aboutsummaryrefslogtreecommitdiff
path: root/doc
diff options
context:
space:
mode:
authorzsloan2016-05-18 20:06:41 +0000
committerzsloan2016-05-18 20:06:41 +0000
commitf8c89f7c24cbfcffdafd12ef2087f4de598ed4bd (patch)
treeca233c2f08151377de161a616e69031d557ff808 /doc
parente36ffce0d972334b07ee91b817fc3f30ed3598c4 (diff)
parenta8945cc625f12e9cf733f469426bf0e4b8e83647 (diff)
downloadgenenetwork2-f8c89f7c24cbfcffdafd12ef2087f4de598ed4bd.tar.gz
Merge branch 'staging' of https://github.com/genenetwork/genenetwork2
Diffstat (limited to 'doc')
-rw-r--r--doc/GUIX-Reproducible-from-source.org21
-rw-r--r--doc/GUIX-archive.org106
-rw-r--r--doc/README.org678
-rw-r--r--doc/database.org710
-rw-r--r--doc/new_variable_names.txt6
-rw-r--r--doc/notes_DA.txt10
-rw-r--r--doc/old/gn_installation_notes.txt (renamed from doc/gn_installation_notes.txt)4
-rw-r--r--doc/old/notes.txt (renamed from doc/notes.txt)0
-rw-r--r--doc/requirements.txt36
-rw-r--r--doc/todo.txt2
10 files changed, 1502 insertions, 71 deletions
diff --git a/doc/GUIX-Reproducible-from-source.org b/doc/GUIX-Reproducible-from-source.org
index b88eb9e8..4399ea26 100644
--- a/doc/GUIX-Reproducible-from-source.org
+++ b/doc/GUIX-Reproducible-from-source.org
@@ -4,6 +4,7 @@
- [[#introduction][Introduction]]
- [[#binary-deployment][Binary deployment]]
- [[#from-source-deployment][From source deployment]]
+ - [[#create-archive][Create archive]]
* Introduction
@@ -31,5 +32,23 @@ Next build guix (and run) following the instructions in [[https://github.com/pjo
Once that is done we can add the guix-bioinformatics path with
-: env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -A slurm
+: env GUIX_PACKAGE_PATH=../guix-bioinformatics command
+So
+
+#+begin_src sh :lang bash
+#+begin_src sh :lang bash
+gn-stable-guix$ env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -A genenetwork
+genenetwork1 1.0-d622c803b out ../guix-bioinformatics/gn/packages/bioinformatics.scm:163:2
+genenetwork2 2.0-9e9475053 out ../guix-bioinformatics/gn/packages/bioinformatics.scm:215:2
+#+end_src sh :lang bash
+
+Install with
+
+#+begin_src sh :lang bash
+gn-stable-guix$ env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -i genenetwork2
+#+end_src sh :lang bash
+
+* Create archive
+
+: env GUIX_PACKAGE_PATH=../../genenetwork/guix-bioinformatics/ ./pre-inst-env guix archive --export -r genenetwork2 > guix_gn2-2.0-9e9475053.nar
diff --git a/doc/GUIX-archive.org b/doc/GUIX-archive.org
new file mode 100644
index 00000000..67ab5cd0
--- /dev/null
+++ b/doc/GUIX-archive.org
@@ -0,0 +1,106 @@
+* Binary deployment
+
+Note binary deployment is not working pending a few improvements
+to GNU Guix. See source deployment instead.
+
+** Install Guix using a tar ball
+
+GN can be deployed either as a binary tarball or as a GNU Guix
+package. First install GNU Guix following the instructions of the
+[[https://www.gnu.org/software/guix/manual/html_node/Binary-Installation.html#Binary-Installation][binary installation]] using a tar ball from [[https://www.gnu.org/software/guix/download/][here]].
