Update auto-generated docs

3 files changed, 141 insertions, 71 deletions

diff --git a/rdf-documentation/dump-probeset.md b/rdf-documentation/dump-probeset.md
new file mode 100644
index 0000000..5b4de63
--- /dev/null
+++ b/rdf-documentation/dump-probeset.md
@@ -0,0 +1,62 @@
+# ProbeSet Metadata
+## 'dump-probeset'
+
+## Schema Triples:
+
+```text
+gn-term:name -> rdfs:range -> rdfs:Literal
+gn-term:probeset -> rdfs:range -> rdfs:Literal
+```
+## Generated Triples:
+
+The following SQL query was executed:
+
+```sql
+SELECT IFNULL(NULLIF(TRIM(ProbeSet.Name), ''), ProbeSet.Id) AS name, GeneChip.Name, ProbeSet.Name, ProbeSet.Symbol, ProbeSet.description, ProbeSet.Chr, IFNULL(ProbeSet.Mb, '') AS Mb, ProbeSet.BlatSeq, ProbeSet.TargetSeq, ProbeSet.UniProtID FROM ProbeSet LEFT JOIN GeneChip ON GeneChip.Id = ProbeSet.ChipId
+```
+
+The above query results to triples that have the form:
+
+```text
+probeset:name -> rdf:type -> gn-id:probeset 
+probeset:name -> gn-term:chipOf -> gn-id:platform_genechip_name 
+probeset:name -> gn-term:name -> ProbeSet(Name) 
+probeset:name -> gn-term:symbol -> ProbeSet(Symbol) 
+probeset:name -> gn-term:description -> ProbeSetdescription 
+probeset:name -> gn-term:chr -> ProbeSet(Chr) 
+probeset:name -> gn-term:mb -> "Mb"^^xsd:double 
+probeset:name -> gn-term:blatSeq -> ProbeSetBlatSeq 
+probeset:name -> gn-term:targetSeq -> ProbeSetTargetSeq 
+probeset:name -> gn-term:uniProtReference -> uniprot:ProbeSet(UniProtID) 
+```
+Here's an example query:
+
+```sparql
+@prefix probeset: <http://genenetwork.org/probeset/> .
+@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
+@prefix rdfs: <http://www.w3.org/2000/01/rdf-r .
+@prefix uniprot: <http://purl.uniprot.org/uniprot/> .
+
+SELECT ?s ?p ?o WHERE { 
+    ?s rdf:type gn-id:probeset .
+    ?s gn-term:chipOf gn-id:platform_mg_u74av2 .
+    ?s gn-term:name "MG_U74AV2" .
+    ?s gn-term:symbol "Cd3g" .
+    ?s ?p ?o .
+}
+```
+
+Expected Result:
+
+```rdf
+probeset:100001_at rdf:type gn-id:probeset .
+probeset:100001_at gn-term:chipOf gn-id:platform_mg_u74av2 .
+probeset:100001_at gn-term:name "MG_U74AV2" .
+probeset:100001_at gn-term:symbol "Cd3g" .
+probeset:100001_at gn-term:description "CD3d antigen, gamma polypeptide" .
+probeset:100001_at gn-term:chr "9" .
+probeset:100001_at gn-term:mb "44.970689"^^xsd:double .
+probeset:100001_at gn-term:blatSeq "CTCTGTTGCAAAATGAACAGCTGTACAGCCCCTCAAGGACCGGGAATATGACCAGTACAGCCATCTCCAAGGAAACCAACTGAGGAAGAAGTGAACTCAGCAGGACTCAGGGTGTCCCCACAATGCATTTTGGAGAGAGCCCAGACTGCAAGCAGAGAGGAAGAACTGAGGAAAACAAGCACAGCGTGGTGTT" .
+probeset:100001_at gn-term:targetSeq "ctctgttgcaaaatgaacagctgtaccagcccctcaaggaccgggaatatgaccagtacagccatctccaaggaaaccaactgaggaagaagtgaactcagcaggactcagggtgtccccccttntatccagcacccagaatcaaaacaatgcattttggagagagcccagtagagagattttcaaccctacaggtagactgcaagcagagaggaagaactgtcaaagaaattttggtcttttttttttttttnncaaaataaaataaaagcttggaggagccagtggtatgantnnnnnntgnancanttgtcaaccttgtttggggttnncagcaccccacccccagaccccccaaaaaaattcagtgaaggaaaacaagcacagcgtggtgtt" .
+```
+
diff --git a/rdf-documentation/dump-species-metadata.md b/rdf-documentation/dump-species-metadata.md
index 7c0f8be..ca09458 100644
--- a/rdf-documentation/dump-species-metadata.md
+++ b/rdf-documentation/dump-species-metadata.md
@@ -4,10 +4,10 @@
 ## Schema Triples:
 
 ```text
-gn:name -> rdfs:range -> rdfs:Literal
-gn:displayName -> rdfs:range -> rdfs:Literal
-gn:binomialName -> rdfs:range -> rdfs:Literal
-gn:family -> rdfs:range -> rdfs:Literal
+gn-term:name -> rdfs:range -> rdfs:Literal
+gn-term:displayName -> rdfs:range -> rdfs:Literal
+gn-term:binomialName -> rdfs:range -> rdfs:Literal
+gn-term:family -> rdfs:range -> rdfs:Literal
 ```
 ## Generated Triples:
 
