aboutsummaryrefslogtreecommitdiff
diff options
context:
space:
mode:
Diffstat
-rw-r--r--tests/integration/conftest.py24
-rw-r--r--tests/integration/test_data/pcorrs_data.json1039
-rw-r--r--tests/integration/test_partial_correlations.py5
3 files changed, 1066 insertions, 2 deletions
diff --git a/tests/integration/conftest.py b/tests/integration/conftest.py
index 4274233..90cf985 100644
--- a/tests/integration/conftest.py
+++ b/tests/integration/conftest.py
@@ -78,3 +78,27 @@ def db_conn():
#
# b.) Delete the test database
db_cursor.execute(f"DROP DATABASE IF EXISTS {test_db_name}")
+
+@pytest.fixture(scope="function")
+def db_conn_with_pcorrs_data(db_conn):
+ """Fixture with data for partial correlations tests"""
+ with open(
+ "tests/integration/test_data/pcorrs_data.json",
+ encoding="utf8") as data_file:
+ data = json.loads(data_file.read())
+ with db_conn.cursor() as cursor:
+ for item in data:
+ row_keys = item["rows"][0].keys()
+ query = (
+ f"INSERT INTO {item['dbtable']}({', '.join(row_keys)}) "
+ f"VALUES ({', '.join(['%s' for key in row_keys])})")
+ cursor.executemany(
+ query,
+ tuple(
+ tuple(row[key] for key in row_keys)
+ for row in item["rows"]))
+
+ yield db_conn
+
+ for item in data:
+ cursor.execute(f"DELETE FROM {item['dbtable']}")
diff --git a/tests/integration/test_data/pcorrs_data.json b/tests/integration/test_data/pcorrs_data.json
new file mode 100644
index 0000000..8f748fc
--- /dev/null
+++ b/tests/integration/test_data/pcorrs_data.json
@@ -0,0 +1,1039 @@
+[
+ {
+ "dbtable": "Phenotype",
+ "rows": [
+ {
+ "Id": 16472,
+ "Pre_publication_description": "Central nervous system, be ...",
+ "Post_publication_description": "Central nervous system, ...",
+ "Original_description": "Original post publication descrip ...",
+ "Units": "Unknown",
+ "Pre_publication_abbreviation": "Learning3",
+ "Post_publication_abbreviation": "Touches_N",
+ "Lab_code": null,
+ "Submitter": "synomehbp",
+ "Owner": null,
+ "Authorized_Users": "synomehbp"
+ },
+ {
+ "Id": 16475,
+ "Pre_publication_description": "Central nervous system, be ...",
+ "Post_publication_description": "Central nervous system, b ...",
+ "Original_description": "Original post publication descrip ...",
+ "Units": "Unknown",
+ "Pre_publication_abbreviation": "Learning6",
+ "Post_publication_abbreviation": "Final_Pretrain_Blank_Latency_S",
+ "Lab_code": null,
+ "Submitter": "synomehbp",
+ "Owner": null,
+ "Authorized_Users": "synomehbp"
+ }]
+ },
+ {
+ "dbtable": "InbredSet",
+ "rows": [
+ {
+ "Id": 1,
+ "InbredSetId": 1,
+ "InbredSetName": "BXD",
+ "Name": "BXD",
+ "SpeciesId": 1,
+ "FullName": "BXD Family",
+ "public": 2,
+ "MappingMethodId": 1,
+ "GeneticType": "riset",
+ "Family": "Reference Populations",
+ "FamilyOrder": 1,
+ "MenuOrderId": 0,
+ "InbredSetCode": "BXD"
+ }]
+ },
+ {
+ "dbtable": "PublishXRef",
+ "rows": [
+ {
+ "Id": 17937,
+ "InbredSetId": 1,
+ "PhenotypeId": 16472,
+ "PublicationId": 13554,
+ "DataId": 41005366,
+ "mean": 229.93754196166992,
+ "Locus": "16p_no_data",
+ "LRS": 23.7705104960664,
+ "additive": -46.0108582181818,
+ "Sequence": 1,
+ "comments": "a publish trait"
+ },
+ {
+ "Id": 17940,
+ "InbredSetId": 1,
+ "PhenotypeId": 16475,
+ "PublicationId": 13557,
