Create a fixture for pcorrs datafixture-for-pcorrs

3 files changed, 1066 insertions, 2 deletions

diff --git a/tests/integration/conftest.py b/tests/integration/conftest.py
index 4274233..90cf985 100644
--- a/tests/integration/conftest.py
+++ b/tests/integration/conftest.py
@@ -78,3 +78,27 @@ def db_conn():
             #
             #   b.) Delete the test database
             db_cursor.execute(f"DROP DATABASE IF EXISTS {test_db_name}")
+
+@pytest.fixture(scope="function")
+def db_conn_with_pcorrs_data(db_conn):
+    """Fixture with data for partial correlations tests"""
+    with open(
+            "tests/integration/test_data/pcorrs_data.json",
+            encoding="utf8") as data_file:
+        data = json.loads(data_file.read())
+        with db_conn.cursor() as cursor:
+            for item in data:
+                row_keys = item["rows"][0].keys()
+                query = (
+                    f"INSERT INTO {item['dbtable']}({', '.join(row_keys)}) "
+                    f"VALUES ({', '.join(['%s' for key in row_keys])})")
+                cursor.executemany(
+                    query,
+                    tuple(
+                        tuple(row[key] for key in row_keys)
+                        for row in item["rows"]))
+
+            yield db_conn
+
+            for item in data:
+                cursor.execute(f"DELETE FROM {item['dbtable']}")
diff --git a/tests/integration/test_data/pcorrs_data.json b/tests/integration/test_data/pcorrs_data.json
new file mode 100644
index 0000000..8f748fc
--- /dev/null
+++ b/tests/integration/test_data/pcorrs_data.json
@@ -0,0 +1,1039 @@
+[
+    {
+	"dbtable": "Phenotype",
+	"rows": [
+	    {
+		"Id": 16472,
+		"Pre_publication_description": "Central nervous system, be ...",
+		"Post_publication_description": "Central nervous system, ...",
+		"Original_description": "Original post publication descrip ...",
+		"Units": "Unknown",
+		"Pre_publication_abbreviation": "Learning3",
+		"Post_publication_abbreviation": "Touches_N",
+		"Lab_code": null,
+		"Submitter": "synomehbp",
+		"Owner": null,
+		"Authorized_Users": "synomehbp"
+	    },
+	    {
+		"Id": 16475,
+		"Pre_publication_description": "Central nervous system, be ...",
+		"Post_publication_description": "Central nervous system, b ...",
+		"Original_description": "Original post publication descrip ...",
+		"Units": "Unknown",
+		"Pre_publication_abbreviation": "Learning6",
+		"Post_publication_abbreviation": "Final_Pretrain_Blank_Latency_S",
+		"Lab_code": null,
+		"Submitter": "synomehbp",
+		"Owner": null,
+		"Authorized_Users": "synomehbp"
+	    }]
+    },
+    {
+	"dbtable": "InbredSet",
+	"rows": [
+	    {
+		"Id": 1,
+		"InbredSetId": 1,
+		"InbredSetName": "BXD",
+		"Name": "BXD",
+		"SpeciesId": 1,
+		"FullName": "BXD Family",
+		"public": 2,
+		"MappingMethodId": 1,
+		"GeneticType": "riset",
+		"Family": "Reference Populations",
+		"FamilyOrder": 1,
+		"MenuOrderId": 0,
+		"InbredSetCode": "BXD"
+	    }]
+    },
+    {
+	"dbtable": "PublishXRef",
+	"rows": [
+	    {
+		"Id": 17937,
+		"InbredSetId": 1,
+		"PhenotypeId": 16472,
+		"PublicationId": 13554,
+		"DataId": 41005366,
+		"mean": 229.93754196166992,
+		"Locus": "16p_no_data",
+		"LRS": 23.7705104960664,
+		"additive": -46.0108582181818,
+		"Sequence": 1,
+		"comments": "a publish trait"