+
+With guix-daemon running you should be able to install the hello
+package:
+
+: guix package -i hello
+
+** Fix locale
+
+You may want to
+
+#+begin_src sh :lang bash
+export GUIX_LOCPATH=$HOME/.guix-profile/lib/locale
+export LC_ALL=en_US.utf8
+#+end_src sh :lang bash
+
+** Authorize our archives
+
+Next add our archive key to guix (as root):
+
+#+begin_src scheme
+echo "(public-key
+ (ecc
+ (curve Ed25519)
+ (q #E9A95686D8437186302E07C7AB9BF3913F435026C2D389AF27D9C66FD6EBB649#)
+ )
+ )
+"|guix archive --authorize
+#+end_src scheme
+
+if you have trouble finding a suitable guix try
+
+: ls /gnu/store/*guix-*/bin/guix
+
+and you should be able to use this directly, e.g.
+
+: alias guix=/gnu/store/632msbms2yaldfnlrb5lbnlnmn9yjisw-guix-0.9.0/bin/guix
+: guix --version
+
+** Download and install the GN2 archive
+
+Find the archive on
+
+ http://files.genenetwork.org/software/
+
+download and install with
+
+#+begin_src bash
+guix archive --import < genenetwork2-data-hash.nar
+#+end_src bash
+
+and you should see a list of packages installing, e.g.
+
+#+begin_src bash
+importing path `/gnu/store/l1zs2drn3zdzl5ysjcmhibcpa35p9zfc-python2-mysqlclient-1.3.7'
+importing path `/gnu/store/n7kfg4knibvblggy8ci2liscl7vz5wkg-python2-parallel-1.6.4'
+importing path `/gnu/store/qvv16qwlq59gp5d07lwbf5n8ndsi3il3-python2-sqlalchemy-1.0.11'
+importing path `/gnu/store/qw872mbmr9ir0a9drv9xw9pvjk05ywwy-python2-xlsxwriter-0.8.4'
+importing path `/gnu/store/wc112m1xfy3p08v14bdzay2ki2rirdsm-pylmm-gn2-1.0-3c6d1cac8'
+importing path `/gnu/store/zfkcy17c2ks3cd9ks14irdabqvmlfpyn-python2-flask-sqlalchemy-2.1'
+importing path `/gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff4'
+(etc.)
+#+end_src bash
+
+The following packages need to be added and the R path set
+
+: export R_LIBS_SITE="/home/wrk/.guix-profile/site-library/"
+: guix package -i /gnu/store/w0dqg9dshq53j8xhcnqgvnvms2s6y5k5-r-wgcna-1.49-425bc170cc0873ddbd414675ac40f6d4d724c7cb
+: guix package -i /gnu/store/k60bdlm0v7xic88j2z5c1jb1jvc371mn-r-qtl-1.38-4
+
+You can add the last one to your profile
+
+: guix package -i /gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff
+: export PATH=~/.guix-profile/bin:$PATH
+: genenetwork2
+
+ or run it directly with
+
+: /gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff/bin/genenetwork2
+
+
+
+** Other
+
+Update guix with a 'guix pull' and make guix visible in the path.
+More information exists also in my [[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org][guix-notes]].
+
+With guix running you should be able to install python, for example.