+ "DataId": 41005369,
+ "mean": 8.97237495581309,
+ "Locus": "rs30305830",
+ "LRS": 18.3037843139756,
+ "additive": -1.79666089108911,
+ "Sequence": 1,
+ "comments": "a publish trait"
+ }]
+ },
+ {
+ "dbtable": "Publication",
+ "rows": [
+ {
+ "Id": 13554,
+ "PubMed_ID": null,
+ "Abstract": "SYNOME (Partner 97). Since April 2014, when ...",
+ "Authors": "Horner A, Kopanitsa M, McLaren R, Human Brain Project Task 1.1.7",
+ "Title": "HBP MAPGENCO BXD study",
+ "Journal": null,
+ "Volume": null,
+ "Pages": null,
+ "Month": null,
+ "Year": 2015
+ },
+ {
+ "Id": 13557,
+ "PubMed_ID": null,
+ "Abstract": "SYNOME (Partner 97). Since April 2014, when ...",
+ "Authors": "Horner A, Kopanitsa M, McLaren R, Human Brain Project Task 1.1.7",
+ "Title": "HBP MAPGENCO BXD study",
+ "Journal": null,
+ "Volume": null,
+ "Pages": null,
+ "Month": null,
+ "Year": 2015
+ }]
+ },
+ {
+ "dbtable": "PublishFreeze",
+ "rows": [
+ {
+ "Id": 1,
+ "Name": "BXDPublish",
+ "FullName": "BXD Published Phenotypes",
+ "ShortName": "BXDPublish",
+ "CreateTime": "2004-07-17",
+ "public": 2,
+ "InbredSetId": 1,
+ "confidentiality": 0,
+ "AuthorisedUsers": null
+ }
+ ]
+ },
+ {
+ "dbtable": "ProbeSet",
+ "rows": [
+ {
+ "Id": 162363,
+ "ChipId":7,
+ "Name": "ILM105290026",
+ "TargetId": "GI_38090455-S",
+ "Symbol": "Gm1151",
+ "description": "gene model 1151, (NCBI)",
+ "Chr": 10,
+ "Mb":36.833229,
+ "Chr_2016": 10,
+ "Mb_2016": 36.553035,
+ "alias": "",
+ "GeneId": 382362,
+ "GenbankId": null,
+ "SNP": null,
+ "BlatSeq": "GATGGTGACCGTCTTATCACAGAACCTCTGCCGGAACTACAGCTGGTGGA",
+ "TargetSeq": "",
+ "UniGeneId": null,
+ "Strand_Probe": "+",
+ "Strand_Gene": null,
+ "OMIM": "",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": 5,
+ "Probe_set_BLAT_score": 50,
+ "Probe_set_Blat_Mb_start": 36.833229,
+ "Probe_set_Blat_Mb_end": 36.833279,
+ "Probe_set_Blat_Mb_start_2016": 36.553035,
+ "Probe_set_Blat_Mb_end_2016": 36.553085,
+ "Probe_set_strand": "+",
+ "Probe_set_Note_by_RW": null,
+ "flag": 0,
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": 10,
+ "name_num": 4294967290,
+ "Probe_Target_Description": "exon 5",
+ "RefSeq_TranscriptId": "XM_356462",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": 10,
+ "Mb_mm8": 36.522645,
+ "Probe_set_Blat_Mb_start_mm8": 36.522645,
+ "Probe_set_Blat_Mb_end_mm8": 36.522695,
+ "HomoloGeneID": null,
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162364",
+ "ChipId": "7",
+ "Name": "ILM610369",
+ "TargetId": "scl0011717.2_283-S",
+ "Symbol": "Ampd3",
+ "description": "AMP deaminase 3",
+ "Chr": "7",
+ "Mb": "110.80792",
+ "Chr_2016": "7",
+ "Mb_2016": "117.951434",
+ "alias": "",
+ "GeneId": "11717",
+ "GenbankId": "D88994|D85596|BC056380|BC040366|BC007183|AK133465|",
+ "SNP": null,
+ "BlatSeq": "ACCGATGACCCCATGCAGTTTCACTACACAAAGAAGCGCTCATGGAGGAG",
+ "TargetSeq": "TACATGTCTCTCTCTCTACCGATGACCCCATGCAGTTTCACTACACAAAGAAGCGCTCATGGAGGAGTAC",
+ "UniGeneId": "Mm.3238",
+ "Strand_Probe": "+",
+ "Strand_Gene": "+",
+ "OMIM": "102772",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "33",
+ "Probe_set_Blat_Mb_start": "110.80792",
+ "Probe_set_Blat_Mb_end": "110.807953",
+ "Probe_set_Blat_Mb_start_2016": "117.951434",