@@ -20,25 +20,26 @@ SELECT Species.FullName, Species.SpeciesName, Species.MenuName, Species.FullName
 The above query results to triples that have the form:
 
 ```text
-gn:species_species_fullname_ -> rdf:type -> gn:species 
-gn:species_species_fullname_ -> gn:name -> Species(SpeciesName) 
-gn:species_species_fullname_ -> gn:displayName -> Species(MenuName) 
-gn:species_species_fullname_ -> gn:binomialName -> Species(FullName) 
-gn:species_species_fullname_ -> gn:family -> Species(Family) 
-gn:species_species_fullname_ -> gn:organism -> #{taxon:Species\x28;TaxonomyId\x29;}# 
+gn-id:Species_fullname -> rdf:type -> gn-id:species 
+gn-id:Species_fullname -> gn-term:name -> Species(SpeciesName) 
+gn-id:Species_fullname -> gn-term:displayName -> Species(MenuName) 
+gn-id:Species_fullname -> gn-term:binomialName -> Species(FullName) 
+gn-id:Species_fullname -> gn-term:family -> Species(Family) 
+gn-id:Species_fullname -> gn-term:organism -> taxon:Species(TaxonomyId) 
 ```
 Here's an example query:
 
 ```sparql
-PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> 
-PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> 
-PREFIX gn: <http://genenetwork.org/terms/> 
-PREFIX taxon: <http://purl.uniprot.org/taxonomy/> 
+@prefix gn-id: <http://genenetwork.org/terms/> .
+@prefix gn-term: <http://genenetwork.org/terms/> .
+@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
+@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
+@prefix taxon: <http://purl.uniprot.org/taxonomy/> .
 
 SELECT ?s ?p ?o WHERE { 
-    ?s rdf:type gn:species .
-    ?s gn:name "Mouse" .
-    ?s gn:displayName "Mouse (Mus musculus, mm10)" .
+    ?s rdf:type gn-id:species .
+    ?s gn-term:name "Mouse" .
+    ?s gn-term:displayName "Mouse (Mus musculus, mm10)" .
     ?s ?p ?o .
 }
 ```
@@ -46,12 +47,12 @@ SELECT ?s ?p ?o WHERE {
 Expected Result:
 
 ```rdf
-gn:species_mus_musculus rdf:type gn:species .
-gn:species_mus_musculus gn:name "Mouse" .
-gn:species_mus_musculus gn:displayName "Mouse (Mus musculus, mm10)" .
-gn:species_mus_musculus gn:binomialName "Mus musculus" .
-gn:species_mus_musculus gn:family "Vertebrates" .
-gn:species_mus_musculus gn:organism taxon:10090 .
+gn-id:Mus_musculus rdf:type gn-id:species .
+gn-id:Mus_musculus gn-term:name "Mouse" .
+gn-id:Mus_musculus gn-term:displayName "Mouse (Mus musculus, mm10)" .
+gn-id:Mus_musculus gn-term:binomialName "Mus musculus" .
+gn-id:Mus_musculus gn-term:family "Vertebrates" .
+gn-id:Mus_musculus gn-term:organism taxon:10090 .
 ```
 