+
+: guix package -i python2
+
+This will make python appear in $HOME/.guix-profile/bin/python. Suggested
+environment settings can be seen with
+
+: guix package --search-paths
+
+
diff --git a/doc/README.org b/doc/README.org
index f6ab6a52..345341e1 100644
--- a/doc/README.org
+++ b/doc/README.org
@@ -1,28 +1,678 @@
-#+TITLE: Installing GeneNetwork services with GNU Guix
+
+#+TITLE: Installing GeneNetwork services
* Table of Contents :TOC:
- [[#introduction][Introduction]]
- - [[#binary-deployment][Binary deployment]]
- - [[#from-source-deployment][From source deployment]]
+ - [[#source-deployment][Source deployment]]
+ - [[#install-guix][Install guix]]
+ - [[#checkout-the-git-repositories][Checkout the git repositories]]
+ - [[#update-guix][Update guix]]
+ - [[#install-gn2][Install GN2]]
+ - [[#run-gn2][Run GN2]]
+ - [[#run-mysql-server][Run MySQL server]]
+ - [[#run-your-own-copy-of-gn2][Run your own copy of GN2]]
+ - [[#set-up-nginx-port-forwarding][Set up nginx port forwarding]]
+ - [[#source-deployment-and-other-information-on-reproducibility][Source deployment and other information on reproducibility]]
+ - [[#trouble-shooting][Trouble shooting]]
+ - [[#importerror-no-module-named-jinja2][ImportError: No module named jinja2]]
+ - [[#error-can-not-find-directory-homegn2_data][ERROR: can not find directory $HOME/gn2_data]]
+ - [[#cant-run-a-module][Can't run a module]]
* Introduction
-Large system deployments tend to get very complex. In this document we
-explain the GeneNetwork deployment system which is based on GNU Guix
-(see Pjotr's [[https://github.com/pjotrp/guix-notes/blob/master/README.md][Guix-notes]]).
+Large system deployments can get very complex. In this document we
+explain the GeneNetwork version 2 (GN2) reproducible deployment system
+which is based on GNU Guix (see also Pjotr's [[https://github.com/pjotrp/guix-notes/blob/master/README.md][Guix-notes]]). The Guix
+system can be used to install GN with all its files and dependencies.
+
+The official installation path is from a checked out version of the
+main Guix package tree and that of the Genenetwork package
+tree. Current supported versions can be found as the SHA values of
+'gn-latest' branches of [[https://github.com/genenetwork/guix-bioinformatics/tree/gn-latest][Guix bioinformatics]] and [[https://github.com/genenetwork/guix/tree/gn-latest][GNU Guix main]].
+
+* Source deployment
+** Install guix
-* Binary deployment
+Deploying from source is also straightforward. Install GNU Guix using
+a binary tar ball as described [[https://github.com/pjotrp/guix-notes][here]].
-NYA
+If it works you should be able to install a package with
-* From source deployment
+: guix package -i hello
-GNU Guix allows for [[https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org][reproducible deployment]] based on a checked out
-Guix repository - use gn-stable for that:
+** Checkout the git repositories
-#+begin_src sh :lang bash
+Check out the two relevant guix and guix-bioinformatics git
+repositories:
+
+#+begin_src bash
+cd ~
mkdir genenetwork
cd genenetwork
-git checkout https://github.com/genenetwork/guix.git gn-stable-guix
-git checkout https://github.com/genenetwork/guix-bioinformatics.git
+git clone --branch gn-latest https://github.com/genenetwork/guix-bioinformatics
+git clone --branch gn-latest --recursive https://github.com/genenetwork/guix guix-gn-latest
+cd guix-gn-latest
+#+end_src bash
+
+** Update guix
+
+At some point you may decide to create, install and run a recent
+version of the guix-daemon by compiling the guix repository. Follow
+[[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org#building-gnu-guix-from-source-using-guix][these]] steps carefully.
+
+** Install GN2
+
+#+begin_src bash
+env GUIX_PACKAGE_PATH=../guix-bioinformatics/ ./pre-inst-env \
+ guix package -i genenetwork2 --fallback
+#+end_src bash
+
+Note that you can use the genenetwork.org guix substitute caching
+server at http://guix.genenetwork.org:8080 (which speeds up installs
+significantly because all packages are pre-built). Here an IRC session
+where we installed GN2 from scratch using GNU Guix and a download
+of the test database:
+
+#+begin_src
+<pjotrp> time to get binary install sorted :) [07:03]
+<pjotrp> Guix is designed for distributed installation servers
+<pjotrp> we have one on guix.genenetwork.org
+<pjotrp> it contains all the prebuild packages
+<pjotrp> for GN
+<user01> okay [07:04]
+<pjotrp> let's step back however [07:05]
+<pjotrp> I presume the environment is set with all guix package --search-paths
+<pjotrp> right?