+	    },
+	    {
+		"Id": 17940,
+		"InbredSetId": 1,
+		"PhenotypeId": 16475,
+		"PublicationId": 13557,
+		"DataId": 41005369,
+		"mean": 8.97237495581309,
+		"Locus": "rs30305830",
+		"LRS": 18.3037843139756,
+		"additive": -1.79666089108911,
+		"Sequence": 1,
+		"comments": "a publish trait"
+	    }]
+    },
+    {
+	"dbtable": "Publication",
+	"rows": [
+	    {
+		"Id": 13554,
+		"PubMed_ID": null,
+		"Abstract": "SYNOME (Partner 97).  Since April 2014, when ...",
+		"Authors": "Horner A, Kopanitsa M, McLaren R, Human Brain Project Task 1.1.7",
+		"Title": "HBP MAPGENCO BXD study",
+		"Journal": null,
+		"Volume": null,
+		"Pages": null,
+		"Month": null,
+		"Year": 2015
+	    },
+	    {
+		"Id": 13557,
+		"PubMed_ID": null,
+		"Abstract": "SYNOME (Partner 97).  Since April 2014, when ...",
+		"Authors": "Horner A, Kopanitsa M, McLaren R, Human Brain Project Task 1.1.7",
+		"Title": "HBP MAPGENCO BXD study",
+		"Journal": null,
+		"Volume": null,
+		"Pages": null,
+		"Month": null,
+		"Year": 2015
+	    }]
+    },
+    {
+	"dbtable": "PublishFreeze",
+	"rows": [
+	    {
+		"Id": 1,
+		"Name": "BXDPublish",
+		"FullName": "BXD Published Phenotypes",
+		"ShortName": "BXDPublish",
+		"CreateTime": "2004-07-17",
+		"public": 2,
+		"InbredSetId": 1,
+		"confidentiality": 0,
+		"AuthorisedUsers": null
+	    }
+	]
+    },
+    {
+	"dbtable": "ProbeSet",
+	"rows": [
+	    {
+		"Id": 162363, 
+		"ChipId":7,
+		"Name": "ILM105290026",
+		"TargetId": "GI_38090455-S",
+		"Symbol": "Gm1151",
+		"description": "gene model 1151, (NCBI)",
+		"Chr": 10,
+		"Mb":36.833229,
+		"Chr_2016": 10,
+		"Mb_2016": 36.553035,
+		"alias": "",
+		"GeneId": 382362,
+		"GenbankId": null,
+		"SNP": null,
+		"BlatSeq": "GATGGTGACCGTCTTATCACAGAACCTCTGCCGGAACTACAGCTGGTGGA",
+		"TargetSeq": "",
+		"UniGeneId": null,
+		"Strand_Probe": "+",
+		"Strand_Gene": null,
+		"OMIM": "",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": 5,
+		"Probe_set_BLAT_score": 50,
+		"Probe_set_Blat_Mb_start": 36.833229,
+		"Probe_set_Blat_Mb_end": 36.833279,
+		"Probe_set_Blat_Mb_start_2016": 36.553035,
+		"Probe_set_Blat_Mb_end_2016": 36.553085,
+		"Probe_set_strand": "+",
+		"Probe_set_Note_by_RW": null,
+		"flag": 0,
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": 10,
+		"name_num": 4294967290,
+		"Probe_Target_Description": "exon 5",
+		"RefSeq_TranscriptId": "XM_356462",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": 10,
+		"Mb_mm8": 36.522645,
+		"Probe_set_Blat_Mb_start_mm8": 36.522645,
+		"Probe_set_Blat_Mb_end_mm8": 36.522695,
+		"HomoloGeneID": null,
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162364",
+		"ChipId": "7",
+		"Name": "ILM610369",
+		"TargetId": "scl0011717.2_283-S",
+		"Symbol": "Ampd3",
+		"description": "AMP deaminase 3",
+		"Chr": "7",
+		"Mb": "110.80792",
+		"Chr_2016": "7",
+		"Mb_2016": "117.951434",
+		"alias": "",
+		"GeneId": "11717",
+		"GenbankId": "D88994|D85596|BC056380|BC040366|BC007183|AK133465|",
+		"SNP": null,
+		"BlatSeq": "ACCGATGACCCCATGCAGTTTCACTACACAAAGAAGCGCTCATGGAGGAG",
+		"TargetSeq": "TACATGTCTCTCTCTCTACCGATGACCCCATGCAGTTTCACTACACAAAGAAGCGCTCATGGAGGAGTAC",
+		"UniGeneId": "Mm.3238",
+		"Strand_Probe": "+",
+		"Strand_Gene": "+",
+		"OMIM": "102772",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "33",