 
@@ -60,11 +61,11 @@ gn:species_mus_musculus gn:organism taxon:10090 .
 ## Schema Triples:
 
 ```text
-gn:strainOfSpecies -> rdfs:domain -> gn:strain
-gn:strainOfSpecies -> rdfs:range -> gn:species
-gn:name -> rdfs:range -> rdfs:Literal
-gn:alias -> rdfs:range -> rdfs:Literal
-gn:symbol -> rdfs:range -> rdfs:Literal
+gn-term:strainOfSpecies -> rdfs:domain -> gn-term:strain
+gn-term:strainOfSpecies -> rdfs:range -> gn-term:species
+gn-term:name -> rdfs:range -> rdfs:Literal
+gn-term:alias -> rdfs:range -> rdfs:Literal
+gn-term:symbol -> rdfs:range -> rdfs:Literal
 ```
 ## Generated Triples:
 
@@ -77,25 +78,26 @@ SELECT CAST(CONVERT(BINARY CONVERT(Strain.Name USING latin1) USING utf8) AS VARC
 The above query results to triples that have the form:
 
 ```text
-gn:strain_strainname -> rdf:type -> gn:strain 
-gn:strain_strainname -> gn:strainOfSpecies -> gn:species_species_fullname_ 
-gn:strain_strainname -> gn:name -> StrainName 
-gn:strain_strainname -> gn:name -> StrainName2 
-gn:strain_strainname -> gn:alias -> StrainAlias 
-gn:strain_strainname -> gn:symbol -> Strain(Symbol) 
+gn-id:Strainname -> rdf:type -> gn-id:strain 
+gn-id:Strainname -> gn-term:strainOfSpecies -> gn-id:Species_fullname 
+gn-id:Strainname -> gn-term:name -> StrainName 
+gn-id:Strainname -> gn-term:name2 -> StrainName2 
+gn-id:Strainname -> gn-term:alias -> StrainAlias 
+gn-id:Strainname -> gn-term:symbol -> Strain(Symbol) 
 ```
 Here's an example query:
 
 ```sparql
-PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> 
-PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> 
-PREFIX gn: <http://genenetwork.org/terms/> 
-PREFIX taxon: <http://purl.uniprot.org/taxonomy/> 
+@prefix gn-id: <http://genenetwork.org/terms/> .
+@prefix gn-term: <http://genenetwork.org/terms/> .
+@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
+@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
+@prefix taxon: <http://purl.uniprot.org/taxonomy/> .
 
 SELECT ?s ?p ?o WHERE { 
-    ?s rdf:type gn:strain .
-    ?s gn:strainOfSpecies gn:species_mus_musculus .
-    ?s gn:name "B6D2F1" .
+    ?s rdf:type gn-id:strain .
+    ?s gn-term:strainOfSpecies gn-id:Mus_musculus .
+    ?s gn-term:name "B6D2F1" .
     ?s ?p ?o .
 }
 ```
@@ -103,10 +105,10 @@ SELECT ?s ?p ?o WHERE {
 Expected Result:
 
 ```rdf
-gn:strain_b6d2f1 rdf:type gn:strain .
-gn:strain_b6d2f1 gn:strainOfSpecies gn:species_mus_musculus .
-gn:strain_b6d2f1 gn:name "B6D2F1" .
-gn:strain_b6d2f1 gn:name "B6D2F1" .
+gn-id:B6d2f1 rdf:type gn-id:strain .
+gn-id:B6d2f1 gn-term:strainOfSpecies gn-id:Mus_musculus .
+gn-id:B6d2f1 gn-term:name "B6D2F1" .
+gn-id:B6d2f1 gn-term:name2 "B6D2F1" .
 ```
 
 
@@ -127,17 +129,19 @@ SELECT MappingMethod.Name FROM MappingMethod
 The above query results to triples that have the form:
 
 ```text
-gn:mappingMethod_mappingmethod_name_ -> rdf:type -> gn:mappingMethod 
+gn-id:mappingMethod_mappingmethod_name -> rdf:type -> gn-id:mappingMethod 
 ```
 Here's an example query:
 
 ```sparql
-PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> 
-PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> 
-PREFIX gn: <http://genenetwork.org/terms/> 
-PREFIX taxon: <http://purl.uniprot.org/taxonomy/> 
+@prefix gn-id: <http://genenetwork.org/terms/> .
+@prefix gn-term: <http://genenetwork.org/terms/> .
+@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
+@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
+@prefix taxon: <http://purl.uniprot.org/taxonomy/> .
 
 SELECT ?s ?p ?o WHERE { 
+    ?s rdf:type gn-id:mappingMethod .
     ?s ?p ?o .
 }
 ```
@@ -145,7 +149,7 @@ SELECT ?s ?p ?o WHERE {
 Expected Result:
 
 ```rdf
-gn:mappingMethod_qtlreaper rdf:type gn:mappingMethod .
+gn-id:mappingMethod_qtlreaper rdf:type gn-id:mappingMethod .
 ```
 
