diff options
-rw-r--r-- | api/GN3-REST-API-Implementation.md | 267 |
1 files changed, 239 insertions, 28 deletions
diff --git a/api/GN3-REST-API-Implementation.md b/api/GN3-REST-API-Implementation.md index 200ca72..0147fcb 100644 --- a/api/GN3-REST-API-Implementation.md +++ b/api/GN3-REST-API-Implementation.md @@ -1051,63 +1051,274 @@ Expected Result: { "@context": { "alias": "skos:altLabel", + "alignID": "gnt:hasAlignID", "blatMbEnd": "gnt:hasBlatMbEnd", - "blatMbEnd2016": "gnt:hasBlatMbEnd2016", "blatMbStart": "gnt:hasBlatMbStart", - "blatMbStart2016": "gnt:hasBlatMbStart2016", "blatScore": "gnt:hasBlatScore", "blatSeq": "gnt:hasBlatSeq", - "chebi": "gnt:hasChebiId", "chip": "gnt:hasChip", "chr": "gnt:chr", + "chromosome": "gnt:chromosome", + "comments": "rdfs:comments", "data": "@graph", "dct": "http://purl.org/dc/terms/", "description": "dct:description", + "gene": "gnt:gene", + "gnc": "http://genenetwork.org/category/", "gnt": "http://genenetwork.org/term/", - "homologene": "gnt:hasHomologeneId", "id": "@id", - "kegg": "gnt:hasKeggId", + "kgID": "gnt:hasKgID", + "location": "gnt:location", "mb": "gnt:mb", - "mb2016": "gnt:mb2016", - "mbMm8": "gnt:mbMm8", "name": "rdfs:label", - "omim": "gnt:hasOmimId", - "pubchem": "gnt:hasPubChemId", - "rdf": "http://www.w3.org/1999/02/22-rdf-syntax-ns#", + "rdf": "http://www.w3.org/1999/02/22-rdf-syntax-ns#>", "rdfs": "http://www.w3.org/2000/01/rdf-schema#", + "references": "dct:references", "skos": "http://www.w3.org/2004/02/skos/core#", + "species": "gnt:belongsToSpecies", "specificity": "gnt:hasSpecificity", + "strand": "gnt:Strand", + "strandProbe": "gnt:strandProbe", "symbol": "gnt:symbol", - "targetId": "gnt:hasTargetId", - "targetSeq": "gnt:hasTargetSeq", - "targetsRegion": "gnt:targetsRegion", + "targetID": "gnt:hasTargetId", + "targetRegion": "gnt:targetsRegion", + "targetSequence": "gnt:hasTargetSeq", + "transcript": "gnt:transcript", + "txEnd": "gnt:TxEnd", + "txStart": "gnt:TxStart", "type": "@type", - "uniprot": "gnt:hasUniprotId" + "unigenID": "gnt:hasUnigenID", + "uniprot": "gnt:uniprot" }, "alias": "HHG1; HLP3; HPE3; SMMCI; Dsh; Hhg1", "blatMbEnd": 28.4573, - "blatMbEnd2016": 28.7837, "blatMbStart": 28.4572, - "blatMbStart2016": 28.7837, "blatScore": "72", "blatSeq": "CATGGGGGTCCACAAATTATATTTTAATTTAACTATTTTCCAATGTAATAGCCGTCTTCTGTACTGCCTTCTT", - "chip": "Affy Mouse Genome 430 2.0 (GPL1261)", + "chip": { + "id": "http://genenetwork.org/id/platformMouse430_2", + "name": "Affy Mouse Genome 430 2.0 (GPL1261)" + }, "chr": "5", "description": "sonic hedgehog hedgehog", - "homologene": { - "id": "https://bio2rdf.org/homologene:30961" - }, "id": "http://genenetwork.org/id/probeset1436869_at", + "location": "Chr 5 @ 28.457155 on the minus strand", "mb": 28.4572, - "mb2016": 28.7837, - "mbMm8": 28.7879, "name": "1436869_at", - "omim": { - "id": "https://www.omim.org/entry/600725" - }, + "references": [ + { + "id": "http://www.ncbi.nlm.nih.gov/homologene/?term=30961" + }, + { + "id": "http://www.ncbi.nlm.nih.gov/omim/600725" + }, + { + "id": "http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids=20423" + } + ], "specificity": "3.6", - "symbol": "Shh", - "targetSeq": "catgggggtccacaaattatatttttatacacagaattgtanattanatttttgagagatcaatacctaantgaatgacatttcattttttgaaagtgtaaaatatgnaaatatattattttaatttaactattttccaatgtaatagccgtcttctgtactgccttctt", - "type": "http://genenetwork.org/category/Probeset" + "strandProbe": "-", + "symbol": { + "alignID": [ + "uc008wua.2", + "R17645" + ], + "chromosome": [ + "4", + "7", + "5" + ], + "description": "sonic hedgehog", + "gene": [ + { + "id": "http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids=6469" + }, + { + "id": "http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids=29499" + }, + { + "id": "http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids=20423" + } + ], + "gnt:hasProteinID": [ + "Q62226", + "SHH" + ], + "gnt:hasRgdID": "3673", + "id": "http://genenetwork.org/id/geneShh", + "kgID": [ + "L27340", + "uc008wua.2" + ], + "name": [ + "SHH", + "Shh" + ], + "references": [ + { + "comments": "Expression across many tissues and cell