r'abc\w{3}', 'abcdef',
+          partial=True).partial, False)
+        self.assertEqual(regex.match(r'abc\w{3}', 'abcdef',
+          partial=True).span(), (0, 6))
+        self.assertEqual(regex.match(r'abc\w{3}', 'abcde',
+          partial=True).partial, True)
+        self.assertEqual(regex.match(r'abc\w{3}', 'abcde',
+          partial=True).span(), (0, 5))
+
+        self.assertEqual(regex.match(r'\d{4}$', '1234', partial=True).partial,
+          False)
+
+        self.assertEqual(regex.match(r'\L<words>', 'post', partial=True,
+          words=['post']).partial, False)
+        self.assertEqual(regex.match(r'\L<words>', 'post', partial=True,
+          words=['post']).span(), (0, 4))
+        self.assertEqual(regex.match(r'\L<words>', 'pos', partial=True,
+          words=['post']).partial, True)
+        self.assertEqual(regex.match(r'\L<words>', 'pos', partial=True,
+          words=['post']).span(), (0, 3))
+
+        self.assertEqual(regex.match(r'(?fi)\L<words>', 'POST', partial=True,
+          words=['po\uFB06']).partial, False)
+        self.assertEqual(regex.match(r'(?fi)\L<words>', 'POST', partial=True,
+          words=['po\uFB06']).span(), (0, 4))
+        self.assertEqual(regex.match(r'(?fi)\L<words>', 'POS', partial=True,
+          words=['po\uFB06']).partial, True)
+        self.assertEqual(regex.match(r'(?fi)\L<words>', 'POS', partial=True,
+          words=['po\uFB06']).span(), (0, 3))
+        self.assertEqual(regex.match(r'(?fi)\L<words>', 'po\uFB06',
+          partial=True, words=['POS']), None)
+
+        self.assertEqual(regex.match(r'[a-z]*4R$', 'a', partial=True).span(),
+          (0, 1))
+        self.assertEqual(regex.match(r'[a-z]*4R$', 'ab', partial=True).span(),
+          (0, 2))
+        self.assertEqual(regex.match(r'[a-z]*4R$', 'ab4', partial=True).span(),
+          (0, 3))
+        self.assertEqual(regex.match(r'[a-z]*4R$', 'a4', partial=True).span(),
+          (0, 2))
+        self.assertEqual(regex.match(r'[a-z]*4R$', 'a4R', partial=True).span(),
+          (0, 3))
+        self.assertEqual(regex.match(r'[a-z]*4R$', '4a', partial=True), None)
+        self.assertEqual(regex.match(r'[a-z]*4R$', 'a44', partial=True), None)
+
+    def test_hg_bugs(self):
+        # Hg issue 28: regex.compile("(?>b)") causes "TypeError: 'Character'
+        # object is not subscriptable"
+        self.assertEqual(bool(regex.compile("(?>b)", flags=regex.V1)), True)
+
+        # Hg issue 29: regex.compile("^((?>\w+)|(?>\s+))*$") causes
+        # "TypeError: 'GreedyRepeat' object is not iterable"
+        self.assertEqual(bool(regex.compile(r"^((?>\w+)|(?>\s+))*$",
+          flags=regex.V1)), True)
+
+        # Hg issue 31: atomic and normal groups in recursive patterns
+        self.assertEqual(regex.findall(r"\((?:(?>[^()]+)|(?R))*\)",
+          "a(bcd(e)f)g(h)"), ['(bcd(e)f)', '(h)'])
+        self.assertEqual(regex.findall(r"\((?:(?:[^()]+)|(?R))*\)",
+          "a(bcd(e)f)g(h)"), ['(bcd(e)f)', '(h)'])
+        self.assertEqual(regex.findall(r"\((?:(?>[^()]+)|(?R))*\)",
+          "a(b(cd)e)f)g)h"), ['(b(cd)e)'])
+        self.assertEqual(regex.findall(r"\((?:(?>[^()]+)|(?R))*\)",
+          "a(bc(d(e)f)gh"), ['(d(e)f)'])
+        self.assertEqual(regex.findall(r"(?r)\((?:(?>[^()]+)|(?R))*\)",
+          "a(bc(d(e)f)gh"), ['(d(e)f)'])
+        self.assertEqual([m.group() for m in
+          regex.finditer(r"\((?:[^()]*+|(?0))*\)", "a(b(c(de)fg)h")],
+          ['(c(de)fg)'])
+
+        # Hg issue 32: regex.search("a(bc)d", "abcd", regex.I|regex.V1) returns
+        # None
+        self.assertEqual(regex.search("a(bc)d", "abcd", regex.I |
+          regex.V1).group(0), "abcd")
+
+        # Hg issue 33: regex.search("([\da-f:]+)$", "E", regex.I|regex.V1)
+        # returns None
+        self.assertEqual(regex.search(r"([\da-f:]+)$", "E", regex.I |
+          regex.V1).group(0), "E")
+        self.assertEqual(regex.search(r"([\da-f:]+)$", "e", regex.I |
+          regex.V1).group(0), "e")
+
+        # Hg issue 34: regex.search("^(?=ab(de))(abd)(e)", "abde").groups()
+        # returns (None, 'abd', 'e') instead of ('de', 'abd', 'e')
+        self.assertEqual(regex.search("^(?=ab(de))(abd)(e)", "abde").groups(),
+          ('de', 'abd', 'e'))
+
+        # Hg issue 35: regex.compile("\ ", regex.X) causes "_regex_core.error:
+        # bad escape"
+        self.assertEqual(bool(regex.match(r"\ ", " ", flags=regex.X)), True)
+
+        # Hg issue 36: regex.search("^(a|)\1{2}b", "b") returns None
+        self.assertEqual(regex.search(r"^(a|)\1{2}b", "b").group(0, 1), ('b',
+          ''))
+
+        # Hg issue 37: regex.search("^(a){0,0}", "abc").group(0,1) returns
+        # ('a', 'a') instead of ('', None)
+        self.assertEqual(regex.search("^(a){0,0}", "abc").group(0, 1), ('',
+          None))
+
+        # Hg issue 38: regex.search("(?>.*/)b", "a/b") returns None
+        self.assertEqual(regex.search("(?>.*/)b", "a/b").group(0), "a/b")
+
+        # Hg issue 39: regex.search("((?i)blah)\\s+\\1", "blah BLAH") doesn't
+        # return None
+        # Changed to positional flags in regex 2023.12.23.
+        self.assertEqual(regex.search(r"((?i)blah)\s+\1", "blah BLAH"), None)
+
+        # Hg issue 40: regex.search("(\()?[^()]+(?(1)\)|)", "(abcd").group(0)
+        # returns "bcd" instead of "abcd"
+        self.assertEqual(regex.search(r"(\()?[^()]+(?(1)\)|)",
+          "(abcd").group(0), "abcd")
+
+        # Hg issue 42: regex.search("(a*)*", "a", flags=regex.V1).span(1)
+        # returns (0, 1) instead of (1, 1)
+        self.assertEqual(regex.search("(a*)*", "a").span(1), (1, 1))
+        self.assertEqual(regex.search("(a*)*", "aa").span(1), (2, 2))
+        self.assertEqual(regex.search("(a*)*", "aaa").span(1), (3, 3))
+
+        # Hg issue 43: regex.compile("a(?#xxx)*") causes "_regex_core.error:
+        # nothing to repeat"
+        self.assertEqual(regex.search("a(?#xxx)*", "aaa").group(), "aaa")
+
+        # Hg issue 44: regex.compile("(?=abc){3}abc") causes
+        # "_regex_core.error: nothing to repeat"
+        self.assertEqual(regex.search("(?=abc){3}abc", "abcabcabc").span(), (0,
+          3))
+
+        # Hg issue 45: regex.compile("^(?:a(?:(?:))+)+") causes
+        # "_regex_core.error: nothing to repeat"
+        self.assertEqual(regex.search("^(?:a(?:(?:))+)+", "a").span(), (0, 1))
+        self.assertEqual(regex.search("^(?:a(?:(?:))+)+", "aa").span(), (0, 2))
+
+        # Hg issue 46: regex.compile("a(?x: b c )d") causes
+        # "_regex_core.error: missing )"
+        self.assertEqual(regex.search("a(?x: b c )d", "abcd").group(0), "abcd")
+
+        # Hg issue 47: regex.compile("a#comment\n*", flags=regex.X) causes
+        # "_regex_core.error: nothing to repeat"
+        self.assertEqual(regex.search("a#comment\n*", "aaa",
+          flags=regex.X).group(0), "aaa")
+
+        # Hg issue 48: regex.search("(a(?(1)\\1)){4}", "a"*10,
+        # flags=regex.V1).group(0,1) returns ('aaaaa', 'a') instead of ('aaaaaaaaaa', 'aaaa')
+        self.assertEqual(regex.search(r"(?V1)(a(?(1)\1)){1}",
+          "aaaaaaaaaa").span(0, 1), ((0, 1), (0, 1)))
+        self.assertEqual(regex.search(r"(?V1)(a(?(1)\1)){2}",
+          "aaaaaaaaaa").span(0, 1), ((0, 3), (1, 3)))
+        self.assertEqual(regex.search(r"(?V1)(a(?(1)\1)){3}",
+          "aaaaaaaaaa").span(0, 1), ((0, 6), (3, 6)))
+        self.assertEqual(regex.search(r"(?V1)(a(?(1)\1)){4}",
+          "aaaaaaaaaa").span(0, 1), ((0, 10), (6, 10)))
+
+        # Hg issue 49: regex.search("(a)(?<=b(?1))", "baz", regex.V1) returns
+        # None incorrectly
+        self.assertEqual(regex.search("(?V1)(a)(?<=b(?1))", "baz").group(0),
+          "a")
+
+        # Hg issue 50: not all keywords are found by named list with
+        # overlapping keywords when full Unicode casefolding is required
+        self.assertEqual(regex.findall(r'(?fi)\L<keywords>',
+          'POST, Post, post, po\u017Ft, po\uFB06, and po\uFB05',
+          keywords=['post','pos']), ['POST', 'Post', 'post', 'po\u017Ft',
+          'po\uFB06', 'po\uFB05'])
+        self.assertEqual(regex.findall(r'(?fi)pos|post',
+          'POST, Post, post, po\u017Ft, po\uFB06, and po\uFB05'), ['POS',
+          'Pos', 'pos', 'po\u017F', 'po\uFB06', 'po\uFB05'])
+        self.assertEqual(regex.findall(r'(?fi)post|pos',
+          'POST, Post, post, po\u017Ft, po\uFB06, and po\uFB05'), ['POST',
+          'Post', 'post', 'po\u017Ft', 'po\uFB06', 'po\uFB05'])
+        self.assertEqual(regex.findall(r'(?fi)post|another',
+          'POST, Post, post, po\u017Ft, po\uFB06, and po\uFB05'), ['POST',
+          'Post', 'post', 'po\u017Ft', 'po\uFB06', 'po\uFB05'])
+
+        # Hg issue 51: regex.search("((a)(?1)|(?2))", "a", flags=regex.V1)
+        # returns None incorrectly
+        self.assertEqual(regex.search("(?V1)((a)(?1)|(?2))", "a").group(0, 1,
+          2), ('a', 'a', None))
+
+        # Hg issue 52: regex.search("(\\1xx|){6}", "xx",
+        # flags=regex.V1).span(0,1) returns incorrect value
+        self.assertEqual(regex.search(r"(?V1)(\1xx|){6}", "xx").span(0, 1),
+          ((0, 2), (2, 2)))
+
+        # Hg issue 53: regex.search("(a|)+", "a") causes MemoryError
+        self.assertEqual(regex.search("(a|)+", "a").group(0, 1), ("a", ""))
+
+        # Hg issue 54: regex.search("(a|)*\\d", "a"*80) causes MemoryError
+        self.assertEqual(regex.search(r"(a|)*\d", "a" * 80), None)
+
+        # Hg issue 55: regex.search("^(?:a?b?)*$", "ac") take a very long time.
