diff options
| -rw-r--r-- | rdf-documentation/dump-probeset.md | 62 | ||||
| -rw-r--r-- | rdf-documentation/dump-species-metadata.md | 130 | ||||
| -rw-r--r-- | rdf-documentation/dump-tissue.md | 20 |
3 files changed, 141 insertions, 71 deletions
diff --git a/rdf-documentation/dump-probeset.md b/rdf-documentation/dump-probeset.md new file mode 100644 index 0000000..5b4de63 --- /dev/null +++ b/rdf-documentation/dump-probeset.md @@ -0,0 +1,62 @@ +# ProbeSet Metadata +## 'dump-probeset' + +## Schema Triples: + +```text +gn-term:name -> rdfs:range -> rdfs:Literal +gn-term:probeset -> rdfs:range -> rdfs:Literal +``` +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT IFNULL(NULLIF(TRIM(ProbeSet.Name), ''), ProbeSet.Id) AS name, GeneChip.Name, ProbeSet.Name, ProbeSet.Symbol, ProbeSet.description, ProbeSet.Chr, IFNULL(ProbeSet.Mb, '') AS Mb, ProbeSet.BlatSeq, ProbeSet.TargetSeq, ProbeSet.UniProtID FROM ProbeSet LEFT JOIN GeneChip ON GeneChip.Id = ProbeSet.ChipId +``` + +The above query results to triples that have the form: + +```text +probeset:name -> rdf:type -> gn-id:probeset +probeset:name -> gn-term:chipOf -> gn-id:platform_genechip_name +probeset:name -> gn-term:name -> ProbeSet(Name) +probeset:name -> gn-term:symbol -> ProbeSet(Symbol) +probeset:name -> gn-term:description -> ProbeSetdescription +probeset:name -> gn-term:chr -> ProbeSet(Chr) +probeset:name -> gn-term:mb -> "Mb"^^xsd:double +probeset:name -> gn-term:blatSeq -> ProbeSetBlatSeq +probeset:name -> gn-term:targetSeq -> ProbeSetTargetSeq +probeset:name -> gn-term:uniProtReference -> uniprot:ProbeSet(UniProtID) +``` +Here's an example query: + +```sparql +@prefix probeset: <http://genenetwork.org/probeset/> . +@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> . +@prefix rdfs: <http://www.w3.org/2000/01/rdf-r . +@prefix uniprot: <http://purl.uniprot.org/uniprot/> . + +SELECT ?s ?p ?o WHERE { + ?s rdf:type gn-id:probeset . + ?s gn-term:chipOf gn-id:platform_mg_u74av2 . + ?s gn-term:name "MG_U74AV2" . + ?s gn-term:symbol "Cd3g" . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +probeset:100001_at rdf:type gn-id:probeset . +probeset:100001_at gn-term:chipOf gn-id:platform_mg_u74av2 . +probeset:100001_at gn-term:name "MG_U74AV2" . +probeset:100001_at gn-term:symbol "Cd3g" . +probeset:100001_at gn-term:description "CD3d antigen, gamma polypeptide" . +probeset:100001_at gn-term:chr "9" . +probeset:100001_at gn-term:mb "44.970689"^^xsd:double . +probeset:100001_at gn-term:blatSeq "CTCTGTTGCAAAATGAACAGCTGTACAGCCCCTCAAGGACCGGGAATATGACCAGTACAGCCATCTCCAAGGAAACCAACTGAGGAAGAAGTGAACTCAGCAGGACTCAGGGTGTCCCCACAATGCATTTTGGAGAGAGCCCAGACTGCAAGCAGAGAGGAAGAACTGAGGAAAACAAGCACAGCGTGGTGTT" . +probeset:100001_at gn-term:targetSeq "ctctgttgcaaaatgaacagctgtaccagcccctcaaggaccgggaatatgaccagtacagccatctccaaggaaaccaactgaggaagaagtgaactcagcaggactcagggtgtccccccttntatccagcacccagaatcaaaacaatgcattttggagagagcccagtagagagattttcaaccctacaggtagactgcaagcagagaggaagaactgtcaaagaaattttggtcttttttttttttttnncaaaataaaataaaagcttggaggagccagtggtatgantnnnnnntgnancanttgtcaaccttgtttggggttnncagcaccccacccccagaccccccaaaaaaattcagtgaaggaaaacaagcacagcgtggtgtt" . +``` + diff --git a/rdf-documentation/dump-species-metadata.md b/rdf-documentation/dump-species-metadata.md index 7c0f8be..ca09458 