+<user01> yep
+<user01> set to the ones in ~/.guix-profile/
+<pjotrp> good, and you are in gn-latest-guix repo [07:06]
+<user01> yep [07:07]
+<pjotrp> git log shows
+
+Author: David Thompson <dthompson2@worcester.edu>
+Date: Sun Mar 27 21:20:19 2016 -0400
+
+<user01> yes
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+ package -A genenetwork2 [07:08]
+<pjotrp> shows
+
+genenetwork2 2.0-a8fcff4 out ../guix-bioinformatics/gn/packages/genenetwork.scm:144:2
+genenetwork2-database-small 1.0 out ../guix-bioinformatics/gn/packages/genenetwork.scm:270:4
+genenetwork2-files-small 1.0 out ../guix-bioinformatics/gn/packages/genenetwork.scm:228:4
+
+<user01> yeah [07:09]
+<pjotrp> OK, we are in sync. This means we should be able to install the exact
+ same software
+<pjotrp> I need to start up my guix daemon - I usually run it in a screen
+<pjotrp> screen -S guix-daemon
+<user01> hah, I don't have screen installed yet [07:11]
+<pjotrp> comes with guix ;) [07:12]
+<pjotrp> no worries, you can run it any way you want
+<pjotrp> $HOME/.guix-profile/bin/guix-daemon --build-users-group=guixbuild
+<user01> then something's weird, because it says I don't have it
+<pjotrp> oh, you need to install it first [07:13]
+<pjotrp> guix package -A screen
+<pjotrp> screen 4.3.1 out gnu/packages/screen.scm:34:2
+<pjotrp> but you can skip this install, for now
+<user01> alright [07:14]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+ package -i genenetwork2 --dry-run
+<pjotrp> substitute: updating list of substitutes from
+ 'https://mirror.hydra.gnu.org'... 79.1%
+<pjotrp> you see that?
+<pjotrp> followed by [07:15]
+substitute: updating list of substitutes from
+'https://hydra.gnu.org'... 100.0%
+The following derivations would be built:
+ /gnu/store/rk7nw0rjqqsha958m649wrykadx6mmhl-profile.drv
+
+/gnu/store/7b0qjybvfx8syzvfs7p5rdablwhbkbvs-module-import-compiled.drv
+ /gnu/store/cy9zahbbf23d3cqyy404lk9f50z192kp-module-import.drv
+ /gnu/store/ibdn603i8grf0jziy5gjsly34wx82lmk-gtk-icon-themes.drv
+
+<pjotrp> which should have the same HASH values /gnu/store/7b0qjybvf... etc.
+ [07:16]
+<user01> profile has a different hash
+<pjotrp> but the next ones?
+<user01> they're the same
+<pjotrp> not sure why profile differs. Do you see the contact with
+ mirror.hydra.org? [07:17]
+<user01> yeah
+<pjotrp> OK, that means you set the key correctly for that one :)
+<pjotrp> alright we are at the same state now. You can see most packages need
+ to be rebuild because they are no longer cached as binaries on hydra
+ [07:18]
+<pjotrp> things move fast...