+ "Probe_set_Blat_Mb_end_2016": "117.951467",
+ "Probe_set_strand": "+",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "7",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "exon 14",
+ "RefSeq_TranscriptId": "NM_009667",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "7",
+ "Mb_mm8": "110.599097",
+ "Probe_set_Blat_Mb_start_mm8": "110.599097",
+ "Probe_set_Blat_Mb_end_mm8": "110.59913",
+ "HomoloGeneID": "408",
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162365",
+ "ChipId": "7",
+ "Name": "ILM1450014",
+ "TargetId": "scl52892.1.1_103-S",
+ "Symbol": "D830016O14Rik",
+ "description": "RIKEN cDNA D830016O14 gene",
+ "Chr": "19",
+ "Mb": "7.325407",
+ "Chr_2016": "19",
+ "Mb_2016": "7.399897",
+ "alias": "",
+ "GeneId": "319413",
+ "GenbankId": null,
+ "SNP": null,
+ "BlatSeq": "GGTGTCTTTAACAAATCCCTCCAAAGTGAGCTTAATTTGACAAACATGGA",
+ "TargetSeq": "AAAAGACTTTGGTGTCTTTAACAAATCCCTCCAAAGTGAGCTTAATTTGACAAACATGGAAATAAAAGCT",
+ "UniGeneId": null,
+ "Strand_Probe": "-",
+ "Strand_Gene": null,
+ "OMIM": "",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "50",
+ "Probe_set_Blat_Mb_start": "7.325407",
+ "Probe_set_Blat_Mb_end": "7.325457",
+ "Probe_set_Blat_Mb_start_2016": "7.399897",
+ "Probe_set_Blat_Mb_end_2016": "7.399947",
+ "Probe_set_strand": "-",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "19",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "intron 2",
+ "RefSeq_TranscriptId": "NM_176907",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "19",
+ "Mb_mm8": "7.392451",
+ "Probe_set_Blat_Mb_start_mm8": "7.392451",
+ "Probe_set_Blat_Mb_end_mm8": "7.392501",
+ "HomoloGeneID": null,
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162366",
+ "ChipId": "7",
+ "Name": "ILM380019",
+ "TargetId": "scl0012946.2_3-S",
+ "Symbol": "Crry",
+ "description": "complement receptor related protein",
+ "Chr": "1",
+ "Mb": "195.131336",
+ "Chr_2016": "1",
+ "Mb_2016": "196.95753",
+ "alias": "MGC102484; Mcp; mCRY",
+ "GeneId": "12946",
+ "GenbankId": null,
+ "SNP": null,
+ "BlatSeq": "CGGAACCCAGCGCCATTTCTGGGTGGGACTGCTTTCTACACCATTTGCCG",
+ "TargetSeq": "AGAGGAAGTTTTATTCCGGAACCCAGCGCCATTTCTGGGTGGGACTGCTTTCTACACCATTTGCCGTAAA",
+ "UniGeneId": "Mm.301652",
+ "Strand_Probe": "-",
+ "Strand_Gene": "-",
+ "OMIM": "",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "50",
+ "Probe_set_Blat_Mb_start": "195.131336",
+ "Probe_set_Blat_Mb_end": "195.131386",
+ "Probe_set_Blat_Mb_start_2016": "196.95753",
+ "Probe_set_Blat_Mb_end_2016": "196.95758",
+ "Probe_set_strand": "-",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "1",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "5' UTR",
+ "RefSeq_TranscriptId": "NM_013499",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "1",
+ "Mb_mm8": "196.83206",
+ "Probe_set_Blat_Mb_start_mm8": "196.83206",
+ "Probe_set_Blat_Mb_end_mm8": "196.83211",
+ "HomoloGeneID": null,
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162367",
+ "ChipId": "7",
+ "Name": "ILM100430441",
+ "TargetId": "scl18939.11_88-S",
+ "Symbol": "Ehf",
+ "description": "ets homologous factor",
+ "Chr": "2",
+ "Mb": "103.263355",
+ "Chr_2016": "2",
+ "Mb_2016": "103.103512",
+ "alias": "9030625L19Rik; AU019492; ESE3; ESEJ",