100644 --- a/rdf-documentation/dump-species-metadata.md +++ b/rdf-documentation/dump-species-metadata.md @@ -4,10 +4,10 @@ ## Schema Triples: ```text -gn:name -> rdfs:range -> rdfs:Literal -gn:displayName -> rdfs:range -> rdfs:Literal -gn:binomialName -> rdfs:range -> rdfs:Literal -gn:family -> rdfs:range -> rdfs:Literal +gn-term:name -> rdfs:range -> rdfs:Literal +gn-term:displayName -> rdfs:range -> rdfs:Literal +gn-term:binomialName -> rdfs:range -> rdfs:Literal +gn-term:family -> rdfs:range -> rdfs:Literal ``` ## Generated Triples: @@ -20,25 +20,26 @@ SELECT Species.FullName, Species.SpeciesName, Species.MenuName, Species.FullName The above query results to triples that have the form: ```text -gn:species_species_fullname_ -> rdf:type -> gn:species -gn:species_species_fullname_ -> gn:name -> Species(SpeciesName) -gn:species_species_fullname_ -> gn:displayName -> Species(MenuName) -gn:species_species_fullname_ -> gn:binomialName -> Species(FullName) -gn:species_species_fullname_ -> gn:family -> Species(Family) -gn:species_species_fullname_ -> gn:organism -> #{taxon:Species\x28;TaxonomyId\x29;}# +gn-id:Species_fullname -> rdf:type -> gn-id:species +gn-id:Species_fullname -> gn-term:name -> Species(SpeciesName) +gn-id:Species_fullname -> gn-term:displayName -> Species(MenuName) +gn-id:Species_fullname -> gn-term:binomialName -> Species(FullName) +gn-id:Species_fullname -> gn-term:family -> Species(Family) +gn-id:Species_fullname -> gn-term:organism -> taxon:Species(TaxonomyId) ``` Here's an example query: ```sparql -PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> -PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> -PREFIX gn: <http://genenetwork.org/terms/> -PREFIX taxon: <http://purl.uniprot.org/taxonomy/> +@prefix gn-id: <http://genenetwork.org/terms/> . +@prefix gn-term: <http://genenetwork.org/terms/> . +@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> . +@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . +@prefix taxon: <http://purl.uniprot.org/taxonomy/> . SELECT ?s ?p ?o WHERE { - ?s rdf:type gn:species . - ?s gn:name "Mouse" . - ?s gn:displayName "Mouse (Mus musculus, mm10)" . + ?s rdf:type gn-id:species . + ?s gn-term:name "Mouse" . + ?s gn-term:displayName "Mouse (Mus musculus, mm10)" . ?s ?p ?o . } ``` @@ -46,12 +47,12 @@ SELECT ?s ?p ?o WHERE { Expected Result: ```rdf -gn:species_mus_musculus rdf:type gn:species . -gn:species_mus_musculus gn:name "Mouse" . -gn:species_mus_musculus gn:displayName "Mouse (Mus musculus, mm10)" . -gn:species_mus_musculus gn:binomialName "Mus musculus" . -gn:species_mus_musculus gn:family "Vertebrates" . -gn:species_mus_musculus gn:organism taxon:10090 . +gn-id:Mus_musculus rdf:type gn-id:species . +gn-id:Mus_musculus gn-term:name "Mouse" . +gn-id:Mus_musculus gn-term:displayName "Mouse (Mus musculus, mm10)" . +gn-id:Mus_musculus gn-term:binomialName "Mus musculus" . +gn-id:Mus_musculus gn-term:family "Vertebrates" . +gn-id:Mus_musculus gn-term:organism taxon:10090 . ``` @@ -60,11 +61,11 @@ gn:species_mus_musculus gn:organism taxon:10090 . ## Schema Triples: ```text -gn:strainOfSpecies -> rdfs:domain -> gn:strain -gn:strainOfSpecies -> rdfs:range -> gn:species -gn:name -> rdfs:range -> rdfs:Literal -gn:alias -> rdfs:range -> rdfs:Literal -gn:symbol -> rdfs:range -> rdfs:Literal +gn-term:strainOfSpecies -> rdfs:domain -> gn-term:strain +gn-term:strainOfSpecies -> rdfs:range -> gn-term:species +gn-term:name -> rdfs:range -> rdfs:Literal +gn-term:alias -> rdfs:range -> rdfs:Literal +gn-term:symbol -> rdfs:range -> rdfs:Literal ``` ## Generated Triples: @@ -77,25 +78,26 @@ SELECT CAST(CONVERT(BINARY CONVERT(Strain.Name USING latin1) USING utf8) AS VARC The above query results to triples that have the form: ```text -gn:strain_strainname -> rdf:type -> gn:strain -gn:strain_strainname -> gn:strainOfSpecies -> gn:species_species_fullname_ -gn:strain_strainname -> gn:name -> StrainName -gn:strain_strainname -> gn:name -> StrainName2 -gn:strain_strainname -> gn:alias -> StrainAlias -gn:strain_strainname -> gn:symbol -> Strain(Symbol) +gn-id:Strainname -> rdf:type -> gn-id:strain +gn-id:Strainname -> gn-term:strainOfSpecies -> gn-id:Species_fullname +gn-id:Strainname -> gn-term:name -> StrainName +gn-id:Strainname -> gn-term:name2 -> StrainName2 +gn-id:Strainname -> gn-term:alias -> StrainAlias +gn-id:Strainname -> gn-term:symbol -> Strain(Symbol) ``` Here's an example query: ```sparql -PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> -PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> -PREFIX gn: <http://genenetwork.org/terms/> -PREFIX taxon: <http://purl.uniprot.org/taxonomy/> +@prefix gn-id: <http://genenetwork.org/terms/> . +@prefix gn-term: <http://genenetwork.org/terms/> . +@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> . +@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . +@prefix taxon: <http://purl.uniprot.org/taxonomy/> . SELECT ?s ?p ?o WHERE { - ?s rdf:type gn:strain . - ?s gn:strainOfSpecies gn:species_mus_musculus . - ?s gn:name "B6D2F1" . + ?s rdf:type gn-id:strain . + ?s gn-term:strainOfSpecies gn-id:Mus_musculus . + ?s gn-term:name "B6D2F1" . ?s ?p ?o . } ``` @@ -103,10 +105,10 @@ SELECT ?s ?p ?o WHERE { Expected Result: ```rdf -gn:strain_b6d2f1 rdf:type gn:strain . -gn:strain_b6d2f1 gn:strainOfSpecies gn:species_mus_musculus . -gn:strain_b6d2f1 gn:name "B6D2F1" . -gn:strain_b6d2f1 gn:name "B6D2F1" . +gn-id:B6d2f1 rdf:type gn-id:strain . +gn-id:B6d2f1 gn-term:strainOfSpecies gn-id:Mus_musculus . +gn-id:B6d2f1 gn-term:name "B6D2F1" . +gn-id:B6d2f1 gn-term:name2 "B6D2F1" . ``` @@ -127,17 +129,19 @@ SELECT MappingMethod.Name FROM MappingMethod The above query results to triples that have the form: ```text -gn:mappingMethod_mappingmethod_name_ -> rdf:type -> gn:mappingMethod +gn-id:mappingMethod_mappingmethod_name -> rdf:type -> gn-id:mappingMethod ``` Here's an example query: ```sparql -PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> -PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> -PREFIX gn: <http://genenetwork.org/terms/> -PREFIX taxon: <http://purl.uniprot.org/taxonomy/> +@prefix gn-id: <http://genenetwork.org/terms/> . +@prefix gn-term: <http://genenetwork.org/terms/> . +@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> . +@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . +@prefix taxon: <http://purl.uniprot.org/taxonomy/> . SELECT ?s ?p ?o WHERE { + ?s rdf:type gn-id:mappingMethod . ?s ?p ?o . } ``` @@ -145,7 +149,7 @@ SELECT ?s ?p ?o WHERE { Expected