+		"Probe_set_Blat_Mb_start": "110.80792",
+		"Probe_set_Blat_Mb_end": "110.807953",
+		"Probe_set_Blat_Mb_start_2016": "117.951434",
+		"Probe_set_Blat_Mb_end_2016": "117.951467",
+		"Probe_set_strand": "+",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "7",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "exon 14",
+		"RefSeq_TranscriptId": "NM_009667",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "7",
+		"Mb_mm8": "110.599097",
+		"Probe_set_Blat_Mb_start_mm8": "110.599097",
+		"Probe_set_Blat_Mb_end_mm8": "110.59913",
+		"HomoloGeneID": "408",
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162365",
+		"ChipId": "7",
+		"Name": "ILM1450014",
+		"TargetId": "scl52892.1.1_103-S",
+		"Symbol": "D830016O14Rik",
+		"description": "RIKEN cDNA D830016O14 gene",
+		"Chr": "19",
+		"Mb": "7.325407",
+		"Chr_2016": "19",
+		"Mb_2016": "7.399897",
+		"alias": "",
+		"GeneId": "319413",
+		"GenbankId": null,
+		"SNP": null,
+		"BlatSeq": "GGTGTCTTTAACAAATCCCTCCAAAGTGAGCTTAATTTGACAAACATGGA",
+		"TargetSeq": "AAAAGACTTTGGTGTCTTTAACAAATCCCTCCAAAGTGAGCTTAATTTGACAAACATGGAAATAAAAGCT",
+		"UniGeneId": null,
+		"Strand_Probe": "-",
+		"Strand_Gene": null,
+		"OMIM": "",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "50",
+		"Probe_set_Blat_Mb_start": "7.325407",
+		"Probe_set_Blat_Mb_end": "7.325457",
+		"Probe_set_Blat_Mb_start_2016": "7.399897",
+		"Probe_set_Blat_Mb_end_2016": "7.399947",
+		"Probe_set_strand": "-",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "19",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "intron 2",
+		"RefSeq_TranscriptId": "NM_176907",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "19",
+		"Mb_mm8": "7.392451",
+		"Probe_set_Blat_Mb_start_mm8": "7.392451",
+		"Probe_set_Blat_Mb_end_mm8": "7.392501",
+		"HomoloGeneID": null,
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162366",
+		"ChipId": "7",
+		"Name": "ILM380019",
+		"TargetId": "scl0012946.2_3-S",
+		"Symbol": "Crry",
+		"description": "complement receptor related protein",
+		"Chr": "1",
+		"Mb": "195.131336",
+		"Chr_2016": "1",
+		"Mb_2016": "196.95753",
+		"alias": "MGC102484; Mcp; mCRY",
+		"GeneId": "12946",
+		"GenbankId": null,
+		"SNP": null,
+		"BlatSeq": "CGGAACCCAGCGCCATTTCTGGGTGGGACTGCTTTCTACACCATTTGCCG",
+		"TargetSeq": "AGAGGAAGTTTTATTCCGGAACCCAGCGCCATTTCTGGGTGGGACTGCTTTCTACACCATTTGCCGTAAA",
+		"UniGeneId": "Mm.301652",
+		"Strand_Probe": "-",
+		"Strand_Gene": "-",
+		"OMIM": "",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "50",
+		"Probe_set_Blat_Mb_start": "195.131336",
+		"Probe_set_Blat_Mb_end": "195.131386",
+		"Probe_set_Blat_Mb_start_2016": "196.95753",
+		"Probe_set_Blat_Mb_end_2016": "196.95758",
+		"Probe_set_strand": "-",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "1",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "5' UTR",
+		"RefSeq_TranscriptId": "NM_013499",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "1",
+		"Mb_mm8": "196.83206",
+		"Probe_set_Blat_Mb_start_mm8": "196.83206",
+		"Probe_set_Blat_Mb_end_mm8": "196.83211",
+		"HomoloGeneID": null,
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162367",
+		"ChipId": "7",
+		"Name": "ILM100430441",
+		"TargetId": "scl18939.11_88-S",
+		"Symbol": "Ehf",
+		"description": "ets homologous factor",
+		"Chr": "2",
+		"Mb": "103.263355",