+ "GeneId": "13661",
+ "GenbankId": "BC008249|BC006789|BC005520|AF035527|",
+ "SNP": null,
+ "BlatSeq": "CCACCCTACAGACTAAATGTTGTAACAGAACATGGACAGCTTTGGTATCT",
+ "TargetSeq": "CCTTCCTTGGGATAATCCACCCTACAGACTAAATGTTGTAACAGAACATGGACAGCTTTGGTATCTGCTT",
+ "UniGeneId": "Mm.10724",
+ "Strand_Probe": "-",
+ "Strand_Gene": "-",
+ "OMIM": "605439",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "50",
+ "Probe_set_Blat_Mb_start": "103.263355",
+ "Probe_set_Blat_Mb_end": "103.263405",
+ "Probe_set_Blat_Mb_start_2016": "103.103512",
+ "Probe_set_Blat_Mb_end_2016": "103.103562",
+ "Probe_set_strand": "-",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "2",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "putative intergenic",
+ "RefSeq_TranscriptId": "NM_007914",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "2",
+ "Mb_mm8": "103.064194",
+ "Probe_set_Blat_Mb_start_mm8": "103.064194",
+ "Probe_set_Blat_Mb_end_mm8": "103.064244",
+ "HomoloGeneID": "3265",
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162368",
+ "ChipId": "7",
+ "Name": "ILM610088",
+ "TargetId": "scl45217.22.1_37-S",
+ "Symbol": "Dis3",
+ "description": "DIS3 mitotic control homolog (S. cerevisiae)",
+ "Chr": "14",
+ "Mb": "99.077306",
+ "Chr_2016": "14",
+ "Mb_2016": "99.476525",
+ "alias": "2810028N01Rik; DKFZp667L1817; FLJ10484; KIAA1008; MGC33035; RP11-342J4.3; RRP44; bA555G22.1; dis3p",
+ "GeneId": "72662",
+ "GenbankId": "BC027357|AK012840|",
+ "SNP": null,
+ "BlatSeq": "CTCAACAGCAACAAAATGGAGAGCATACTTACAGACTCCTGTGCGATAGC",
+ "TargetSeq": "CAGAACATCCAAAGACTCAACAGCAACAAAATGGAGAGCATACTTACAGACTCCTGTGCGATAGCTACTT",
+ "UniGeneId": "Mm.163339",
+ "Strand_Probe": "-",
+ "Strand_Gene": "-",
+ "OMIM": "607533",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "50",
+ "Probe_set_Blat_Mb_start": "99.077306",
+ "Probe_set_Blat_Mb_end": "99.077356",
+ "Probe_set_Blat_Mb_start_2016": "99.476525",
+ "Probe_set_Blat_Mb_end_2016": "99.476575",
+ "Probe_set_strand": "-",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "14",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "3' UTR",
+ "RefSeq_TranscriptId": "NM_028315",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "14",
+ "Mb_mm8": "97.96044",
+ "Probe_set_Blat_Mb_start_mm8": "97.96044",
+ "Probe_set_Blat_Mb_end_mm8": "97.96049",
+ "HomoloGeneID": "6910",
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162369",
+ "ChipId": "7",
+ "Name": "ILM870181",
+ "TargetId": "scl056379.2_58-S",
+ "Symbol": "Kcnj1",
+ "description": "potassium inwardly-rectifying channel, subfamily J, member 1",
+ "Chr": "9",
+ "Mb": "32.398853",
+ "Chr_2016": "9",
+ "Mb_2016": "32.206438",
+ "alias": "KIR1.1; Kir1.1; ROMK; ROMK-2; ROMK1; Romk2",
+ "GeneId": "56379",
+ "GenbankId": "BC020525|AF012834|",
+ "SNP": null,
+ "BlatSeq": "CCTGGAGTGTGTATGATGCTAACACCGAATGGTTCTTGTGTTTCTCTGCC",
+ "TargetSeq": "CAGCCTGGAGTGTGTATGATGCTAACACCGAATGGTTCTTGTGTTTCTCTGCCTAGTGGTTGAACTGCAA",
+ "UniGeneId": "Mm.390168",
+ "Strand_Probe": "+",
+ "Strand_Gene": "+",
+ "OMIM": "600359",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "50",
+ "Probe_set_Blat_Mb_start": "32.398853",
+ "Probe_set_Blat_Mb_end": "32.398903",