+        self.assertEqual(regex.search("^(?:a?b?)*$", "ac"), None)
+
+        # Hg issue 58: bad named character escape sequences like "\\N{1}"
+        # treats as "N"
+        self.assertRaisesRegex(regex.error, self.UNDEF_CHAR_NAME, lambda:
+          regex.compile("\\N{1}"))
+
+        # Hg issue 59: regex.search("\\Z", "a\na\n") returns None incorrectly
+        self.assertEqual(regex.search("\\Z", "a\na\n").span(0), (4, 4))
+
+        # Hg issue 60: regex.search("(q1|.)*(q2|.)*(x(a|bc)*y){2,}", "xayxay")
+        # returns None incorrectly
+        self.assertEqual(regex.search("(q1|.)*(q2|.)*(x(a|bc)*y){2,}",
+          "xayxay").group(0), "xayxay")
+
+        # Hg issue 61: regex.search("[^a]", "A", regex.I).group(0) returns ''
+        # incorrectly
+        self.assertEqual(regex.search("(?i)[^a]", "A"), None)
+
+        # Hg issue 63: regex.search("[[:ascii:]]", "\N{KELVIN SIGN}",
+        # flags=regex.I|regex.V1) doesn't return None
+        self.assertEqual(regex.search("(?i)[[:ascii:]]", "\N{KELVIN SIGN}"),
+          None)
+
+        # Hg issue 66: regex.search("((a|b(?1)c){3,5})", "baaaaca",
+        # flags=regex.V1).groups() returns ('baaaac', 'baaaac') instead of ('aaaa', 'a')
+        self.assertEqual(regex.search("((a|b(?1)c){3,5})", "baaaaca").group(0,
+          1, 2), ('aaaa', 'aaaa', 'a'))
+
+        # Hg issue 71: non-greedy quantifier in lookbehind
+        self.assertEqual(regex.findall(r"(?<=:\S+ )\w+", ":9 abc :10 def"),
+          ['abc', 'def'])
+        self.assertEqual(regex.findall(r"(?<=:\S* )\w+", ":9 abc :10 def"),
+          ['abc', 'def'])
+        self.assertEqual(regex.findall(r"(?<=:\S+? )\w+", ":9 abc :10 def"),
+          ['abc', 'def'])
+        self.assertEqual(regex.findall(r"(?<=:\S*? )\w+", ":9 abc :10 def"),
+          ['abc', 'def'])
+
+        # Hg issue 73: conditional patterns
+        self.assertEqual(regex.search(r"(?:fe)?male", "female").group(),
+          "female")
+        self.assertEqual([m.group() for m in
+          regex.finditer(r"(fe)?male: h(?(1)(er)|(is)) (\w+)",
+          "female: her dog; male: his cat. asdsasda")], ['female: her dog',
+          'male: his cat'])
+
+        # Hg issue 78: "Captures" doesn't work for recursive calls
+        self.assertEqual(regex.search(r'(?<rec>\((?:[^()]++|(?&rec))*\))',
+          'aaa(((1+0)+1)+1)bbb').captures('rec'), ['(1+0)', '((1+0)+1)',
+          '(((1+0)+1)+1)'])
+
+        # Hg issue 80: Escape characters throws an exception
+        self.assertRaisesRegex(regex.error, self.BAD_ESCAPE, lambda:
+          regex.sub('x', '\\', 'x'), )
+
+        # Hg issue 82: error range does not work
+        fz = "(CAGCCTCCCATTTCAGAATATACATCC){1<e<=2}"
+        seq = "tcagacgagtgcgttgtaaaacgacggccagtCAGCCTCCCATTCAGAATATACATCCcgacggccagttaaaaacaatgccaaggaggtcatagctgtttcctgccagttaaaaacaatgccaaggaggtcatagctgtttcctgacgcactcgtctgagcgggctggcaagg"
+        self.assertEqual(regex.search(fz, seq, regex.BESTMATCH)[0],
+          "tCAGCCTCCCATTCAGAATATACATCC")
+
+        # Hg issue 83: slash handling in presence of a quantifier
+        self.assertEqual(regex.findall(r"c..+/c", "cA/c\ncAb/c"), ['cAb/c'])
+
+        # Hg issue 85: Non-conformance to Unicode UAX#29 re: ZWJ / ZWNJ
+        self.assertEqual(ascii(regex.sub(r"(\w+)", r"[\1]",
+          '\u0905\u0928\u094d\u200d\u0928 \u0d28\u0d4d\u200d \u0915\u093f\u0928',
+          regex.WORD)),
+          ascii('[\u0905\u0928\u094d\u200d\u0928] [\u0d28\u0d4d\u200d] [\u0915\u093f\u0928]'))
+
+        # Hg issue 88: regex.match() hangs
+        self.assertEqual(regex.match(r".*a.*ba.*aa", "ababba"), None)
+
+        # Hg issue 87: Allow duplicate names of groups
+        self.assertEqual(regex.match(r'(?<x>a(?<x>b))', "ab").spans("x"), [(1,
+          2), (0, 2)])
+
+        # Hg issue 91: match.expand is extremely slow
+        # Check that the replacement cache works.
+        self.assertEqual(regex.sub(r'(-)', lambda m: m.expand(r'x'), 'a-b-c'),
+          'axbxc')
+
+        # Hg issue 94: Python crashes when executing regex updates
+        # pattern.findall
+        rx = regex.compile(r'\bt(est){i<2}', flags=regex.V1)
+        self.assertEqual(rx.search("Some text"), None)
+        self.assertEqual(rx.findall("Some text"), [])
+
+        # Hg issue 95: 'pos' for regex.error
+        self.assertRaisesRegex(regex.error, self.MULTIPLE_REPEAT, lambda:
+          regex.compile(r'.???'))
+
+        # Hg issue 97: behaviour of regex.escape's special_only is wrong
+        #
+        # Hg issue 244: Make `special_only=True` the default in
+        # `regex.escape()`
+        self.assertEqual(regex.escape('foo!?', special_only=False), 'foo\\!\\?')
+        self.assertEqual(regex.escape('foo!?', special_only=True), 'foo!\\?')
+        self.assertEqual(regex.escape('foo!?'), 'foo!\\?')
+
+        self.assertEqual(regex.escape(b'foo!?', special_only=False), b'foo\\!\\?')
+        self.assertEqual(regex.escape(b'foo!?', special_only=True),
+          b'foo!\\?')
+        self.assertEqual(regex.escape(b'foo!?'), b'foo!\\?')
+
+        # Hg issue 100: strange results from regex.search
+        self.assertEqual(regex.search('^([^z]*(?:WWWi|W))?$',
+          'WWWi').groups(), ('WWWi', ))
+        self.assertEqual(regex.search('^([^z]*(?:WWWi|w))?$',
+          'WWWi').groups(), ('WWWi', ))
+        self.assertEqual(regex.search('^([^z]*?(?:WWWi|W))?$',
+          'WWWi').groups(), ('WWWi', ))
+
+        # Hg issue 101: findall() broken (seems like memory corruption)
+        pat = regex.compile(r'xxx', flags=regex.FULLCASE | regex.UNICODE)
+        self.assertEqual([x.group() for x in pat.finditer('yxxx')], ['xxx'])
+        self.assertEqual(pat.findall('yxxx'), ['xxx'])
+
+        raw = 'yxxx'
+        self.assertEqual([x.group() for x in pat.finditer(raw)], ['xxx'])
+        self.assertEqual(pat.findall(raw), ['xxx'])
+
+        pat = regex.compile(r'xxx', flags=regex.FULLCASE | regex.IGNORECASE |
+          regex.UNICODE)
+        self.assertEqual([x.group() for x in pat.finditer('yxxx')], ['xxx'])
+        self.assertEqual(pat.findall('yxxx'), ['xxx'])
+
+        raw = 'yxxx'
+        self.assertEqual([x.group() for x in pat.finditer(raw)], ['xxx'])
+        self.assertEqual(pat.findall(raw), ['xxx'])
+
+        # Hg issue 106: * operator not working correctly with sub()
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.sub('(?V0).*', 'x', 'test'), 'xx')
+        else:
+            self.assertEqual(regex.sub('(?V0).*', 'x', 'test'), 'x')
+        self.assertEqual(regex.sub('(?V1).*', 'x', 'test'), 'xx')
+
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.sub('(?V0).*?', '|', 'test'), '|||||||||')
+        else:
+            self.assertEqual(regex.sub('(?V0).*?', '|', 'test'), '|t|e|s|t|')
+        self.assertEqual(regex.sub('(?V1).*?', '|', 'test'), '|||||||||')
+
+        # Hg issue 112: re: OK, but regex: SystemError
+        self.assertEqual(regex.sub(r'^(@)\n(?!.*?@)(.*)',
+          r'\1\n==========\n\2', '@\n', flags=regex.DOTALL), '@\n==========\n')
+
+        # Hg issue 109: Edit distance of fuzzy match
+        self.assertEqual(regex.match(r'(?:cats|cat){e<=1}',
+         'caz').fuzzy_counts, (1, 0, 0))
+        self.assertEqual(regex.match(r'(?e)(?:cats|cat){e<=1}',
+          'caz').fuzzy_counts, (1, 0, 0))
+        self.assertEqual(regex.match(r'(?b)(?:cats|cat){e<=1}',
+          'caz').fuzzy_counts, (1, 0, 0))
+
+        self.assertEqual(regex.match(r'(?:cat){e<=1}', 'caz').fuzzy_counts,
+          (1, 0, 0))
+        self.assertEqual(regex.match(r'(?e)(?:cat){e<=1}',
+          'caz').fuzzy_counts, (1, 0, 0))
+        self.assertEqual(regex.match(r'(?b)(?:cat){e<=1}',
+          'caz').fuzzy_counts, (1, 0, 0))
+
+        self.assertEqual(regex.match(r'(?:cats){e<=2}', 'c ats').fuzzy_counts,
+          (1, 1, 0))
+        self.assertEqual(regex.match(r'(?e)(?:cats){e<=2}',
+          'c ats').fuzzy_counts, (0, 1, 0))
+        self.assertEqual(regex.match(r'(?b)(?:cats){e<=2}',
+          'c ats').fuzzy_counts, (0, 1, 0))
+
+        self.assertEqual(regex.match(r'(?:cats){e<=2}',
+          'c a ts').fuzzy_counts, (0, 2, 0))
+        self.assertEqual(regex.match(r'(?e)(?:cats){e<=2}',
+          'c a ts').fuzzy_counts, (0, 2, 0))
+        self.assertEqual(regex.match(r'(?b)(?:cats){e<=2}',
+          'c a ts').fuzzy_counts, (0, 2, 0))
+
+        self.assertEqual(regex.match(r'(?:cats){e<=1}', 'c ats').fuzzy_counts,
+          (0, 1, 0))
+        self.assertEqual(regex.match(r'(?e)(?:cats){e<=1}',
+          'c ats').fuzzy_counts, (0, 1, 0))
+        self.assertEqual(regex.match(r'(?b)(?:cats){e<=1}',
+          'c ats').fuzzy_counts, (0, 1, 0))
+
+        # Hg issue 115: Infinite loop when processing backreferences
+        self.assertEqual(regex.findall(r'\bof ([a-z]+) of \1\b',
+          'To make use of one of these modules'), [])
+
+        # Hg issue 125: Reference to entire match (\g&lt;0&gt;) in
+        # Pattern.sub() doesn't work as of 2014.09.22 release.