+		"Chr_2016": "2",
+		"Mb_2016": "103.103512",
+		"alias": "9030625L19Rik; AU019492; ESE3; ESEJ",
+		"GeneId": "13661",
+		"GenbankId": "BC008249|BC006789|BC005520|AF035527|",
+		"SNP": null,
+		"BlatSeq": "CCACCCTACAGACTAAATGTTGTAACAGAACATGGACAGCTTTGGTATCT",
+		"TargetSeq": "CCTTCCTTGGGATAATCCACCCTACAGACTAAATGTTGTAACAGAACATGGACAGCTTTGGTATCTGCTT",
+		"UniGeneId": "Mm.10724",
+		"Strand_Probe": "-",
+		"Strand_Gene": "-",
+		"OMIM": "605439",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "50",
+		"Probe_set_Blat_Mb_start": "103.263355",
+		"Probe_set_Blat_Mb_end": "103.263405",
+		"Probe_set_Blat_Mb_start_2016": "103.103512",
+		"Probe_set_Blat_Mb_end_2016": "103.103562",
+		"Probe_set_strand": "-",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "2",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "putative intergenic",
+		"RefSeq_TranscriptId": "NM_007914",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "2",
+		"Mb_mm8": "103.064194",
+		"Probe_set_Blat_Mb_start_mm8": "103.064194",
+		"Probe_set_Blat_Mb_end_mm8": "103.064244",
+		"HomoloGeneID": "3265",
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162368",
+		"ChipId": "7",
+		"Name": "ILM610088",
+		"TargetId": "scl45217.22.1_37-S",
+		"Symbol": "Dis3",
+		"description": "DIS3 mitotic control homolog (S. cerevisiae)",
+		"Chr": "14",
+		"Mb": "99.077306",
+		"Chr_2016": "14",
+		"Mb_2016": "99.476525",
+		"alias": "2810028N01Rik; DKFZp667L1817; FLJ10484; KIAA1008; MGC33035; RP11-342J4.3; RRP44; bA555G22.1; dis3p",
+		"GeneId": "72662",
+		"GenbankId": "BC027357|AK012840|",
+		"SNP": null,
+		"BlatSeq": "CTCAACAGCAACAAAATGGAGAGCATACTTACAGACTCCTGTGCGATAGC",
+		"TargetSeq": "CAGAACATCCAAAGACTCAACAGCAACAAAATGGAGAGCATACTTACAGACTCCTGTGCGATAGCTACTT",
+		"UniGeneId": "Mm.163339",
+		"Strand_Probe": "-",
+		"Strand_Gene": "-",
+		"OMIM": "607533",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "50",
+		"Probe_set_Blat_Mb_start": "99.077306",
+		"Probe_set_Blat_Mb_end": "99.077356",
+		"Probe_set_Blat_Mb_start_2016": "99.476525",
+		"Probe_set_Blat_Mb_end_2016": "99.476575",
+		"Probe_set_strand": "-",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "14",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "3' UTR",
+		"RefSeq_TranscriptId": "NM_028315",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "14",
+		"Mb_mm8": "97.96044",
+		"Probe_set_Blat_Mb_start_mm8": "97.96044",
+		"Probe_set_Blat_Mb_end_mm8": "97.96049",
+		"HomoloGeneID": "6910",
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162369",
+		"ChipId": "7",
+		"Name": "ILM870181",
+		"TargetId": "scl056379.2_58-S",
+		"Symbol": "Kcnj1",
+		"description": "potassium inwardly-rectifying channel, subfamily J, member 1",
+		"Chr": "9",
+		"Mb": "32.398853",
+		"Chr_2016": "9",
+		"Mb_2016": "32.206438",
+		"alias": "KIR1.1; Kir1.1; ROMK; ROMK-2; ROMK1; Romk2",
+		"GeneId": "56379",
+		"GenbankId": "BC020525|AF012834|",
+		"SNP": null,
+		"BlatSeq": "CCTGGAGTGTGTATGATGCTAACACCGAATGGTTCTTGTGTTTCTCTGCC",
+		"TargetSeq": "CAGCCTGGAGTGTGTATGATGCTAACACCGAATGGTTCTTGTGTTTCTCTGCCTAGTGGTTGAACTGCAA",
+		"UniGeneId": "Mm.390168",
+		"Strand_Probe": "+",
+		"Strand_Gene": "+",
+		"OMIM": "600359",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "50",
+		"Probe_set_Blat_Mb_start": "32.398853",
+		"Probe_set_Blat_Mb_end": "32.398903",