+ "Probe_set_Blat_Mb_start_2016": "32.206438",
+ "Probe_set_Blat_Mb_end_2016": "32.206488",
+ "Probe_set_strand": "+",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "9",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "3' UTR",
+ "RefSeq_TranscriptId": "NM_019659",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "9",
+ "Mb_mm8": "32.148418",
+ "Probe_set_Blat_Mb_start_mm8": "32.148418",
+ "Probe_set_Blat_Mb_end_mm8": "32.148468",
+ "HomoloGeneID": "56764",
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162370",
+ "ChipId": "7",
+ "Name": "ILM103060390",
+ "TargetId": "ri|D130099D04|PX00187M10|AK051805|1507-S",
+ "Symbol": "Scn3b",
+ "description": "sodium channel, voltage-gated, type III, beta",
+ "Chr": "9",
+ "Mb": "40.277854",
+ "Chr_2016": "9",
+ "Mb_2016": "40.085439",
+ "alias": "1110001K16Rik; 4833414B02Rik; HSA243396; SCNB3; Scnb3",
+ "GeneId": "235281",
+ "GenbankId": null,
+ "SNP": null,
+ "BlatSeq": "GCTCAGGGCCAGGGTCAGGGTCAGAGTGAGGGTCAATTTCGGTTCTGGTT",
+ "TargetSeq": "",
+ "UniGeneId": "Mm.290083",
+ "Strand_Probe": "+",
+ "Strand_Gene": null,
+ "OMIM": "608214",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "50",
+ "Probe_set_Blat_Mb_start": "40.277854",
+ "Probe_set_Blat_Mb_end": "40.277904",
+ "Probe_set_Blat_Mb_start_2016": "40.085439",
+ "Probe_set_Blat_Mb_end_2016": "40.085489",
+ "Probe_set_strand": "+",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "9",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "intron 4",
+ "RefSeq_TranscriptId": "NM_001083917",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "9",
+ "Mb_mm8": "40.028425",
+ "Probe_set_Blat_Mb_start_mm8": "40.028425",
+ "Probe_set_Blat_Mb_end_mm8": "40.028475",
+ "HomoloGeneID": "10176",
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162371",
+ "ChipId": "7",
+ "Name": "ILM4480390",
+ "TargetId": "scl0018933.1_65-S",
+ "Symbol": "Prrx1",
+ "description": "paired related homeobox 1",
+ "Chr": "1",
+ "Mb": "163.257817",
+ "Chr_2016": "1",
+ "Mb_2016": "165.187948",
+ "alias": "A230024N07Rik; AA755424; AI385634; AI843499; K-2; PHOX1; PMX1; PRX1; Pmx1; Prx1; mHox",
+ "GeneId": "18933",
+ "GenbankId": "X59725|U03873|L06502|",
+ "SNP": null,
+ "BlatSeq": "CTCAAGTCCTACTCAGGAGACGTGACTGCTGTGGAGCAACCCATCGTACC",
+ "TargetSeq": "CAATAAAAACGCTTCTCTCCTCAAGTCCTACTCAGGAGACGTGACTGCTGTGGAGCAACCCATCGTACCT",
+ "UniGeneId": "Mm.288642",
+ "Strand_Probe": "-",
+ "Strand_Gene": "-",
+ "OMIM": "167420",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "50",
+ "Probe_set_Blat_Mb_start": "163.257817",
+ "Probe_set_Blat_Mb_end": "163.257867",
+ "Probe_set_Blat_Mb_start_2016": "165.187948",
+ "Probe_set_Blat_Mb_end_2016": "165.187998",
+ "Probe_set_strand": "-",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "1",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "exon 3",
+ "RefSeq_TranscriptId": "NM_001025570",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "1",
+ "Mb_mm8": "165.094492",
+ "Probe_set_Blat_Mb_start_mm8": "165.094492",
+ "Probe_set_Blat_Mb_end_mm8": "165.094542",
+ "HomoloGeneID": "7896",
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ },
+ {
+ "Id": "162372",
+ "ChipId": "7",
+ "Name": "ILM101940014",
+ "TargetId": "ri|A430065A10|PX00137F11|AK040115|1649-S",