+        self.assertEqual(regex.sub(r'x', r'\g<0>', 'x'), 'x')
+
+        # Unreported issue: no such builtin as 'ascii' in Python 2.
+        self.assertEqual(bool(regex.match(r'a', 'a', regex.DEBUG)), True)
+
+        # Hg issue 131: nested sets behaviour
+        self.assertEqual(regex.findall(r'(?V1)[[b-e]--cd]', 'abcdef'), ['b',
+          'e'])
+        self.assertEqual(regex.findall(r'(?V1)[b-e--cd]', 'abcdef'), ['b',
+          'e'])
+        self.assertEqual(regex.findall(r'(?V1)[[bcde]--cd]', 'abcdef'), ['b',
+          'e'])
+        self.assertEqual(regex.findall(r'(?V1)[bcde--cd]', 'abcdef'), ['b',
+          'e'])
+
+        # Hg issue 132: index out of range on null property \p{}
+        self.assertRaisesRegex(regex.error, '^unknown property at position 4$',
+          lambda: regex.compile(r'\p{}'))
+
+        # Issue 23692.
+        self.assertEqual(regex.match('(?:()|(?(1)()|z)){2}(?(2)a|z)',
+          'a').group(0, 1, 2), ('a', '', ''))
+        self.assertEqual(regex.match('(?:()|(?(1)()|z)){0,2}(?(2)a|z)',
+          'a').group(0, 1, 2), ('a', '', ''))
+
+        # Hg issue 137: Posix character class :punct: does not seem to be
+        # supported.
+
+        # Posix compatibility as recommended here:
+        # http://www.unicode.org/reports/tr18/#Compatibility_Properties
+
+        # Posix in Unicode.
+        chars = ''.join(chr(c) for c in range(0x10000))
+
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:alnum:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''[\p{Alpha}\p{PosixDigit}]+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:alpha:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''\p{Alpha}+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:ascii:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''[\p{InBasicLatin}]+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:blank:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''[\p{gc=Space_Separator}\t]+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:cntrl:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''\p{gc=Control}+''', chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:digit:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''[0-9]+''', chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:graph:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''[^\p{Space}\p{gc=Control}\p{gc=Surrogate}\p{gc=Unassigned}]+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:lower:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''\p{Lower}+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:print:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''(?V1)[\p{Graph}\p{Blank}--\p{Cntrl}]+''', chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:punct:]]+''',
+          chars))),
+          ascii(''.join(regex.findall(r'''(?V1)[\p{gc=Punctuation}\p{gc=Symbol}--\p{Alpha}]+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:space:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''\p{Whitespace}+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:upper:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''\p{Upper}+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:word:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''[\p{Alpha}\p{gc=Mark}\p{Digit}\p{gc=Connector_Punctuation}\p{Join_Control}]+''',
+          chars))))
+        self.assertEqual(ascii(''.join(regex.findall(r'''[[:xdigit:]]+''',
+          chars))), ascii(''.join(regex.findall(r'''[0-9A-Fa-f]+''',
+          chars))))
+
+        # Posix in ASCII.
+        chars = bytes(range(0x100))
+
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:alnum:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)[\p{Alpha}\p{PosixDigit}]+''',
+          chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:alpha:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)\p{Alpha}+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:ascii:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)[\x00-\x7F]+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:blank:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)[\p{gc=Space_Separator}\t]+''',
+          chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:cntrl:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)\p{gc=Control}+''',
+          chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:digit:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)[0-9]+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:graph:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)[^\p{Space}\p{gc=Control}\p{gc=Surrogate}\p{gc=Unassigned}]+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:lower:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)\p{Lower}+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:print:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?aV1)[\p{Graph}\p{Blank}--\p{Cntrl}]+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:punct:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?aV1)[\p{gc=Punctuation}\p{gc=Symbol}--\p{Alpha}]+''',
+          chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:space:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)\p{Whitespace}+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:upper:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)\p{Upper}+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:word:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)[\p{Alpha}\p{gc=Mark}\p{Digit}\p{gc=Connector_Punctuation}\p{Join_Control}]+''', chars))))
+        self.assertEqual(ascii(b''.join(regex.findall(br'''(?a)[[:xdigit:]]+''',
+          chars))), ascii(b''.join(regex.findall(br'''(?a)[0-9A-Fa-f]+''', chars))))
+
+        # Hg issue 138: grapheme anchored search not working properly.
+        self.assertEqual(ascii(regex.search(r'\X$', 'ab\u2103').group()),
+          ascii('\u2103'))
+
+        # Hg issue 139: Regular expression with multiple wildcards where first
+        # should match empty string does not always work.
+        self.assertEqual(regex.search("([^L]*)([^R]*R)", "LtR").groups(), ('',
+          'LtR'))
+
+        # Hg issue 140: Replace with REVERSE and groups has unexpected
+        # behavior.
+        self.assertEqual(regex.sub(r'(.)', r'x\1y', 'ab'), 'xayxby')
+        self.assertEqual(regex.sub(r'(?r)(.)', r'x\1y', 'ab'), 'xayxby')
+        self.assertEqual(regex.subf(r'(.)', 'x{1}y', 'ab'), 'xayxby')
+        self.assertEqual(regex.subf(r'(?r)(.)', 'x{1}y', 'ab'), 'xayxby')
+
+        # Hg issue 141: Crash on a certain partial match.
+        self.assertEqual(regex.fullmatch('(a)*abc', 'ab',
+          partial=True).span(), (0, 2))
+        self.assertEqual(regex.fullmatch('(a)*abc', 'ab',
+          partial=True).partial, True)
+
+        # Hg issue 143: Partial matches have incorrect span if prefix is '.'
+        # wildcard.
+        self.assertEqual(regex.search('OXRG', 'OOGOX', partial=True).span(),
+          (3, 5))
+        self.assertEqual(regex.search('.XRG', 'OOGOX', partial=True).span(),
+          (3, 5))
+        self.assertEqual(regex.search('.{1,3}XRG', 'OOGOX',
+          partial=True).span(), (1, 5))
+
+        # Hg issue 144: Latest version problem with matching 'R|R'.
+        self.assertEqual(regex.match('R|R', 'R').span(), (0, 1))
+
+        # Hg issue 146: Forced-fail (?!) works improperly in conditional.
+        self.assertEqual(regex.match(r'(.)(?(1)(?!))', 'xy'), None)
+
+        # Groups cleared after failure.
+        self.assertEqual(regex.findall(r'(y)?(\d)(?(1)\b\B)', 'ax1y2z3b'),
+          [('', '1'), ('', '2'), ('', '3')])
+        self.assertEqual(regex.findall(r'(y)?+(\d)(?(1)\b\B)', 'ax1y2z3b'),
+          [('', '1'), ('', '2'), ('', '3')])
+
+        # Hg issue 147: Fuzzy match can return match points beyond buffer end.
+        self.assertEqual([m.span() for m in regex.finditer(r'(?i)(?:error){e}',
+          'regex failure')], [(0, 5), (5, 10), (10, 13), (13, 13)])
+        self.assertEqual([m.span() for m in
+          regex.finditer(r'(?fi)(?:error){e}', 'regex failure')], [(0, 5), (5,
+          10), (10, 13), (13, 13)])
+
+        # Hg issue 150: Have an option for POSIX-compatible longest match of
+        # alternates.
+        self.assertEqual(regex.search(r'(?p)\d+(\w(\d*)?|[eE]([+-]\d+))',
+          '10b12')[0], '10b12')
+        self.assertEqual(regex.search(r'(?p)\d+(\w(\d*)?|[eE]([+-]\d+))',
+          '10E+12')[0], '10E+12')
+
+        self.assertEqual(regex.search(r'(?p)(\w|ae|oe|ue|ss)', 'ae')[0], 'ae')
+        self.assertEqual(regex.search(r'(?p)one(self)?(selfsufficient)?',
+          'oneselfsufficient')[0], 'oneselfsufficient')
+
+        # Hg issue 151: Request: \K.
+        self.assertEqual(regex.search(r'(ab\Kcd)', 'abcd').group(0, 1), ('cd',
+          'abcd'))
+        self.assertEqual(regex.findall(r'\w\w\K\w\w', 'abcdefgh'), ['cd',
+          'gh'])
+        self.assertEqual(regex.findall(r'(\w\w\K\w\w)', 'abcdefgh'), ['abcd',
+          'efgh'])
+
+        self.assertEqual(regex.search(r'(?r)(ab\Kcd)', 'abcd').group(0, 1),
+          ('ab', 'abcd'))
+        self.assertEqual(regex.findall(r'(?r)\w\w\K\w\w', 'abcdefgh'), ['ef',
+          'ab'])
+        self.assertEqual(regex.findall(r'(?r)(\w\w\K\w\w)', 'abcdefgh'),
+          ['efgh', 'abcd'])
+
+        # Hg issue 152: Request: Request: (?(DEFINE)...).
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<quant>\d+)(?<item>\w+))(?&quant) (?&item)',
+          '5 elephants')[0], '5 elephants')
+
+        self.assertEqual(regex.search(r'(?&routine)(?(DEFINE)(?<routine>.))', 'a').group('routine'), None)
+        self.assertEqual(regex.search(r'(?&routine)(?(DEFINE)(?<routine>.))', 'a').captures('routine'), ['a'])
+
+        # Hg issue 153: Request: (*SKIP).