+<user01> hehe
+<pjotrp> let me also do the same on my laptop - which I have staged before
+ [07:19]
+<pjotrp> btw, to set the path I often do [07:20]
+<pjotrp> export
+ PATH="/home/wrk/.guix-profile/bin:/home/wrk/.guix-profile/sbin":$PATH
+<pjotrp> to keep things like 'screen' from Debian
+<pjotrp> Once past building guix itself that is normally OK [07:21]
+<user01> ah, okay
+<user01> will do that
+<pjotrp> the guix build requires certain versions of tools, so you don't want
+ to mix foreign tools in [07:23]
+<user01> makes sense [07:24]
+<pjotrp> On my laptop I am trying the main updating list of substitutes from
+ 'http://hydra.gnu.org'... 10.5% [07:27]
+<pjotrp> it is a bit slow, but let's see if there is a difference with the
+ mirror
+<pjotrp> you can see there are two servers here. Actually with recent daemons,
+ if the mirror fails it will try the main server [07:28]
+<pjotrp> I documented the use of a caching server here [07:29]
+<pjotrp> https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org
+<pjotrp> this is exactly what we are doing now
+<user01> alrighty [07:35]
+<pjotrp> To see if a remote server has a guix server running it should respond
+ [07:36]
+<pjotrp> lynx http://guix.genenetwork.org:8080 --dump
+<pjotrp> Resource not found: /
+<pjotrp>
+<pjotrp> you see that?
+<user01> yes [07:37]
+<pjotrp> good. The main hydra server is too slow. So on my laptop I forced
+ using the mirror with [07:38]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics/ ./pre-inst-env guix
+ package -i genenetwork2 --dry-run
+ --substitute-urls="http://mirror.hydra.gnu.org"
+<pjotrp>
+<pjotrp> the list looks the same to me [07:40]
+<user01> me too
+<pjotrp> note that some packages will be built and some downloaded, right?
+ [07:41]
+<user01> yes
+<pjotrp> atlas is actually a binary on my system [07:43]
+<pjotrp> I mean in that list
+<pjotrp> so, it should not build. Same as yours?
+<user01> yeah, atlas and r-gtable are the ones to be downloaded
+<pjotrp> You should not have seen that error ;)
+<pjotrp> we should try and install it this way, try [07:44]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+ package -i genenetwork2 --cores=4 --max-jobs=4 --keep-going [07:46]
+<pjotrp> set CPUs and max-jobs to something sensible
+<pjotrp> Does your VM have multiple cores?
+<pjotrp> note you can always press Ctrl-C during install
+<user01> it doesn't, I'll reboot it and give it another core [07:47]
+<user02> Hey [07:48]
+<user02> I'm here
+<user02> Will be stepping away for some breakfast
+<pjotrp> Can you do the same as us
+<pjotrp> Can you see the irc log
+<user02> Alright
+<user02> Yes, I can
+<user02> Please email me a copy in five minutes
+<pjotrp> user01: so when I use the GN server [07:56]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+ package -i genenetwork2 --dry-run
+ --substitute-urls=http://guix.genenetwork.org:8080
+<pjotrp> I don't need to build anything [07:57]
+<pjotrp> (this won't work for you, yet)
+<pjotrp> to get it to work you need to 'trust' it [07:58]
+<pjotrp> but, first get the build going
+<pjotrp> I'll have a coffee while you and get building
+<user01> yeah it's doing its thing now [08:01]
+<pjotrp> cool [08:02]
+<pjotrp> in a separate terminal you can try and install with the gn mirror
+ [08:05]
+<pjotrp> I'll send you the public key and you can paste it as said
+ https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org
+ [08:06]
+<user01> alright
+<pjotrp> should be in the E-mail [08:09]
+<pjotrp> getting it working it kinda nasty since the server gives no feedback
+<pjotrp> it works when you see no more in the build list ;) [08:11]
+<pjotrp> btw, you can install software in parallel. Guix does that.
+<pjotrp> even the same packages
+<pjotrp> so keep building ;)
+<pjotrp> try and do this with Debian...
+<pjotrp> coffee for me [08:12]
+<user01> the first build failed [08:15]
+<pjotrp> OK, Dennis fixed that one yesterday [08:27]
+<pjotrp> the problem is that sometime source tarballs disappear [08:28]
+<pjotrp> R is notorious for that
+<user01> haha, that's inconvenient..