+		"Probe_set_Blat_Mb_start_2016": "32.206438",
+		"Probe_set_Blat_Mb_end_2016": "32.206488",
+		"Probe_set_strand": "+",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "9",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "3' UTR",
+		"RefSeq_TranscriptId": "NM_019659",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "9",
+		"Mb_mm8": "32.148418",
+		"Probe_set_Blat_Mb_start_mm8": "32.148418",
+		"Probe_set_Blat_Mb_end_mm8": "32.148468",
+		"HomoloGeneID": "56764",
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162370",
+		"ChipId": "7",
+		"Name": "ILM103060390",
+		"TargetId": "ri|D130099D04|PX00187M10|AK051805|1507-S",
+		"Symbol": "Scn3b",
+		"description": "sodium channel, voltage-gated, type III, beta",
+		"Chr": "9",
+		"Mb": "40.277854",
+		"Chr_2016": "9",
+		"Mb_2016": "40.085439",
+		"alias": "1110001K16Rik; 4833414B02Rik; HSA243396; SCNB3; Scnb3",
+		"GeneId": "235281",
+		"GenbankId": null,
+		"SNP": null,
+		"BlatSeq": "GCTCAGGGCCAGGGTCAGGGTCAGAGTGAGGGTCAATTTCGGTTCTGGTT",
+		"TargetSeq": "",
+		"UniGeneId": "Mm.290083",
+		"Strand_Probe": "+",
+		"Strand_Gene": null,
+		"OMIM": "608214",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "50",
+		"Probe_set_Blat_Mb_start": "40.277854",
+		"Probe_set_Blat_Mb_end": "40.277904",
+		"Probe_set_Blat_Mb_start_2016": "40.085439",
+		"Probe_set_Blat_Mb_end_2016": "40.085489",
+		"Probe_set_strand": "+",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "9",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "intron 4",
+		"RefSeq_TranscriptId": "NM_001083917",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "9",
+		"Mb_mm8": "40.028425",
+		"Probe_set_Blat_Mb_start_mm8": "40.028425",
+		"Probe_set_Blat_Mb_end_mm8": "40.028475",
+		"HomoloGeneID": "10176",
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162371",
+		"ChipId": "7",
+		"Name": "ILM4480390",
+		"TargetId": "scl0018933.1_65-S",
+		"Symbol": "Prrx1",
+		"description": "paired related homeobox 1",
+		"Chr": "1",
+		"Mb": "163.257817",
+		"Chr_2016": "1",
+		"Mb_2016": "165.187948",
+		"alias": "A230024N07Rik; AA755424; AI385634; AI843499; K-2; PHOX1; PMX1; PRX1; Pmx1; Prx1; mHox",
+		"GeneId": "18933",
+		"GenbankId": "X59725|U03873|L06502|",
+		"SNP": null,
+		"BlatSeq": "CTCAAGTCCTACTCAGGAGACGTGACTGCTGTGGAGCAACCCATCGTACC",
+		"TargetSeq": "CAATAAAAACGCTTCTCTCCTCAAGTCCTACTCAGGAGACGTGACTGCTGTGGAGCAACCCATCGTACCT",
+		"UniGeneId": "Mm.288642",
+		"Strand_Probe": "-",
+		"Strand_Gene": "-",
+		"OMIM": "167420",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "50",
+		"Probe_set_Blat_Mb_start": "163.257817",
+		"Probe_set_Blat_Mb_end": "163.257867",
+		"Probe_set_Blat_Mb_start_2016": "165.187948",
+		"Probe_set_Blat_Mb_end_2016": "165.187998",
+		"Probe_set_strand": "-",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "1",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "exon 3",
+		"RefSeq_TranscriptId": "NM_001025570",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "1",
+		"Mb_mm8": "165.094492",
+		"Probe_set_Blat_Mb_start_mm8": "165.094492",
+		"Probe_set_Blat_Mb_end_mm8": "165.094542",
+		"HomoloGeneID": "7896",
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    },
+	    {
+		"Id": "162372",
+		"ChipId": "7",
+		"Name": "ILM101940014",
+		"TargetId": "ri|A430065A10|PX00137F11|AK040115|1649-S",