+        self.assertEqual(regex.search(r'12(*FAIL)|3', '123')[0], '3')
+        self.assertEqual(regex.search(r'(?r)12(*FAIL)|3', '123')[0], '3')
+
+        self.assertEqual(regex.search(r'\d+(*PRUNE)\d', '123'), None)
+        self.assertEqual(regex.search(r'\d+(?=(*PRUNE))\d', '123')[0], '123')
+        self.assertEqual(regex.search(r'\d+(*PRUNE)bcd|[3d]', '123bcd')[0],
+          '123bcd')
+        self.assertEqual(regex.search(r'\d+(*PRUNE)bcd|[3d]', '123zzd')[0],
+          'd')
+        self.assertEqual(regex.search(r'\d+?(*PRUNE)bcd|[3d]', '123bcd')[0],
+          '3bcd')
+        self.assertEqual(regex.search(r'\d+?(*PRUNE)bcd|[3d]', '123zzd')[0],
+          'd')
+        self.assertEqual(regex.search(r'\d++(?<=3(*PRUNE))zzd|[4d]$',
+          '123zzd')[0], '123zzd')
+        self.assertEqual(regex.search(r'\d++(?<=3(*PRUNE))zzd|[4d]$',
+          '124zzd')[0], 'd')
+        self.assertEqual(regex.search(r'\d++(?<=(*PRUNE)3)zzd|[4d]$',
+          '124zzd')[0], 'd')
+        self.assertEqual(regex.search(r'\d++(?<=2(*PRUNE)3)zzd|[3d]$',
+          '124zzd')[0], 'd')
+
+        self.assertEqual(regex.search(r'(?r)\d(*PRUNE)\d+', '123'), None)
+        self.assertEqual(regex.search(r'(?r)\d(?<=(*PRUNE))\d+', '123')[0],
+          '123')
+        self.assertEqual(regex.search(r'(?r)\d+(*PRUNE)bcd|[3d]',
+          '123bcd')[0], '123bcd')
+        self.assertEqual(regex.search(r'(?r)\d+(*PRUNE)bcd|[3d]',
+          '123zzd')[0], 'd')
+        self.assertEqual(regex.search(r'(?r)\d++(?<=3(*PRUNE))zzd|[4d]$',
+          '123zzd')[0], '123zzd')
+        self.assertEqual(regex.search(r'(?r)\d++(?<=3(*PRUNE))zzd|[4d]$',
+          '124zzd')[0], 'd')
+        self.assertEqual(regex.search(r'(?r)\d++(?<=(*PRUNE)3)zzd|[4d]$',
+          '124zzd')[0], 'd')
+        self.assertEqual(regex.search(r'(?r)\d++(?<=2(*PRUNE)3)zzd|[3d]$',
+          '124zzd')[0], 'd')
+
+        self.assertEqual(regex.search(r'\d+(*SKIP)bcd|[3d]', '123bcd')[0],
+          '123bcd')
+        self.assertEqual(regex.search(r'\d+(*SKIP)bcd|[3d]', '123zzd')[0],
+          'd')
+        self.assertEqual(regex.search(r'\d+?(*SKIP)bcd|[3d]', '123bcd')[0],
+          '3bcd')
+        self.assertEqual(regex.search(r'\d+?(*SKIP)bcd|[3d]', '123zzd')[0],
+          'd')
+        self.assertEqual(regex.search(r'\d++(?<=3(*SKIP))zzd|[4d]$',
+          '123zzd')[0], '123zzd')
+        self.assertEqual(regex.search(r'\d++(?<=3(*SKIP))zzd|[4d]$',
+          '124zzd')[0], 'd')
+        self.assertEqual(regex.search(r'\d++(?<=(*SKIP)3)zzd|[4d]$',
+          '124zzd')[0], 'd')
+        self.assertEqual(regex.search(r'\d++(?<=2(*SKIP)3)zzd|[3d]$',
+          '124zzd')[0], 'd')
+
+        self.assertEqual(regex.search(r'(?r)\d+(*SKIP)bcd|[3d]', '123bcd')[0],
+          '123bcd')
+        self.assertEqual(regex.search(r'(?r)\d+(*SKIP)bcd|[3d]', '123zzd')[0],
+          'd')
+        self.assertEqual(regex.search(r'(?r)\d++(?<=3(*SKIP))zzd|[4d]$',
+          '123zzd')[0], '123zzd')
+        self.assertEqual(regex.search(r'(?r)\d++(?<=3(*SKIP))zzd|[4d]$',
+          '124zzd')[0], 'd')
+        self.assertEqual(regex.search(r'(?r)\d++(?<=(*SKIP)3)zzd|[4d]$',
+          '124zzd')[0], 'd')
+        self.assertEqual(regex.search(r'(?r)\d++(?<=2(*SKIP)3)zzd|[3d]$',
+          '124zzd')[0], 'd')
+
+        # Hg issue 154: Segmentation fault 11 when working with an atomic group
+        text = """June 30, December 31, 2013 2012
+some words follow:
+more words and numbers 1,234,567 9,876,542
+more words and numbers 1,234,567 9,876,542"""
+        self.assertEqual(len(regex.findall(r'(?<!\d)(?>2014|2013 ?2012)', text)), 1)
+
+        # Hg issue 156: regression on atomic grouping
+        self.assertEqual(regex.match('1(?>2)', '12').span(), (0, 2))
+
+        # Hg issue 157: regression: segfault on complex lookaround
+        self.assertEqual(regex.match(r'(?V1w)(?=(?=[^A-Z]*+[A-Z])(?=[^a-z]*+[a-z]))(?=\D*+\d)(?=\p{Alphanumeric}*+\P{Alphanumeric})\A(?s:.){8,255}+\Z',
+          'AAaa11!!')[0], 'AAaa11!!')
+
+        # Hg issue 158: Group issue with (?(DEFINE)...)
+        TEST_REGEX = regex.compile(r'''(?smx)
+(?(DEFINE)
+  (?<subcat>
+   ^,[^,]+,
+   )
+)
+
+# Group 2 is defined on this line
+^,([^,]+),
+
+(?:(?!(?&subcat)[\r\n]+(?&subcat)).)+
+''')
+
+        TEST_DATA = '''
+,Cat 1,
+,Brand 1,
+some
+thing
+,Brand 2,
+other
+things
+,Cat 2,
+,Brand,
+Some
+thing
+'''
+
+        self.assertEqual([m.span(1, 2) for m in
+          TEST_REGEX.finditer(TEST_DATA)], [((-1, -1), (2, 7)), ((-1, -1), (54,
+          59))])
+
+        # Hg issue 161: Unexpected fuzzy match results
+        self.assertEqual(regex.search('(abcdefgh){e}',
+          '******abcdefghijklmnopqrtuvwxyz', regex.BESTMATCH).span(), (6, 14))
+        self.assertEqual(regex.search('(abcdefghi){e}',
+          '******abcdefghijklmnopqrtuvwxyz', regex.BESTMATCH).span(), (6, 15))
+
+        # Hg issue 163: allow lookarounds in conditionals.
+        self.assertEqual(regex.match(r'(?:(?=\d)\d+\b|\w+)', '123abc').span(),
+          (0, 6))
+        self.assertEqual(regex.match(r'(?(?=\d)\d+\b|\w+)', '123abc'), None)
+        self.assertEqual(regex.search(r'(?(?<=love\s)you|(?<=hate\s)her)',
+          "I love you").span(), (7, 10))
+        self.assertEqual(regex.findall(r'(?(?<=love\s)you|(?<=hate\s)her)',
+          "I love you but I don't hate her either"), ['you', 'her'])
+
+        # Hg issue 180: bug of POSIX matching.
+        self.assertEqual(regex.search(r'(?p)a*(.*?)', 'aaabbb').group(0, 1),
+          ('aaabbb', 'bbb'))
+        self.assertEqual(regex.search(r'(?p)a*(.*)', 'aaabbb').group(0, 1),
+          ('aaabbb', 'bbb'))
+        self.assertEqual(regex.sub(r'(?p)a*(.*?)', r'\1', 'aaabbb'), 'bbb')
+        self.assertEqual(regex.sub(r'(?p)a*(.*)', r'\1', 'aaabbb'), 'bbb')
+
+        # Hg issue 192: Named lists reverse matching doesn't work with
+        # IGNORECASE and V1
+        self.assertEqual(regex.match(r'(?irV0)\L<kw>', '21', kw=['1']).span(),
+          (1, 2))
+        self.assertEqual(regex.match(r'(?irV1)\L<kw>', '21', kw=['1']).span(),
+          (1, 2))
+
+        # Hg issue 193: Alternation and .REVERSE flag.
+        self.assertEqual(regex.search('a|b', '111a222').span(), (3, 4))
+        self.assertEqual(regex.search('(?r)a|b', '111a222').span(), (3, 4))
+
+        # Hg issue 194: .FULLCASE and Backreference
+        self.assertEqual(regex.search(r'(?if)<(CLI)><\1>',
+          '<cli><cli>').span(), (0, 10))
+        self.assertEqual(regex.search(r'(?if)<(CLI)><\1>',
+          '<cli><clI>').span(), (0, 10))
+        self.assertEqual(regex.search(r'(?ifr)<\1><(CLI)>',
+          '<cli><clI>').span(), (0, 10))
+
+        # Hg issue 195: Pickle (or otherwise serial) the compiled regex
+        r = regex.compile(r'\L<options>', options=['foo', 'bar'])
+        p = pickle.dumps(r)
+        r = pickle.loads(p)
+        self.assertEqual(r.match('foo').span(), (0, 3))
+
+        # Hg issue 196: Fuzzy matching on repeated regex not working as
+        # expected
+        self.assertEqual(regex.match('(x{6}){e<=1}', 'xxxxxx',
+          flags=regex.BESTMATCH).span(), (0, 6))
+        self.assertEqual(regex.match('(x{6}){e<=1}', 'xxxxx',
+          flags=regex.BESTMATCH).span(), (0, 5))
+        self.assertEqual(regex.match('(x{6}){e<=1}', 'x',
+          flags=regex.BESTMATCH), None)
+        self.assertEqual(regex.match('(?r)(x{6}){e<=1}', 'xxxxxx',
+          flags=regex.BESTMATCH).span(), (0, 6))
+        self.assertEqual(regex.match('(?r)(x{6}){e<=1}', 'xxxxx',
+          flags=regex.BESTMATCH).span(), (0, 5))
+        self.assertEqual(regex.match('(?r)(x{6}){e<=1}', 'x',
+          flags=regex.BESTMATCH), None)
+
+        # Hg issue 197: ValueError in regex.compile
+        self.assertRaises(regex.error, lambda:
+          regex.compile(b'00000\\0\\00\\^\50\\00\\U05000000'))
+
+        # Hg issue 198: ValueError in regex.compile
+        self.assertRaises(regex.error, lambda: regex.compile(b"{e<l"))
+
+        # Hg issue 199: Segfault in re.compile
+        self.assertEqual(bool(regex.compile('((?0)){e}')), True)
+
+        # Hg issue 200: AttributeError in regex.compile with latest regex
+        self.assertEqual(bool(regex.compile('\x00?(?0){e}')), True)
+
+        # Hg issue 201: ENHANCEMATCH crashes interpreter
+        self.assertEqual(regex.findall(r'((brown)|(lazy)){1<=e<=3} ((dog)|(fox)){1<=e<=3}',
+          'The quick borwn fax jumped over the lzy hog', regex.ENHANCEMATCH),
+          [('borwn', 'borwn', '', 'fax', '', 'fax'), ('lzy', '', 'lzy', 'hog',
+          'hog', '')])
+
+        # Hg issue 203: partial matching bug
+        self.assertEqual(regex.search(r'\d\d\d-\d\d-\d\d\d\d',
+          "My SSN is 999-89-76, but don't tell.", partial=True).span(), (36,
+          36))
+
+        # Hg issue 204: confusion of (?aif) flags
+        upper_i = '\N{CYRILLIC CAPITAL LETTER SHORT I}'
+        lower_i = '\N{CYRILLIC SMALL LETTER SHORT I}'
+
+        self.assertEqual(bool(regex.match(r'(?ui)' + upper_i,
+          lower_i)), True)
+        self.assertEqual(bool(regex.match(r'(?ui)' + lower_i,
+          upper_i)), True)
+