+<pjotrp> well, it is good that Guix catches them
+<pjotrp> but we do not cache sources
+<pjotrp> binaries are cached - to some degree - so we don't have to rebuild
+ those [08:29]
+<pjotrp> time to use the guix cache at guix.genenetwork.org
+<pjotrp> try and install the key (it is in the E-mail)
+<pjotrp> and see what this lists [08:31]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+ package -i genenetwork2
+ --substitute-urls=http://guix.genenetwork.org:8080 --dry-run
+<pjotrp> should be all binary installs
+<user01> it's not.. [08:32]
+<user01> if I remove --substitute-urls, the list changes, does that mean I
+ have the key set up correctly at least? [08:33]
+<pjotrp> dunno [08:35]
+<pjotrp> how many packages does it want to build?
+<pjotrp> should be zero
+<user01> four
+<pjotrp> Ah, that is OK - those are default profile things
+<user01> genenetwork2 is among the ones to be downloaded so [08:36]
+<pjotrp> remove --dry-run
+<pjotrp> yeah, good sign :)
+<pjotrp> we'll still hit a snag, but run it
+<pjotrp> should be fast
+<user01> doing it [08:37]
+<user01> it worked! [08:38]
+<user01> I think [08:39]
+<pjotrp> heh [08:40]
+<pjotrp> you mean it is finished?
+<user01> yep
+<pjotrp> type genenetwork2
+<user01> complains about not being able to connect to the database [08:41]
+<pjotrp> last snag :)
+<pjotrp> no database
+<pjotrp> well, we succeeded in installing a same-byte install of a very
+ complex system :) [08:42]
+<pjotrp> (always take time to congratulate yourself)
+<pjotrp> now we need to install mysql
+<user01> hehe :)
+<pjotrp> this can be done throug guix or through debian [08:43]
+<pjotrp> the latter is a bit easier here, so let's do that
+<pjotrp> fun note: you can mix debian and guix
+<pjotrp> Follow instructions on [08:44]
+<pjotrp>
+ https://github.com/genenetwork/genenetwork2/tree/staging/doc#run-mysql-server
+<pjotrp> apt-get install mysql-common [08:45]
+<pjotrp> may do it
+<pjotrp> You can also install with guix, but I need to document that
+<pjotrp> btw your internet must be fast :) [08:46]
+<user01> hehe it is ;)
+<pjotrp> when the database is installed [08:48]
+<pjotrp> be sure to set the password as instructed [08:50]
+<pjotrp> when mysql is set the genenetwork2 command should fire up the web
+ server on localhost:5003 [08:58]
+<pjotrp> btw my internet is way slower :) [09:00]
+<user02> I'm back [09:04]
+<user02> fixed router firmware upgrade problem
+<user02> unbricking
+<pjotrp> tssk [09:07]
+<user02> I'll never leave routers to update themselves again [09:08]
+<user02> self-brick highway
+<user02> Resuming [09:09]
+<pjotrp> auto-updates are evil
+<pjotrp> always switch them off
+<pjotrp> user02: can you install genenetwork like user has done? [09:10]
+<pjotrp> pretty well documented here now :)
+<user02> Yes I can [09:11]
+<user02> Already installed key
+<pjotrp> user02: you are getting binary packages only now? [09:13]
+<user02> That's the sanest way to go now
+<user02> seriously
+<pjotrp> everything should be pre-built from guix.genenetwork.org
+<pjotrp> you are downloading?
+<user02> yes [09:15]
+<pjotrp> cool. Maybe an idea to set up a server
+<pjotrp> for your own use
+<user02> Stuck at downloading preprocesscore
+<pjotrp> should not [09:24]
+<pjotrp> what does env GUIX_PACKAGE_PATH=../guix-bioinformatics/
+ ./pre-inst-env guix package -i genenetwork2
+ --substitute-urls="http://guix.genenetwork.org:8080" --dry-run
+ [09:25]
+<pjotrp> say for r-prepocesscore
+<pjotrp> download or build?