+		"Symbol": "Cd4",
+		"description": "CD4 antigen",
+		"Chr": "6",
+		"Mb": "124.867492",
+		"Chr_2016": "6",
+		"Mb_2016": "124.81751",
+		"alias": "CD4mut; L3T4; Ly-4",
+		"GeneId": "12504",
+		"GenbankId": "X04836|M36851|M36850|M17080|M17079|M17078|M17077|M17076|M13816|BC039137|AK161775|AK153966|AF045882|AC002397|",
+		"SNP": null,
+		"BlatSeq": "ACAGAGGTTGGAGATAGAAGTGAGGAGAGAGAGGGGTCCTGGGCTCTAGG",
+		"TargetSeq": "",
+		"UniGeneId": "Mm.2209",
+		"Strand_Probe": "-",
+		"Strand_Gene": "-",
+		"OMIM": "186940",
+		"comments": "",
+		"Probe_set_target_region": null,
+		"Probe_set_specificity": "5",
+		"Probe_set_BLAT_score": "50",
+		"Probe_set_Blat_Mb_start": "124.867492",
+		"Probe_set_Blat_Mb_end": "124.867542",
+		"Probe_set_Blat_Mb_start_2016": "124.81751",
+		"Probe_set_Blat_Mb_end_2016": "124.81756",
+		"Probe_set_strand": "-",
+		"Probe_set_Note_by_RW": null,
+		"flag": "0",
+		"Symbol_H": null,
+		"description_H": null,
+		"chromosome_H": null,
+		"MB_H": null,
+		"alias_H": null,
+		"GeneId_H": null,
+		"chr_num": "6",
+		"name_num": "4294967290",
+		"Probe_Target_Description": "intron 8",
+		"RefSeq_TranscriptId": "NM_013488",
+		"ENSEMBLGeneId": null,
+		"Chr_mm8": "6",
+		"Mb_mm8": "124.833111",
+		"Probe_set_Blat_Mb_start_mm8": "124.833111",
+		"Probe_set_Blat_Mb_end_mm8": "124.833161",
+		"HomoloGeneID": "513",
+		"Biotype_ENS": null,
+		"ProteinID": null,
+		"ProteinName": null,
+		"UniProtID": null,
+		"Flybase_Id": null,
+		"RGD_ID": null,
+		"HMDB_ID": null,
+		"Confidence": null,
+		"ChEBI_ID": null,
+		"ChEMBL_ID": null,
+		"CAS_number": null,
+		"PubChem_ID": null,
+		"ChemSpider_ID": null,
+		"UNII_ID": null,
+		"EC_number": null,
+		"KEGG_ID": null,
+		"Molecular_Weight": null,
+		"Nugowiki_ID": null,
+		"Type": null,
+		"Tissue": null,
+		"PrimaryName": null,
+		"SecondaryNames": null,
+		"PeptideSequence": null
+	    }
+	]
+    },
+    {
+	"dbtable": "ProbeFreeze",
+	"rows": [
+	    {
+		"Id": 70,
+		"ProbeFreezeId": 70,
+		"ChipId": 7,
+		"TissueId": 22,
+		"Name": "UCLA BXD and BXH Cartilage v2",
+		"FullName": "",
+		"ShortName": "",
+		"CreateTime": "2008-09-19",
+		"InbredSetId": 1
+	    }]
+    },
+    {
+	"dbtable": "ProbeSetFreeze",
+	"rows": [
+	    {
+		"Id": 208,
+		"ProbeFreezeId": 70,
+		"AvgID": 8,
+		"Name": "UCLA_BXDBXH_CARTILAGE_V2",
+		"Name2": "UCLA_BXDBXH_CARTILAGE_V2",
+		"FullName": "UCLA BXD and BXH Cartilage v2",
+		"ShortName": "UCLA BXD and BXH Cartilage v2",
+		"CreateTime": "2008-09-19",
+		"OrderList": 1,
+		"public": 1,
+		"confidentiality": 0,
+		"AuthorisedUsers": "",
+		"DataScale": "log2"
+	    }]
+    },
+    {
+	"dbtable": "ProbeSetXRef",
+	"rows": [
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162363,
+		"DataId": 36682455,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 6.456752523814815,
+		"se": null,
+		"Locus": "rs13481111",
+		"LRS": 9.14055192058577,
+		"pValue": 0.766,
+		"additive": 0.317877142857143,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162364,
+		"DataId": 36694754,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 6.770600282740741,
+		"se": null,
+		"Locus": "rs45702177",
+		"LRS": 9.93858530031785,
+		"pValue": 0.807,
+		"additive": -0.269377750000001,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162365,