+        self.assertEqual(bool(regex.match(r'(?ai)' + upper_i,
+          lower_i)), False)
+        self.assertEqual(bool(regex.match(r'(?ai)' + lower_i,
+          upper_i)), False)
+
+        self.assertEqual(bool(regex.match(r'(?afi)' + upper_i,
+          lower_i)), False)
+        self.assertEqual(bool(regex.match(r'(?afi)' + lower_i,
+          upper_i)), False)
+
+        # Hg issue 205: Named list and (?ri) flags
+        self.assertEqual(bool(regex.search(r'(?i)\L<aa>', '22', aa=['121',
+          '22'])), True)
+        self.assertEqual(bool(regex.search(r'(?ri)\L<aa>', '22', aa=['121',
+          '22'])), True)
+        self.assertEqual(bool(regex.search(r'(?fi)\L<aa>', '22', aa=['121',
+          '22'])), True)
+        self.assertEqual(bool(regex.search(r'(?fri)\L<aa>', '22', aa=['121',
+          '22'])), True)
+
+        # Hg issue 208: Named list, (?ri) flags, Backreference
+        self.assertEqual(regex.search(r'(?r)\1dog..(?<=(\L<aa>))$', 'ccdogcc',
+          aa=['bcb', 'cc']). span(), (0, 7))
+        self.assertEqual(regex.search(r'(?ir)\1dog..(?<=(\L<aa>))$',
+          'ccdogcc', aa=['bcb', 'cc']). span(), (0, 7))
+
+        # Hg issue 210: Fuzzy matching and Backreference
+        self.assertEqual(regex.search(r'(2)(?:\1{5}){e<=1}',
+          '3222212').span(), (1, 7))
+        self.assertEqual(regex.search(r'(\d)(?:\1{5}){e<=1}',
+          '3222212').span(), (1, 7))
+
+        # Hg issue 211: Segmentation fault with recursive matches and atomic
+        # groups
+        self.assertEqual(regex.match(r'''\A(?P<whole>(?>\((?&whole)\)|[+\-]))\Z''',
+          '((-))').span(), (0, 5))
+        self.assertEqual(regex.match(r'''\A(?P<whole>(?>\((?&whole)\)|[+\-]))\Z''',
+          '((-)+)'), None)
+
+        # Hg issue 212: Unexpected matching difference with .*? between re and
+        # regex
+        self.assertEqual(regex.match(r"x.*? (.).*\1(.*)\1",
+          'x  |y| z|').span(), (0, 9))
+        self.assertEqual(regex.match(r"\.sr (.*?) (.)(.*)\2(.*)\2(.*)",
+          r'.sr  h |<nw>|<span class="locked">|').span(), (0, 35))
+
+        # Hg issue 213: Segmentation Fault
+        a = '"\\xF9\\x80\\xAEqdz\\x95L\\xA7\\x89[\\xFE \\x91)\\xF9]\\xDB\'\\x99\\x09=\\x00\\xFD\\x98\\x22\\xDD\\xF1\\xB6\\xC3 Z\\xB6gv\\xA5x\\x93P\\xE1r\\x14\\x8Cv\\x0C\\xC0w\\x15r\\xFFc%" '
+        py_regex_pattern = r'''(?P<http_referer>((?>(?<!\\)(?>"(?>\\.|[^\\"]+)+"|""|(?>'(?>\\.|[^\\']+)+')|''|(?>`(?>\\.|[^\\`]+)+`)|``)))) (?P<useragent>((?>(?<!\\)(?>"(?>\\.|[^\\"]+)+"|""|(?>'(?>\\.|[^\\']+)+')|''|(?>`(?>\\.|[^\\`]+)+`)|``))))'''
+        self.assertEqual(bool(regex.search(py_regex_pattern, a)), False)
+
+        # Hg Issue 216: Invalid match when using negative lookbehind and pipe
+        self.assertEqual(bool(regex.match('foo(?<=foo)', 'foo')), True)
+        self.assertEqual(bool(regex.match('foo(?<!foo)', 'foo')), False)
+        self.assertEqual(bool(regex.match('foo(?<=foo|x)', 'foo')), True)
+        self.assertEqual(bool(regex.match('foo(?<!foo|x)', 'foo')), False)
+
+        # Hg issue 217: Core dump in conditional ahead match and matching \!
+        # character
+        self.assertEqual(bool(regex.match(r'(?(?=.*\!.*)(?P<true>.*\!\w*\:.*)|(?P<false>.*))',
+          '!')), False)
+
+        # Hg issue 220: Misbehavior of group capture with OR operand
+        self.assertEqual(regex.match(r'\w*(ea)\w*|\w*e(?!a)\w*',
+          'easier').groups(), ('ea', ))
+
+        # Hg issue 225: BESTMATCH in fuzzy match not working
+        self.assertEqual(regex.search('(^1234$){i,d}', '12234',
+          regex.BESTMATCH).span(), (0, 5))
+        self.assertEqual(regex.search('(^1234$){i,d}', '12234',
+          regex.BESTMATCH).fuzzy_counts, (0, 1, 0))
+
+        self.assertEqual(regex.search('(^1234$){s,i,d}', '12234',
+          regex.BESTMATCH).span(), (0, 5))
+        self.assertEqual(regex.search('(^1234$){s,i,d}', '12234',
+          regex.BESTMATCH).fuzzy_counts, (0, 1, 0))
+
+        # Hg issue 226: Error matching at start of string
+        self.assertEqual(regex.search('(^123$){s,i,d}', 'xxxxxxxx123',
+          regex.BESTMATCH).span(), (0, 11))
+        self.assertEqual(regex.search('(^123$){s,i,d}', 'xxxxxxxx123',
+          regex.BESTMATCH).fuzzy_counts, (0, 8, 0))
+
+        # Hg issue 227: Incorrect behavior for ? operator with UNICODE +
+        # IGNORECASE
+        self.assertEqual(regex.search(r'a?yz', 'xxxxyz', flags=regex.FULLCASE |
+          regex.IGNORECASE).span(), (4, 6))
+
+        # Hg issue 230: Is it a bug of (?(DEFINE)...)
+        self.assertEqual(regex.findall(r'(?:(?![a-d]).)+', 'abcdefgh'),
+          ['efgh'])
+        self.assertEqual(regex.findall(r'''(?(DEFINE)(?P<mydef>(?:(?![a-d]).)))(?&mydef)+''',
+          'abcdefgh'), ['efgh'])
+
+        # Hg issue 238: Not fully re backward compatible
+        self.assertEqual(regex.findall(r'((\w{1,3})(\.{2,10})){1,3}',
+          '"Erm....yes. T..T...Thank you for that."'), [('Erm....', 'Erm',
+          '....'), ('T...', 'T', '...')])
+        self.assertEqual(regex.findall(r'((\w{1,3})(\.{2,10})){3}',
+          '"Erm....yes. T..T...Thank you for that."'), [])
+        self.assertEqual(regex.findall(r'((\w{1,3})(\.{2,10})){2}',
+          '"Erm....yes. T..T...Thank you for that."'), [('T...', 'T', '...')])
+        self.assertEqual(regex.findall(r'((\w{1,3})(\.{2,10})){1}',
+          '"Erm....yes. T..T...Thank you for that."'), [('Erm....', 'Erm',
+          '....'), ('T..', 'T', '..'), ('T...', 'T', '...')])
+
+        # Hg issue 247: Unexpected result with fuzzy matching and lookahead
+        # expression
+        self.assertEqual(regex.search(r'(?:ESTONIA(?!\w)){e<=1}',
+          'ESTONIAN WORKERS').group(), 'ESTONIAN')
+        self.assertEqual(regex.search(r'(?:ESTONIA(?=\W)){e<=1}',
+          'ESTONIAN WORKERS').group(), 'ESTONIAN')
+
+        self.assertEqual(regex.search(r'(?:(?<!\w)ESTONIA){e<=1}',
+          'BLUB NESTONIA').group(), 'NESTONIA')
+        self.assertEqual(regex.search(r'(?:(?<=\W)ESTONIA){e<=1}',
+          'BLUB NESTONIA').group(), 'NESTONIA')
+
+        self.assertEqual(regex.search(r'(?r)(?:ESTONIA(?!\w)){e<=1}',
+          'ESTONIAN WORKERS').group(), 'ESTONIAN')
+        self.assertEqual(regex.search(r'(?r)(?:ESTONIA(?=\W)){e<=1}',
+          'ESTONIAN WORKERS').group(), 'ESTONIAN')
+
+        self.assertEqual(regex.search(r'(?r)(?:(?<!\w)ESTONIA){e<=1}',
+          'BLUB NESTONIA').group(), 'NESTONIA')
+        self.assertEqual(regex.search(r'(?r)(?:(?<=\W)ESTONIA){e<=1}',
+          'BLUB NESTONIA').group(), 'NESTONIA')
+
+        # Hg issue 248: Unexpected result with fuzzy matching and more than one
+        # non-greedy quantifier
+        self.assertEqual(regex.search(r'(?:A.*B.*CDE){e<=2}',
+          'A B CYZ').group(), 'A B CYZ')
+        self.assertEqual(regex.search(r'(?:A.*B.*?CDE){e<=2}',
+          'A B CYZ').group(), 'A B CYZ')
+        self.assertEqual(regex.search(r'(?:A.*?B.*CDE){e<=2}',
+          'A B CYZ').group(), 'A B CYZ')
+        self.assertEqual(regex.search(r'(?:A.*?B.*?CDE){e<=2}',
+          'A B CYZ').group(), 'A B CYZ')
+
+        # Hg issue 249: Add an option to regex.escape() to not escape spaces
+        self.assertEqual(regex.escape(' ,0A[', special_only=False, literal_spaces=False), '\\ \\,0A\\[')
+        self.assertEqual(regex.escape(' ,0A[', special_only=False, literal_spaces=True), ' \\,0A\\[')
+        self.assertEqual(regex.escape(' ,0A[', special_only=True, literal_spaces=False), '\\ ,0A\\[')
+        self.assertEqual(regex.escape(' ,0A[', special_only=True, literal_spaces=True), ' ,0A\\[')
+
+        self.assertEqual(regex.escape(' ,0A['), '\\ ,0A\\[')
+
+        # Hg issue 251: Segfault with a particular expression
+        self.assertEqual(regex.search(r'(?(?=A)A|B)', 'A').span(), (0, 1))
+        self.assertEqual(regex.search(r'(?(?=A)A|B)', 'B').span(), (0, 1))
+        self.assertEqual(regex.search(r'(?(?=A)A|)', 'B').span(), (0, 0))
+        self.assertEqual(regex.search(r'(?(?=X)X|)', '').span(), (0, 0))
+        self.assertEqual(regex.search(r'(?(?=X))', '').span(), (0, 0))
+
+        # Hg issue 252: Empty capture strings when using DEFINE group reference
+        # within look-behind expression
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?&func)',
+          'abc').groups(), (None, ))
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?&func)',
+          'abc').groupdict(), {'func': None})
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?&func)',
+          'abc').capturesdict(), {'func': ['a']})
+
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?=(?&func))',
+          'abc').groups(), (None, ))
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?=(?&func))',
+          'abc').groupdict(), {'func': None})
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.))(?=(?&func))',
+          'abc').capturesdict(), {'func': ['a']})
+
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.)).(?<=(?&func))',
+          'abc').groups(), (None, ))
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.)).(?<=(?&func))',
+          'abc').groupdict(), {'func': None})