types", + "id": "http://biogps.org/?org=mouse#goto=genereport&id=20423", + "name": [ + "BioGPS", + "BioGPS Resource Link" + ] + }, + { + "comments": "GeneMANIA", + "id": "https://genemania.org/search/homo-sapiens/6469", + "name": "GeneMANIA" + }, + { + "id": "http://www.pantherdb.org/genes/geneList.do?searchType=basic&fieldName=all&organism=all&listType=1&fieldValue=SHH" + }, + { + "comments": "GTEx Portal", + "id": "https://www.gtexportal.org/home/gene/SHH", + "name": "GTEx Portal" + }, + { + "comments": "GTEx Portal", + "id": "https://www.gtexportal.org/home/gene/Shh", + "name": "GTEx Portal" + }, + { + "comments": "Human Protein Atlas", + "id": "http://www.proteinatlas.org/search/Shh", + "name": "Protein Atlas" + }, + { + "comments": "Meta-analysis of gene expression data", + "id": "http://www.chibi.ubc.ca/Gemma/gene/showGene.html?ncbiid=29499", + "name": "Gemma" + }, + { + "comments": "Rat Genome DB", + "id": "https://rgd.mcw.edu/rgdweb/elasticResults.html?term=Shh&category=Gene&species=Mouse", + "name": "Rat Genome DB" + }, + { + "comments": "Allen Brain Atlas", + "id": "http://mouse.brain-map.org/search/show?search_type=gene&search_term=", + "name": "ABA" + }, + { + "comments": "Protein interactions: known and inferred", + "id": "http://string-db.org/newstring_cgi/show_network_section.pl?identifier=SHH", + "name": "STRING" + }, + { + "comments": "EBI GWAS", + "id": "https://www.ebi.ac.uk/gwas/search?query=SHH", + "name": "EBI GWAS" + }, + { + "id": "http://www.pantherdb.org/genes/geneList.do?searchType=basic&fieldName=all&organism=all&listType=1&fieldValue=Shh" + }, + { + "comments": "GeneMANIA", + "id": "https://genemania.org/search/rattus-norvegicus/29499", + "name": "GeneMANIA" + }, + { + "comments": "EBI GWAS", + "id": "https://www.ebi.ac.uk/gwas/search?query=Shh", + "name": "EBI GWAS" + }, + { + "comments": "Meta-analysis of gene expression data", + "id": "http://www.chibi.ubc.ca/Gemma/gene/showGene.html?ncbiid=6469", + "name": "Gemma" + }, + { + "comments": "Rat Genome DB", + "id": "https://rgd.mcw.edu/rgdweb/elasticResults.html?term=SHH&category=Gene&species=Human", + "name": "Rat Genome DB" + }, + { + "comments": "Meta-analysis of gene expression data", + "id": "http://www.chibi.ubc.ca/Gemma/gene/showGene.html?ncbiid=20423", + "name": "Gemma" + }, + { + "comments": "GeneMANIA", + "id": "https://genemania.org/search/mus-musculus/20423", + "name": "GeneMANIA" + }, + { + "comments": "Expression across many tissues and cell types", + "id": "http://biogps.org/?org=human#goto=genereport&id=6469", + "name": [ + "BioGPS Resource Link", + "BioGPS" + ] + }, + { + "comments": "Expression across many tissues and cell types", + "id": "http://biogps.org/?org=rat#goto=genereport&id=29499", + "name": [ + "BioGPS Resource Link", + "BioGPS" + ] + }, + { + "comments": "Human Protein Atlas", + "id": "http://www.proteinatlas.org/search/SHH", + "name": "Protein Atlas" + }, + { + "comments": "Protein interactions: known and inferred", + "id": "http://string-db.org/newstring_cgi/show_network_section.pl?identifier=Shh", + "name": "STRING" + } + ], + "species": [ + { + "id": "http://genenetwork.org/id/Rat" + }, + { + "id": "http://genenetwork.org/id/Human" + }, + { + "id": "http://genenetwork.org/id/Rattus_norvegicus" + }, + { + "id": "http://genenetwork.org/id/Mouse" + } + ], + "strand": [ + "+", + "-" + ], + "transcript": [ + { + "id": "https://portals.broadinstitute.org/gpp/public/trans/details?transName=NM_017221" + }, + { + "id": "https://portals.broadinstitute.org/gpp/public/trans/details?transName=NM_009170" + }, + { + "id": "https://portals.broadinstitute.org/gpp/public/trans/details?transName=NM_000193" + } + ], + "txEnd": [ + 28.4671, + 0.727691, + 155.104, + 2.20966 + ], + "txStart": [ + 2.2005, + 0.718538, + 155.095, + 28.4568 + ], + "type": "gnc:GeneSymbol", + "unigenID": [ + "Mm.57202", + "Hs.164537" + ] + }, + "targetSequence": "catgggggtccacaaattatatttttatacacagaattgtanattanatttttgagagatcaatacctaantgaatgacatttcattttttgaaagtgtaaaatatgnaaatatattattttaatttaactattttccaatgtaatagccgtcttctgtactgccttctt", + "type": "gnc:Probeset" } ``` |