+ "Symbol": "Cd4",
+ "description": "CD4 antigen",
+ "Chr": "6",
+ "Mb": "124.867492",
+ "Chr_2016": "6",
+ "Mb_2016": "124.81751",
+ "alias": "CD4mut; L3T4; Ly-4",
+ "GeneId": "12504",
+ "GenbankId": "X04836|M36851|M36850|M17080|M17079|M17078|M17077|M17076|M13816|BC039137|AK161775|AK153966|AF045882|AC002397|",
+ "SNP": null,
+ "BlatSeq": "ACAGAGGTTGGAGATAGAAGTGAGGAGAGAGAGGGGTCCTGGGCTCTAGG",
+ "TargetSeq": "",
+ "UniGeneId": "Mm.2209",
+ "Strand_Probe": "-",
+ "Strand_Gene": "-",
+ "OMIM": "186940",
+ "comments": "",
+ "Probe_set_target_region": null,
+ "Probe_set_specificity": "5",
+ "Probe_set_BLAT_score": "50",
+ "Probe_set_Blat_Mb_start": "124.867492",
+ "Probe_set_Blat_Mb_end": "124.867542",
+ "Probe_set_Blat_Mb_start_2016": "124.81751",
+ "Probe_set_Blat_Mb_end_2016": "124.81756",
+ "Probe_set_strand": "-",
+ "Probe_set_Note_by_RW": null,
+ "flag": "0",
+ "Symbol_H": null,
+ "description_H": null,
+ "chromosome_H": null,
+ "MB_H": null,
+ "alias_H": null,
+ "GeneId_H": null,
+ "chr_num": "6",
+ "name_num": "4294967290",
+ "Probe_Target_Description": "intron 8",
+ "RefSeq_TranscriptId": "NM_013488",
+ "ENSEMBLGeneId": null,
+ "Chr_mm8": "6",
+ "Mb_mm8": "124.833111",
+ "Probe_set_Blat_Mb_start_mm8": "124.833111",
+ "Probe_set_Blat_Mb_end_mm8": "124.833161",
+ "HomoloGeneID": "513",
+ "Biotype_ENS": null,
+ "ProteinID": null,
+ "ProteinName": null,
+ "UniProtID": null,
+ "Flybase_Id": null,
+ "RGD_ID": null,
+ "HMDB_ID": null,
+ "Confidence": null,
+ "ChEBI_ID": null,
+ "ChEMBL_ID": null,
+ "CAS_number": null,
+ "PubChem_ID": null,
+ "ChemSpider_ID": null,
+ "UNII_ID": null,
+ "EC_number": null,
+ "KEGG_ID": null,
+ "Molecular_Weight": null,
+ "Nugowiki_ID": null,
+ "Type": null,
+ "Tissue": null,
+ "PrimaryName": null,
+ "SecondaryNames": null,
+ "PeptideSequence": null
+ }
+ ]
+ },
+ {
+ "dbtable": "ProbeFreeze",
+ "rows": [
+ {
+ "Id": 70,
+ "ProbeFreezeId": 70,
+ "ChipId": 7,
+ "TissueId": 22,
+ "Name": "UCLA BXD and BXH Cartilage v2",
+ "FullName": "",
+ "ShortName": "",
+ "CreateTime": "2008-09-19",
+ "InbredSetId": 1
+ }]
+ },
+ {
+ "dbtable": "ProbeSetFreeze",
+ "rows": [
+ {
+ "Id": 208,
+ "ProbeFreezeId": 70,
+ "AvgID": 8,
+ "Name": "UCLA_BXDBXH_CARTILAGE_V2",
+ "Name2": "UCLA_BXDBXH_CARTILAGE_V2",
+ "FullName": "UCLA BXD and BXH Cartilage v2",
+ "ShortName": "UCLA BXD and BXH Cartilage v2",
+ "CreateTime": "2008-09-19",
+ "OrderList": 1,
+ "public": 1,
+ "confidentiality": 0,
+ "AuthorisedUsers": "",
+ "DataScale": "log2"
+ }]
+ },
+ {
+ "dbtable": "ProbeSetXRef",
+ "rows": [
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162363,
+ "DataId": 36682455,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 6.456752523814815,
+ "se": null,
+ "Locus": "rs13481111",
+ "LRS": 9.14055192058577,
+ "pValue": 0.766,
+ "additive": 0.317877142857143,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162364,
+ "DataId": 36694754,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 6.770600282740741,
+ "se": null,
+ "Locus": "rs45702177",
+ "LRS": 9.93858530031785,
+ "pValue": 0.807,
+ "additive": -0.269377750000001,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162365,