+        self.assertEqual(regex.search(r'(?(DEFINE)(?<func>.)).(?<=(?&func))',
+          'abc').capturesdict(), {'func': ['a']})
+
+        # Hg issue 271: Comment logic different between Re and Regex
+        self.assertEqual(bool(regex.match(r'ab(?#comment\))cd', 'abcd')), True)
+
+        # Hg issue 276: Partial Matches yield incorrect matches and bounds
+        self.assertEqual(regex.search(r'[a-z]+ [a-z]*?:', 'foo bar',
+          partial=True).span(), (0, 7))
+        self.assertEqual(regex.search(r'(?r):[a-z]*? [a-z]+', 'foo bar',
+          partial=True).span(), (0, 7))
+
+        # Hg issue 291: Include Script Extensions as a supported Unicode property
+        self.assertEqual(bool(regex.match(r'(?u)\p{Script:Beng}',
+          '\u09EF')), True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{Script:Bengali}',
+          '\u09EF')), True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{Script_Extensions:Bengali}',
+          '\u09EF')), True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{Script_Extensions:Beng}',
+          '\u09EF')), True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{Script_Extensions:Cakm}',
+          '\u09EF')), True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{Script_Extensions:Sylo}',
+          '\u09EF')), True)
+
+        # Hg issue #293: scx (Script Extensions) property currently matches
+        # incorrectly
+        self.assertEqual(bool(regex.match(r'(?u)\p{scx:Latin}', 'P')), True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{scx:Ahom}', 'P')), False)
+        self.assertEqual(bool(regex.match(r'(?u)\p{scx:Common}', '4')), True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{scx:Caucasian_Albanian}', '4')),
+          False)
+        self.assertEqual(bool(regex.match(r'(?u)\p{scx:Arabic}', '\u062A')), True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{scx:Balinese}', '\u062A')),
+          False)
+        self.assertEqual(bool(regex.match(r'(?u)\p{scx:Devanagari}', '\u091C')),
+          True)
+        self.assertEqual(bool(regex.match(r'(?u)\p{scx:Batak}', '\u091C')), False)
+
+        # Hg issue 296: Group references are not taken into account when group is reporting the last match
+        self.assertEqual(regex.fullmatch('(?P<x>.)*(?&x)', 'abc').captures('x'),
+          ['a', 'b', 'c'])
+        self.assertEqual(regex.fullmatch('(?P<x>.)*(?&x)', 'abc').group('x'),
+          'b')
+
+        self.assertEqual(regex.fullmatch('(?P<x>.)(?P<x>.)(?P<x>.)',
+          'abc').captures('x'), ['a', 'b', 'c'])
+        self.assertEqual(regex.fullmatch('(?P<x>.)(?P<x>.)(?P<x>.)',
+          'abc').group('x'), 'c')
+
+        # Hg issue 299: Partial gives misleading results with "open ended" regexp
+        self.assertEqual(regex.match('(?:ab)*', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)*', 'abab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)*?', '', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)*+', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)*+', 'abab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)+', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)+', 'abab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)+?', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)++', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?:ab)++', 'abab', partial=True).partial,
+          False)
+
+        self.assertEqual(regex.match('(?r)(?:ab)*', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)*', 'abab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)*?', '', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)*+', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)*+', 'abab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)+', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)+', 'abab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)+?', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)++', 'ab', partial=True).partial,
+          False)
+        self.assertEqual(regex.match('(?r)(?:ab)++', 'abab', partial=True).partial,
+          False)
+
+        self.assertEqual(regex.match('a*', '', partial=True).partial, False)
+        self.assertEqual(regex.match('a*?', '', partial=True).partial, False)
+        self.assertEqual(regex.match('a*+', '', partial=True).partial, False)
+        self.assertEqual(regex.match('a+', '', partial=True).partial, True)
+        self.assertEqual(regex.match('a+?', '', partial=True).partial, True)
+        self.assertEqual(regex.match('a++', '', partial=True).partial, True)
+        self.assertEqual(regex.match('a+', 'a', partial=True).partial, False)
+        self.assertEqual(regex.match('a+?', 'a', partial=True).partial, False)
+        self.assertEqual(regex.match('a++', 'a', partial=True).partial, False)
+
+        self.assertEqual(regex.match('(?r)a*', '', partial=True).partial, False)
+        self.assertEqual(regex.match('(?r)a*?', '', partial=True).partial, False)
+        self.assertEqual(regex.match('(?r)a*+', '', partial=True).partial, False)
+        self.assertEqual(regex.match('(?r)a+', '', partial=True).partial, True)
+        self.assertEqual(regex.match('(?r)a+?', '', partial=True).partial, True)
+        self.assertEqual(regex.match('(?r)a++', '', partial=True).partial, True)
+        self.assertEqual(regex.match('(?r)a+', 'a', partial=True).partial, False)
+        self.assertEqual(regex.match('(?r)a+?', 'a', partial=True).partial, False)
+        self.assertEqual(regex.match('(?r)a++', 'a', partial=True).partial, False)
+
+        self.assertEqual(regex.match(r"(?:\s*\w+'*)+", 'whatever', partial=True).partial,
+          False)
+
+        # Hg issue 300: segmentation fault
+        pattern = ('(?P<termini5>GGCGTCACACTTTGCTATGCCATAGCAT[AG]TTTATCCATAAGA'
+          'TTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATAACAGAACATATTGA'
+          'CTATCCGGTATTACCCGGCATGACAGGAGTAAAA){e<=1}'
+          '(?P<gene>[ACGT]{1059}){e<=2}'
+          '(?P<spacer>TAATCGTCTTGTTTGATACACAAGGGTCGCATCTGCGGCCCTTTTGCTTTTTTAAG'
+          'TTGTAAGGATATGCCATTCTAGA){e<=0}'
+          '(?P<barcode>[ACGT]{18}){e<=0}'
+          '(?P<termini3>AGATCGG[CT]AGAGCGTCGTGTAGGGAAAGAGTGTGG){e<=1}')
+
+        text = ('GCACGGCGTCACACTTTGCTATGCCATAGCATATTTATCCATAAGATTAGCGGATCCTACC'
+          'TGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATAACAGAACATATTGACTATCCGGTATTACC'
+          'CGGCATGACAGGAGTAAAAATGGCTATCGACGAAAACAAACAGAAAGCGTTGGCGGCAGCACTGGGC'
+          'CAGATTGAGAAACAATTTGGTAAAGGCTCCATCATGCGCCTGGGTGAAGACCGTTCCATGGATGTGG'
+          'AAACCATCTCTACCGGTTCGCTTTCACTGGATATCGCGCTTGGGGCAGGTGGTCTGCCGATGGGCCG'
+          'TATCGTCGAAATCTACGGACCGGAATCTTCCGGTAAAACCACGCTGACGCTGCAGGTGATCGCCGCA'
+          'GCGCAGCGTGAAGGTAAAACCTGTGCGTTTATCGATGCTGAACACGCGCTGGACCCAATCTACGCAC'
+          'GTAAACTGGGCGTCGATATCGACAACCTGCTGTGCTCCCAGCCGGACACCGGCGAGCAGGCACTGGA'
+          'AATCTGTGACGCCCTGGCGCGTTCTGGCGCAGTAGACGTTATCGTCGTTGACTCCGTGGCGGCACTG'
+          'ACGCCGAAAGCGGAAATCGAAGGCGAAATCGGCGACTCTCATATGGGCCTTGCGGCACGTATGATGA'
+          'GCCAGGCGATGCGTAAGCTGGCGGGTAACCTGAAGCAGTCCAACACGCTGCTGATCTTCATCAACCC'
+          'CATCCGTATGAAAATTGGTGTGATGTTCGGCAACCCGGAAACCACTTACCGGTGGTAACGCGCTGAA'
+          'ATTCTACGCCTCTGTTCGTCTCGACATCCGTTAAATCGGCGCGGTGAAAGAGGGCGAAAACGTGGTG'
+          'GGTAGCGAAACCCGCGTGAAAGTGGTGAAGAACAAAATCGCTGCGCCGTTTAAACAGGCTGAATTCC'
+          'AGATCCTCTACGGCGAAGGTATCAACTTCTACCCCGAACTGGTTGACCTGGGCGTAAAAGAGAAGCT'
+          'GATCGAGAAAGCAGGCGCGTGGTACAGCTACAAAGGTGAGAAGATCGGTCAGGGTAAAGCGAATGCG'
+          'ACTGCCTGGCTGAAATTTAACCCGGAAACCGCGAAAGAGATCGAGTGAAAAGTACGTGAGTTGCTGC'
+          'TGAGCAACCCGAACTCAACGCCGGATTTCTCTGTAGATGATAGCGAAGGCGTAGCAGAAACTAACGA'
+          'AGATTTTTAATCGTCTTGTTTGATACACAAGGGTCGCATCTGCGGCCCTTTTGCTTTTTTAAGTTGT'
+          'AAGGATATGCCATTCTAGACAGTTAACACACCAACAAAGATCGGTAGAGCGTCGTGTAGGGAAAGAG'
+          'TGTGGTACC')
+
+        m = regex.search(pattern, text, flags=regex.BESTMATCH)
+        self.assertEqual(m.fuzzy_counts, (0, 1, 0))
+        self.assertEqual(m.fuzzy_changes, ([], [1206], []))
+
+        # Hg issue 306: Fuzzy match parameters not respecting quantifier scope
+        self.assertEqual(regex.search(r'(?e)(dogf(((oo){e<1})|((00){e<1}))d){e<2}',
+          'dogfood').fuzzy_counts, (0, 0, 0))
+        self.assertEqual(regex.search(r'(?e)(dogf(((oo){e<1})|((00){e<1}))d){e<2}',
+          'dogfoot').fuzzy_counts, (1, 0, 0))
+
+        # Hg issue 312: \X not matching graphemes with zero-width-joins
+        self.assertEqual(regex.findall(r'\X',
+          '\U0001F468\u200D\U0001F469\u200D\U0001F467\u200D\U0001F466'),
+          ['\U0001F468\u200D\U0001F469\u200D\U0001F467\u200D\U0001F466'])
+
+        # Hg issue 320: Abnormal performance
+        self.assertEqual(bool(regex.search(r'(?=a)a', 'a')), True)
+        self.assertEqual(bool(regex.search(r'(?!b)a', 'a')), True)
+
+        # Hg issue 327: .fullmatch() causes MemoryError
+        self.assertEqual(regex.fullmatch(r'((\d)*?)*?', '123').span(), (0, 3))
+
+        # Hg issue 329: Wrong group matches when question mark quantifier is used within a look behind
+        self.assertEqual(regex.search(r'''(?(DEFINE)(?<mydef>(?<wrong>THIS_SHOULD_NOT_MATCHx?)|(?<right>right))).*(?<=(?&mydef).*)''',