 
@@ -154,32 +158,34 @@ gn:mappingMethod_qtlreaper rdf:type gn:mappingMethod .
 ## Schema Triples:
 
 ```text
-gn:name -> rdfs:range -> rdfs:Literal
+gn-term:normalization -> rdfs:range -> rdfs:Literal
 ```
 ## Generated Triples:
 
 The following SQL query was executed:
 
 ```sql
-SELECT AvgMethod.Name, AvgMethod.Name FROM AvgMethod
+SELECT AvgMethod.Name, AvgMethod.Normalization FROM AvgMethod
 ```
 
 The above query results to triples that have the form:
 
 ```text
-gn:avgmethod_avgmethod_name_ -> rdf:type -> gn:avgMethod 
-gn:avgmethod_avgmethod_name_ -> gn:name -> AvgMethod(Name) 
+gn-id:avgmethod_avgmethod_name -> rdf:type -> gn-id:avgMethod 
+gn-id:avgmethod_avgmethod_name -> gn-term:normalization -> AvgMethod(Normalization) 
 ```
 Here's an example query:
 
 ```sparql
-PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> 
-PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> 
-PREFIX gn: <http://genenetwork.org/terms/> 
-PREFIX taxon: <http://purl.uniprot.org/taxonomy/> 
+@prefix gn-id: <http://genenetwork.org/terms/> .
+@prefix gn-term: <http://genenetwork.org/terms/> .
+@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
+@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
+@prefix taxon: <http://purl.uniprot.org/taxonomy/> .
 
 SELECT ?s ?p ?o WHERE { 
-    ?s rdf:type gn:avgMethod .
+    ?s rdf:type gn-id:avgMethod .
+    ?s gn-term:normalization "MAS5" .
     ?s ?p ?o .
 }
 ```
@@ -187,7 +193,7 @@ SELECT ?s ?p ?o WHERE {
 Expected Result:
 
 ```rdf
-gn:avgmethod_mas5 rdf:type gn:avgMethod .
-gn:avgmethod_mas5 gn:name "MAS5" .
+gn-id:avgmethod_mas5 rdf:type gn-id:avgMethod .
+gn-id:avgmethod_mas5 gn-term:normalization "MAS5" .
 ```
 
diff --git a/rdf-documentation/dump-tissue.md b/rdf-documentation/dump-tissue.md
index bfa2a76..dd64f83 100644
--- a/rdf-documentation/dump-tissue.md
+++ b/rdf-documentation/dump-tissue.md
@@ -4,7 +4,7 @@
 ## Schema Triples:
 
 ```text
-gn:name -> rdfs:range -> rdfs:Literal
+gn-term:name -> rdfs:range -> rdfs:Literal
 ```
 ## Generated Triples:
 
@@ -17,18 +17,20 @@ SELECT Tissue.Short_Name, Tissue.Name FROM Tissue
 The above query results to triples that have the form:
 
 ```text
-gn:tissue_tissue_short_name_ -> rdf:type -> gn:tissue 
-gn:tissue_tissue_short_name_ -> gn:name -> Tissue(Name) 
+gn-id:tissue_tissue_short_name -> rdf:type -> gn-id:tissue 
+gn-id:tissue_tissue_short_name -> gn-term:name -> Tissue(Name) 
 ```
 Here's an example query:
 
 ```sparql
-PREFIX rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> 
-PREFIX rdfs: <http://www.w3.org/2000/01/rdf-schema#> 
-PREFIX gn: <http://genenetwork.org/terms/> 
+@prefix gn-id: <http://genenetwork.org/terms/> .
+@prefix gn-term: <http://genenetwork.org/terms/> .
+@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
+@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
 
 SELECT ?s ?p ?o WHERE { 
-    ?s rdf:type gn:tissue .
+    ?s rdf:type gn-id:tissue .
+    ?s gn-term:name "Brain mRNA" .
     ?s ?p ?o .
 }
 ```
@@ -36,7 +38,7 @@ SELECT ?s ?p ?o WHERE {
 Expected Result:
 
 ```rdf
-gn:tissue_brn rdf:type gn:tissue .
-gn:tissue_brn gn:name "Brain mRNA" .
+gn-id:tissue_brn rdf:type gn-id:tissue .
+gn-id:tissue_brn gn-term:name "Brain mRNA" .
 ```