Result: ```rdf -gn:mappingMethod_qtlreaper rdf:type gn:mappingMethod . +gn-id:mappingMethod_qtlreaper rdf:type gn-id:mappingMethod . ``` @@ -154,32 +158,34 @@ gn:mappingMethod_qtlreaper rdf:type gn:mappingMethod . ## Schema Triples: ```text -gn:name -> rdfs:range -> rdfs:Literal +gn-term:normalization -> rdfs:range -> rdfs:Literal ``` ## Generated Triples: The following SQL query was executed: ```sql -SELECT AvgMethod.Name, AvgMethod.Name FROM AvgMethod +SELECT AvgMethod.Name, AvgMethod.Normalization FROM AvgMethod ``` The above query results to triples that have the form: ```text -gn:avgmethod_avgmethod_name_ -> rdf:type -> gn:avgMethod -gn:avgmethod_avgmethod_name_ -> gn:name -> AvgMethod(Name) +gn-id:avgmethod_avgmethod_name -> rdf:type -> gn-id:avgMethod +gn-id:avgmethod_avgmethod_name -> gn-term:normalization -> AvgMethod(Normalization) ``` Here's an example query: ```sparql -PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> -PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> -PREFIX gn: <http://genenetwork.org/terms/> -PREFIX taxon: <http://purl.uniprot.org/taxonomy/> +@prefix gn-id: <http://genenetwork.org/terms/> . +@prefix gn-term: <http://genenetwork.org/terms/> . +@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> . +@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . +@prefix taxon: <http://purl.uniprot.org/taxonomy/> . SELECT ?s ?p ?o WHERE { - ?s rdf:type gn:avgMethod . + ?s rdf:type gn-id:avgMethod . + ?s gn-term:normalization "MAS5" . ?s ?p ?o . } ``` @@ -187,7 +193,7 @@ SELECT ?s ?p ?o WHERE { Expected Result: ```rdf -gn:avgmethod_mas5 rdf:type gn:avgMethod . -gn:avgmethod_mas5 gn:name "MAS5" . +gn-id:avgmethod_mas5 rdf:type gn-id:avgMethod . +gn-id:avgmethod_mas5 gn-term:normalization "MAS5" . ``` diff --git a/rdf-documentation/dump-tissue.md b/rdf-documentation/dump-tissue.md index bfa2a76..dd64f83 100644 --- a/rdf-documentation/dump-tissue.md +++ b/rdf-documentation/dump-tissue.md @@ -4,7 +4,7 @@ ## Schema Triples: ```text -gn:name -> rdfs:range -> rdfs:Literal +gn-term:name -> rdfs:range -> rdfs:Literal ``` ## Generated Triples: @@ -17,18 +17,20 @@ SELECT Tissue.Short_Name, Tissue.Name FROM Tissue The above query results to triples that have the form: ```text -gn:tissue_tissue_short_name_ -> rdf:type -> gn:tissue -gn:tissue_tissue_short_name_ -> gn:name -> Tissue(Name) +gn-id:tissue_tissue_short_name -> rdf:type -> gn-id:tissue +gn-id:tissue_tissue_short_name -> gn-term:name -> Tissue(Name) ``` Here's an example query: ```sparql -PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> -PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> -PREFIX gn: <http://genenetwork.org/terms/> +@prefix gn-id: <http://genenetwork.org/terms/> . +@prefix gn-term: <http://genenetwork.org/terms/> . +@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> . +@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . SELECT ?s ?p ?o WHERE { - ?s rdf:type gn:tissue . + ?s rdf:type gn-id:tissue . + ?s gn-term:name "Brain mRNA" . ?s ?p ?o . } ``` @@ -36,7 +38,7 @@ SELECT ?s ?p ?o WHERE { Expected Result: ```rdf -gn:tissue_brn rdf:type gn:tissue . -gn:tissue_brn gn:name "Brain mRNA" . +gn-id:tissue_brn rdf:type gn-id:tissue . +gn-id:tissue_brn gn-term:name "Brain mRNA" . ``` |