+          'x right').capturesdict(), {'mydef': ['right'], 'wrong': [], 'right':
+          ['right']})
+
+        # Hg issue 338: specifying allowed characters when fuzzy-matching
+        self.assertEqual(bool(regex.match(r'(?:cat){e<=1:[u]}', 'cut')), True)
+        self.assertEqual(bool(regex.match(r'(?:cat){e<=1:u}', 'cut')), True)
+
+        # Hg issue 353: fuzzy changes negative indexes
+        self.assertEqual(regex.search(r'(?be)(AGTGTTCCCCGCGCCAGCGGGGATAAACCG){s<=5,i<=5,d<=5,s+i+d<=10}',
+          'TTCCCCGCGCCAGCGGGGATAAACCG').fuzzy_changes, ([], [], [0, 1, 3, 5]))
+
+        # Git issue 364: Contradictory values in fuzzy_counts and fuzzy_changes
+        self.assertEqual(regex.match(r'(?:bc){e}', 'c').fuzzy_counts, (1, 0,
+          1))
+        self.assertEqual(regex.match(r'(?:bc){e}', 'c').fuzzy_changes, ([0],
+          [], [1]))
+        self.assertEqual(regex.match(r'(?e)(?:bc){e}', 'c').fuzzy_counts, (0,
+          0, 1))
+        self.assertEqual(regex.match(r'(?e)(?:bc){e}', 'c').fuzzy_changes,
+          ([], [], [0]))
+        self.assertEqual(regex.match(r'(?b)(?:bc){e}', 'c').fuzzy_counts, (0,
+          0, 1))
+        self.assertEqual(regex.match(r'(?b)(?:bc){e}', 'c').fuzzy_changes,
+          ([], [], [0]))
+
+        # Git issue 370: Confusions about Fuzzy matching behavior
+        self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){e}',
+          '$ 10,112.111.12').fuzzy_counts, (6, 0, 5))
+        self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){s<=1}',
+          '$ 10,112.111.12').fuzzy_counts, (1, 0, 0))
+        self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){s<=1,i<=1,d<=1}',
+          '$ 10,112.111.12').fuzzy_counts, (1, 0, 0))
+        self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){s<=3}',
+          '$ 10,1a2.111.12').fuzzy_counts, (2, 0, 0))
+        self.assertEqual(regex.match('(?e)(?:^(\\$ )?\\d{1,3}(,\\d{3})*(\\.\\d{2})$){s<=2}',
+          '$ 10,1a2.111.12').fuzzy_counts, (2, 0, 0))
+
+        self.assertEqual(regex.fullmatch(r'(?e)(?:0?,0(?:,0)?){s<=1,d<=1}',
+          ',0;0').fuzzy_counts, (1, 0, 0))
+        self.assertEqual(regex.fullmatch(r'(?e)(?:0??,0(?:,0)?){s<=1,d<=1}',
+          ',0;0').fuzzy_counts, (1, 0, 0))
+
+        # Git issue 371: Specifying character set when fuzzy-matching allows characters not in the set
+        self.assertEqual(regex.search(r"\b(?e)(?:\d{6,20}){i<=5:[\-\\\/]}\b",
+          "cat dog starting at 00:01132.000. hello world"), None)
+
+        # Git issue 385: Comments in expressions
+        self.assertEqual(bool(regex.compile('(?#)')), True)
+        self.assertEqual(bool(regex.compile('(?x)(?#)')), True)
+
+        # Git issue 394: Unexpected behaviour in fuzzy matching with limited character set with IGNORECASE flag
+        self.assertEqual(regex.findall(r'(\d+){i<=2:[ab]}', '123X4Y5'),
+          ['123', '4', '5'])
+        self.assertEqual(regex.findall(r'(?i)(\d+){i<=2:[ab]}', '123X4Y5'),
+          ['123', '4', '5'])
+
+        # Git issue 403: Fuzzy matching with wrong distance (unnecessary substitutions)
+        self.assertEqual(regex.match(r'^(test){e<=5}$', 'terstin',
+          flags=regex.B).fuzzy_counts, (0, 3, 0))
+
+        # Git issue 408: regex fails with a quantified backreference but succeeds with repeated backref
+        self.assertEqual(bool(regex.match(r"(?:(x*)\1\1\1)*x$", "x" * 5)), True)
+        self.assertEqual(bool(regex.match(r"(?:(x*)\1{3})*x$", "x" * 5)), True)
+
+        # Git issue 415: Fuzzy character restrictions don't apply to insertions at "right edge"
+        self.assertEqual(regex.match(r't(?:es){s<=1:\d}t', 'te5t').group(),
+          'te5t')
+        self.assertEqual(regex.match(r't(?:es){s<=1:\d}t', 'tezt'), None)
+        self.assertEqual(regex.match(r't(?:es){i<=1:\d}t', 'tes5t').group(),
+          'tes5t')
+        self.assertEqual(regex.match(r't(?:es){i<=1:\d}t', 'teszt'), None)
+        self.assertEqual(regex.match(r't(?:es){i<=1:\d}t',
+          'tes5t').fuzzy_changes, ([], [3], []))
+        self.assertEqual(regex.match(r't(es){i<=1,0<e<=1}t', 'tes5t').group(),
+          'tes5t')
+        self.assertEqual(regex.match(r't(?:es){i<=1,0<e<=1:\d}t',
+          'tes5t').fuzzy_changes, ([], [3], []))
+
+        # Git issue 421: Fatal Python error: Segmentation fault
+        self.assertEqual(regex.compile(r"(\d+ week|\d+ days)").split("7 days"), ['', '7 days', ''])
+        self.assertEqual(regex.compile(r"(\d+ week|\d+ days)").split("10 days"), ['', '10 days', ''])
+
+        self.assertEqual(regex.compile(r"[ ]* Name[ ]*\* ").search("  Name *"), None)
+
+        self.assertEqual(regex.compile('a|\\.*pb\\.py').search('.geojs'), None)
+
+        p = regex.compile('(?<=(?:\\A|\\W|_))(\\d+ decades? ago|\\d+ minutes ago|\\d+ seconds ago|in \\d+ decades?|\\d+ months ago|in \\d+ minutes|\\d+ minute ago|in \\d+ seconds|\\d+ second ago|\\d+ years ago|in \\d+ months|\\d+ month ago|\\d+ weeks ago|\\d+ hours ago|in \\d+ minute|in \\d+ second|in \\d+ years|\\d+ year ago|in \\d+ month|in \\d+ weeks|\\d+ week ago|\\d+ days ago|in \\d+ hours|\\d+ hour ago|in \\d+ year|in \\d+ week|in \\d+ days|\\d+ day ago|in \\d+ hour|\\d+ min ago|\\d+ sec ago|\\d+ yr ago|\\d+ mo ago|\\d+ wk ago|in \\d+ day|\\d+ hr ago|in \\d+ min|in \\d+ sec|in \\d+ yr|in \\d+ mo|in \\d+ wk|in \\d+ hr)(?=(?:\\Z|\\W|_))', flags=regex.I | regex.V0)
+        self.assertEqual(p.search('1 month ago').group(), '1 month ago')
+        self.assertEqual(p.search('9 hours 1 minute ago').group(), '1 minute ago')
+        self.assertEqual(p.search('10 months 1 hour ago').group(), '1 hour ago')
+        self.assertEqual(p.search('1 month 10 hours ago').group(), '10 hours ago')
+
+        # Git issue 427: Possible bug with BESTMATCH
+        sequence = 'TTCAGACGTGTGCTCTTCCGATCTCAATACCGACTCCTCACTGTGTGTCT'
+        pattern = r'(?P<insert>.*)(?P<anchor>CTTCC){e<=1}(?P<umi>([ACGT]){4,6})(?P<sid>CAATACCGACTCCTCACTGTGT){e<=2}(?P<end>([ACGT]){0,6}$)'
+
+        m = regex.match(pattern, sequence, flags=regex.BESTMATCH)
+        self.assertEqual(m.span(), (0, 50))
+        self.assertEqual(m.groupdict(), {'insert': 'TTCAGACGTGTGCT', 'anchor': 'CTTCC', 'umi': 'GATCT', 'sid': 'CAATACCGACTCCTCACTGTGT', 'end': 'GTCT'})
+
+        m = regex.match(pattern, sequence, flags=regex.ENHANCEMATCH)
+        self.assertEqual(m.span(), (0, 50))
+        self.assertEqual(m.groupdict(), {'insert': 'TTCAGACGTGTGCT', 'anchor': 'CTTCC', 'umi': 'GATCT', 'sid': 'CAATACCGACTCCTCACTGTGT', 'end': 'GTCT'})
+
+        # Git issue 433: Disagreement between fuzzy_counts and fuzzy_changes
+        pattern = r'(?P<insert>.*)(?P<anchor>AACACTGG){e<=1}(?P<umi>([AT][CG]){5}){e<=2}(?P<sid>GTAACCGAAG){e<=2}(?P<end>([ACGT]){0,6}$)'
+
+        sequence = 'GGAAAACACTGGTCTCAGTCTCGTAACCGAAGTGGTCG'
+        m = regex.match(pattern, sequence, flags=regex.BESTMATCH)
+        self.assertEqual(m.fuzzy_counts, (0, 0, 0))
+        self.assertEqual(m.fuzzy_changes, ([], [], []))
+
+        sequence = 'GGAAAACACTGGTCTCAGTCTCGTCCCCGAAGTGGTCG'
+        m = regex.match(pattern, sequence, flags=regex.BESTMATCH)
+        self.assertEqual(m.fuzzy_counts, (2, 0, 0))
+        self.assertEqual(m.fuzzy_changes, ([24, 25], [], []))
+
+        # Git issue 439: Unmatched groups: sub vs subf
+        self.assertEqual(regex.sub(r'(test1)|(test2)', r'matched: \1\2', 'test1'), 'matched: test1')
+        self.assertEqual(regex.subf(r'(test1)|(test2)', r'matched: {1}{2}', 'test1'), 'matched: test1')
+        self.assertEqual(regex.search(r'(test1)|(test2)', 'matched: test1').expand(r'matched: \1\2'), 'matched: test1'),
+        self.assertEqual(regex.search(r'(test1)|(test2)', 'matched: test1').expandf(r'matched: {1}{2}'), 'matched: test1')
+
+        # Git issue 442: Fuzzy regex matching doesn't seem to test insertions correctly
+        self.assertEqual(regex.search(r"(?:\bha\b){i:[ ]}", "having"), None)
+        self.assertEqual(regex.search(r"(?:\bha\b){i:[ ]}", "having", flags=regex.I), None)
+
+        # Git issue 467: Scoped inline flags 'a', 'u' and 'L' affect global flags
+        self.assertEqual(regex.match(r'(?a:\w)\w', 'd\N{CYRILLIC SMALL LETTER ZHE}').span(), (0, 2))
+        self.assertEqual(regex.match(r'(?a:\w)(?u:\w)', 'd\N{CYRILLIC SMALL LETTER ZHE}').span(), (0, 2))
+
+        # Git issue 473: Emoji classified as letter
+        self.assertEqual(regex.match(r'^\p{LC}+$', '\N{SMILING CAT FACE WITH OPEN MOUTH}'), None)
+        self.assertEqual(regex.match(r'^\p{So}+$', '\N{SMILING CAT FACE WITH OPEN MOUTH}').span(), (0, 1))
+
+        # Git issue 474: regex has no equivalent to `re.Match.groups()` for captures
+        self.assertEqual(regex.match(r'(.)+', 'abc').allcaptures(), (['abc'], ['a', 'b', 'c']))
+        self.assertEqual(regex.match(r'(.)+', 'abc').allspans(), ([(0, 3)], [(0, 1), (1, 2), (2, 3)]))
+
+        # Git issue 477: \v for vertical spacing
+        self.assertEqual(bool(regex.fullmatch(r'\p{HorizSpace}+', '\t \xA0\u1680\u180E\u2000\u2001\u2002\u2003\u2004\u2005\u2006\u2007\u2008\u2009\u200A\u202F\u205F\u3000')), True)