+		"DataId": 36722457,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 5.662663275518519,
+		"se": null,
+		"Locus": "rs13476571",
+		"LRS": 9.48847562635838,
+		"pValue": 0.819,
+		"additive": 0.455515666666667,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162366,
+		"DataId": 36694938,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 9.016869263111111,
+		"se": null,
+		"Locus": "D17Mit49",
+		"LRS": 15.4322471324916,
+		"pValue": 0.256,
+		"additive": 0.694807555555555,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162367,
+		"DataId": 36708108,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 6.718528922370371,
+		"se": null,
+		"Locus": "rs30410261",
+		"LRS": 12.0753156129002,
+		"pValue": 0.471,
+		"additive": 0.178058453038674,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162368,
+		"DataId": 36719235,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 7.002730319481482,
+		"se": null,
+		"Locus": "rs13481905",
+		"LRS": 10.9885585995265,
+		"pValue": 0.692,
+		"additive": 0.43507425,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162369,
+		"DataId": 36703967,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 6.218555236666667,
+		"se": null,
+		"Locus": "rs30180803",
+		"LRS": 10.9500077249538,
+		"pValue": 0.535,
+		"additive": 0.448662250000001,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162370,
+		"DataId": 36689110,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 7.600573964407409,
+		"se": null,
+		"Locus": "rs33169019",
+		"LRS": 11.9566520135225,
+		"pValue": 0.578,
+		"additive": -0.598675833333333,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162371,
+		"DataId": 36695702,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 8.625563461407406,
+		"se": null,
+		"Locus": "rs33154273",
+		"LRS": 16.4292522865817,
+		"pValue": 0.751,
+		"additive": 0.671029166666667,
+		"h2": null
+	    },
+	    {
+		"ProbeSetFreezeId": 208,
+		"ProbeSetId": 162372,
+		"DataId": 36687105,
+		"Locus_old": null,
+		"LRS_old": null,
+		"pValue_old": null,
+		"mean": 7.485297168111107,
+		"se": null,
+		"Locus": "rs31238188",
+		"LRS": 14.6979417011059,
+		"pValue": 0.365,
+		"additive": 0.217527857142857,
+		"h2": null
+	    }
+	]
+    }
+]
diff --git a/tests/integration/test_partial_correlations.py b/tests/integration/test_partial_correlations.py
index d249b42..e047e3d 100644
--- a/tests/integration/test_partial_correlations.py
+++ b/tests/integration/test_partial_correlations.py
@@ -213,7 +213,7 @@ def test_partial_correlation_api_with_non_existent_control_traits(client, post_d
     #         traits data set to something we are in control of
      )
 def test_part_corr_api_with_mix_of_existing_and_non_existing_control_traits(
-        db_conn, primary, controls, method, target):
+        db_conn_with_pcorrs_data, primary, controls, method, target):
     """
     Check that calling the function with a mix of existing and missing control
     traits raises an warning.
@@ -221,4 +221,5 @@ def test_part_corr_api_with_mix_of_existing_and_non_existing_control_traits(
     criteria = 10
     with pytest.warns(UserWarning):
         partial_correlations_entry(
-            db_conn, primary, controls, method, criteria, target)
+            db_conn_with_pcorrs_data, primary, controls, method, criteria,
+            target)