+ "DataId": 36722457,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 5.662663275518519,
+ "se": null,
+ "Locus": "rs13476571",
+ "LRS": 9.48847562635838,
+ "pValue": 0.819,
+ "additive": 0.455515666666667,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162366,
+ "DataId": 36694938,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 9.016869263111111,
+ "se": null,
+ "Locus": "D17Mit49",
+ "LRS": 15.4322471324916,
+ "pValue": 0.256,
+ "additive": 0.694807555555555,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162367,
+ "DataId": 36708108,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 6.718528922370371,
+ "se": null,
+ "Locus": "rs30410261",
+ "LRS": 12.0753156129002,
+ "pValue": 0.471,
+ "additive": 0.178058453038674,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162368,
+ "DataId": 36719235,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 7.002730319481482,
+ "se": null,
+ "Locus": "rs13481905",
+ "LRS": 10.9885585995265,
+ "pValue": 0.692,
+ "additive": 0.43507425,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162369,
+ "DataId": 36703967,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 6.218555236666667,
+ "se": null,
+ "Locus": "rs30180803",
+ "LRS": 10.9500077249538,
+ "pValue": 0.535,
+ "additive": 0.448662250000001,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162370,
+ "DataId": 36689110,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 7.600573964407409,
+ "se": null,
+ "Locus": "rs33169019",
+ "LRS": 11.9566520135225,
+ "pValue": 0.578,
+ "additive": -0.598675833333333,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162371,
+ "DataId": 36695702,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 8.625563461407406,
+ "se": null,
+ "Locus": "rs33154273",
+ "LRS": 16.4292522865817,
+ "pValue": 0.751,
+ "additive": 0.671029166666667,
+ "h2": null
+ },
+ {
+ "ProbeSetFreezeId": 208,
+ "ProbeSetId": 162372,
+ "DataId": 36687105,
+ "Locus_old": null,
+ "LRS_old": null,
+ "pValue_old": null,
+ "mean": 7.485297168111107,
+ "se": null,
+ "Locus": "rs31238188",
+ "LRS": 14.6979417011059,
+ "pValue": 0.365,
+ "additive": 0.217527857142857,
+ "h2": null
+ }
+ ]
+ }
+]
diff --git a/tests/integration/test_partial_correlations.py b/tests/integration/test_partial_correlations.py
index d249b42..e047e3d 100644
--- a/tests/integration/test_partial_correlations.py
+++ b/tests/integration/test_partial_correlations.py
@@ -213,7 +213,7 @@ def test_partial_correlation_api_with_non_existent_control_traits(client, post_d
# traits data set to something we are in control of
)
def test_part_corr_api_with_mix_of_existing_and_non_existing_control_traits(
- db_conn, primary, controls, method, target):
+ db_conn_with_pcorrs_data, primary, controls, method, target):
"""
Check that calling the function with a mix of existing and missing control
traits raises an warning.
@@ -221,4 +221,5 @@ def test_part_corr_api_with_mix_of_existing_and_non_existing_control_traits(
criteria = 10
with pytest.warns(UserWarning):
partial_correlations_entry(
- db_conn, primary, controls, method, criteria, target)
+ db_conn_with_pcorrs_data, primary, controls, method, criteria,
+ target)
generated by cgit v1.2.3 (git 2.44.0) at 2024-11-21 19:49:32 +0000