+        self.assertEqual(bool(regex.fullmatch(r'\p{VertSpace}+', '\n\v\f\r\x85\u2028\u2029')), True)
+
+        # Git issue 479: Segmentation fault when using conditional pattern
+        self.assertEqual(regex.match(r'(?(?<=A)|(?(?![^B])C|D))', 'A'), None)
+        self.assertEqual(regex.search(r'(?(?<=A)|(?(?![^B])C|D))', 'A').span(), (1, 1))
+
+        # Git issue 494: Backtracking failure matching regex ^a?(a?)b?c\1$ against string abca
+        self.assertEqual(regex.search(r"^a?(a?)b?c\1$", "abca").span(), (0, 4))
+
+        # Git issue 498: Conditional negative lookahead inside positive lookahead fails to match
+        self.assertEqual(regex.match(r'(?(?=a).|..)', 'ab').span(), (0, 1))
+        self.assertEqual(regex.match(r'(?(?=b).|..)', 'ab').span(), (0, 2))
+        self.assertEqual(regex.match(r'(?(?!a).|..)', 'ab').span(), (0, 2))
+        self.assertEqual(regex.match(r'(?(?!b).|..)', 'ab').span(), (0, 1))
+
+        # Git issue 525: segfault when fuzzy matching empty list
+        self.assertEqual(regex.match(r"(\L<foo>){e<=5}", "blah", foo=[]).span(), (0, 0))
+
+        # Git issue 527: `VERBOSE`/`X` flag breaks `\N` escapes
+        self.assertEqual(regex.compile(r'\N{LATIN SMALL LETTER A}').match('a').span(), (0, 1))
+        self.assertEqual(regex.compile(r'\N{LATIN SMALL LETTER A}', flags=regex.X).match('a').span(), (0, 1))
+
+        # Git issue 539: Bug: Partial matching fails on a simple example
+        self.assertEqual(regex.match(r"[^/]*b/ccc", "b/ccc", partial=True).span(), (0, 5))
+        self.assertEqual(regex.match(r"[^/]*b/ccc", "b/ccb", partial=True), None)
+        self.assertEqual(regex.match(r"[^/]*b/ccc", "b/cc", partial=True).span(), (0, 4))
+        self.assertEqual(regex.match(r"[^/]*b/xyz", "b/xy", partial=True).span(), (0, 4))
+        self.assertEqual(regex.match(r"[^/]*b/xyz", "b/yz", partial=True), None)
+
+        self.assertEqual(regex.match(r"(?i)[^/]*b/ccc", "b/ccc", partial=True).span(), (0, 5))
+        self.assertEqual(regex.match(r"(?i)[^/]*b/ccc", "b/ccb", partial=True), None)
+        self.assertEqual(regex.match(r"(?i)[^/]*b/ccc", "b/cc", partial=True).span(), (0, 4))
+        self.assertEqual(regex.match(r"(?i)[^/]*b/xyz", "b/xy", partial=True).span(), (0, 4))
+        self.assertEqual(regex.match(r"(?i)[^/]*b/xyz", "b/yz", partial=True), None)
+
+        # Git issue 546: Partial match not working in some instances with non-greedy capture
+        self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<', partial=True)), True)
+        self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking', partial=True)), True)
+        self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>', partial=True)), True)
+        self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>x', partial=True)), True)
+        self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>xyz abc', partial=True)), True)
+        self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>xyz abc foo', partial=True)), True)
+        self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>xyz abc foo ', partial=True)), True)
+        self.assertEqual(bool(regex.match(r'<thinking>.*?</thinking>', '<thinking>xyz abc foo bar', partial=True)), True)
+
+    def test_fuzzy_ext(self):
+        self.assertEqual(bool(regex.fullmatch(r'(?r)(?:a){e<=1:[a-z]}', 'e')),
+          True)
+        self.assertEqual(bool(regex.fullmatch(r'(?:a){e<=1:[a-z]}', 'e')),
+          True)
+        self.assertEqual(bool(regex.fullmatch(r'(?:a){e<=1:[a-z]}', '-')),
+          False)
+        self.assertEqual(bool(regex.fullmatch(r'(?r)(?:a){e<=1:[a-z]}', '-')),
+          False)
+
+        self.assertEqual(bool(regex.fullmatch(r'(?:a){e<=1:[a-z]}', 'ae')),
+          True)
+        self.assertEqual(bool(regex.fullmatch(r'(?r)(?:a){e<=1:[a-z]}',
+          'ae')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?:a){e<=1:[a-z]}', 'a-')),
+          False)
+        self.assertEqual(bool(regex.fullmatch(r'(?r)(?:a){e<=1:[a-z]}',
+          'a-')), False)
+
+        self.assertEqual(bool(regex.fullmatch(r'(?:ab){e<=1:[a-z]}', 'ae')),
+           True)
+        self.assertEqual(bool(regex.fullmatch(r'(?r)(?:ab){e<=1:[a-z]}',
+           'ae')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?:ab){e<=1:[a-z]}', 'a-')),
+           False)
+        self.assertEqual(bool(regex.fullmatch(r'(?r)(?:ab){e<=1:[a-z]}',
+           'a-')), False)
+
+        self.assertEqual(bool(regex.fullmatch(r'(a)\1{e<=1:[a-z]}', 'ae')),
+           True)
+        self.assertEqual(bool(regex.fullmatch(r'(?r)\1{e<=1:[a-z]}(a)',
+           'ea')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(a)\1{e<=1:[a-z]}', 'a-')),
+           False)
+        self.assertEqual(bool(regex.fullmatch(r'(?r)\1{e<=1:[a-z]}(a)',
+           '-a')), False)
+
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}',
+          'ts')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}',
+          'st')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}',
+          'st')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}',
+          'ts')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}',
+          '-s')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}',
+          's-')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}',
+          's-')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)(?:\N{LATIN SMALL LETTER SHARP S}){e<=1:[a-z]}',
+          '-s')), False)
+
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}',
+           'ssst')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}',
+           'ssts')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)\1{e<=1:[a-z]}(\N{LATIN SMALL LETTER SHARP S})',
+           'stss')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)\1{e<=1:[a-z]}(\N{LATIN SMALL LETTER SHARP S})',
+           'tsss')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}',
+           'ss-s')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}',
+           'sss-')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}',
+           '-s')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)(\N{LATIN SMALL LETTER SHARP S})\1{e<=1:[a-z]}',
+           's-')), False)
+
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(ss)\1{e<=1:[a-z]}',
+           '\N{LATIN SMALL LETTER SHARP S}ts')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(ss)\1{e<=1:[a-z]}',
+           '\N{LATIN SMALL LETTER SHARP S}st')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)\1{e<=1:[a-z]}(ss)',
+           'st\N{LATIN SMALL LETTER SHARP S}')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)\1{e<=1:[a-z]}(ss)',
+           'ts\N{LATIN SMALL LETTER SHARP S}')), True)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(ss)\1{e<=1:[a-z]}',
+           '\N{LATIN SMALL LETTER SHARP S}-s')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?fiu)(ss)\1{e<=1:[a-z]}',
+           '\N{LATIN SMALL LETTER SHARP S}s-')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)(ss)\1{e<=1:[a-z]}',
+           's-\N{LATIN SMALL LETTER SHARP S}')), False)
+        self.assertEqual(bool(regex.fullmatch(r'(?firu)(ss)\1{e<=1:[a-z]}',
+           '-s\N{LATIN SMALL LETTER SHARP S}')), False)
+
+    def test_subscripted_captures(self):
+        self.assertEqual(regex.match(r'(?P<x>.)+',
+          'abc').expandf('{0} {0[0]} {0[-1]}'), 'abc abc abc')
+        self.assertEqual(regex.match(r'(?P<x>.)+',
+          'abc').expandf('{1} {1[0]} {1[1]} {1[2]} {1[-1]} {1[-2]} {1[-3]}'),
+          'c a b c c b a')
+        self.assertEqual(regex.match(r'(?P<x>.)+',
+          'abc').expandf('{x} {x[0]} {x[1]} {x[2]} {x[-1]} {x[-2]} {x[-3]}'),
+          'c a b c c b a')
+
+        self.assertEqual(regex.subf(r'(?P<x>.)+', r'{0} {0[0]} {0[-1]}',
+          'abc'), 'abc abc abc')
+        self.assertEqual(regex.subf(r'(?P<x>.)+',
+          '{1} {1[0]} {1[1]} {1[2]} {1[-1]} {1[-2]} {1[-3]}', 'abc'),
+          'c a b c c b a')
+        self.assertEqual(regex.subf(r'(?P<x>.)+',
+          '{x} {x[0]} {x[1]} {x[2]} {x[-1]} {x[-2]} {x[-3]}', 'abc'),
+          'c a b c c b a')
+
+    def test_more_zerowidth(self):
+        if sys.version_info >= (3, 7, 0):
+            self.assertEqual(regex.split(r'\b|:+', 'a::bc'), ['', 'a', '', '',
+              'bc', ''])
+            self.assertEqual(regex.sub(r'\b|:+', '-', 'a::bc'), '-a---bc-')
+            self.assertEqual(regex.findall(r'\b|:+', 'a::bc'), ['', '', '::',
+              '', ''])
+            self.assertEqual([m.span() for m in regex.finditer(r'\b|:+',
+              'a::bc')], [(0, 0), (1, 1), (1, 3), (3, 3), (5, 5)])
+            self.assertEqual([m.span() for m in regex.finditer(r'(?m)^\s*?$',
+              'foo\n\n\nbar')], [(4, 4), (4, 5), (5, 5)])
+
+    def test_line_ending(self):
+      self.assertEqual(regex.findall(r'\R', '\r\n\n\x0B\f\r\x85\u2028\u2029'),
+        ['\r\n', '\n', '\x0B', '\f', '\r', '\x85', '\u2028', '\u2029'])
+      self.assertEqual(regex.findall(br'\R', b'\r\n\n\x0B\f\r\x85'), [b'\r\n',
+        b'\n', b'\x0B', b'\f', b'\r'])
+
+def test_main():
+    unittest.main(verbosity=2)
+
+if __name__ == "__main__":
+    test_main()