+<pjotrp> mine says download [09:26]
+<user02> it only lists the derivatives to be built
+<user02> nothing else happens [09:27]
+<pjotrp> OK, so there is a problem
+<pjotrp> your key may not be working
+<pjotrp> everything should be listed as 'to be download' [09:28]
+<user02> Hmm
+<user02> Ah
+<user02> I know where I messed up
+<pjotrp> where?
+<user02> I did add the key
+<user02> However
+<pjotrp> (I am documenting)
+<user02> I did not tell guix to trust it
+<pjotrp> yes
+<pjotrp> and there is another potential problem
+<user02> Remember the documentation on installing guix?
+<user02> You have to tell guix to trust the default key [09:29]
+<user02> Right?
+<user02> So in this case
+<pjotrp> read the IRC log
+<user02> That step is mandatory
+<pjotrp> user01: how are you doing?
+<pjotrp> user02:
+ https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org#using-gnu-guix-archive
+ [09:30]
+<user01> a little bit left on the db download
+<pjotrp> user02: you should see no more building
+<pjotrp> user02: another issue may be that you updated r-preprocesscore
+ package in guix-buinformatics [09:32]
+<pjotrp> all downstream packages will want to rebuild
+<user02> no, not really
+<user02> It's not even installed
+<pjotrp> checkout a branch of the the old version - make sure we are in synch
+<pjotrp> should be at
+ /gnu/store/y1f3r2xs3fhyadd46nd2aqbr2p9qv2ra-r-biocpreprocesscore-1.32.0
+ [09:33]
+<pjotrp>
+<user03> pjotrp: Possibly we should use the archive utility of Guix to do
+ deployment to avoid such out-of-sync differences :) [09:34]
+<pjotrp> maybe. I did not get archive to update profiles properly [09:37]
+<pjotrp> Also it is good that they get to understand guix
+ this way
+<pjotrp> carved in stone, eh [09:38]
+<user02> Yeah, all good [09:39]
+<user02> My mistake was skipping the guix archive part
+<user02> Can we begin with the install?
+<user02> It's telling me of derivatives that will be downloaded [09:40]
+<user02> So we're good
+<user02> Here goes
+<pjotrp> yeeha [09:42]
+<user02> pjotrp, where is this guix.genenetwork.org located at?
+<pjotrp> Tennessee
+<user02> It's...it's....sloooooooowwwwwwwwwwwwww
+<pjotrp> not from Europe
+<pjotrp> is it downloading at all?
+<user02> It should be extended
+<user02> Yes...like at 100KB/s [09:43]
+<user02> tear-jerker
+<user02> Verizon problems
+<user02> who's the host?
+<pjotrp> I am getting 500Kb/s
+<pjotrp> UT
+<user02> Guix's servers can run off more than one server, right?
+<user02> I'd like to host that particular server here
+<user02> For speed
+<pjotrp> yes
+<user02> Sooner or later
+<user02> It will be a necessity [09:45]
+<pjotrp> exactly what I am doing - this is our server
+<pjotrp> guix.genenetwork.org:8080
+<user02> All done installing [09:46]
+<pjotrp> what?
+<user02> Now the databases
+<pjotrp> what do you mean by slow exactly?
+<user02> Yes, it's installed
+<pjotrp> can you run genenetwork2
+<user02> setting variables
+<user02> If I try running it now, it will fail as I don't have the DBs [09:47]
+<pjotrp> cool - you had a lot of prebuilt packages already
+<pjotrp> OK, follow the instructions I wrote above
+<user01> now everything seems to be working for me :)
+<user02> OK
+<pjotrp> user01: excellent!
+<pjotrp> you see a webserver?
+<user01> yep, can connect to localhost:5003 [09:48]
+<pjotrp> So now you are running a guix copy of GN2
+<pjotrp> you can see where it lives with `which genenetwork2` or ls -l
+ ~/.guix-profile/bin/genenetwork2 [09:49]
+<pjotrp>
+ /gnu/store/1kma5xszvzsvmbb4k699h7gvdncw901i-genenetwork2-2.0-a8fcff4/bin/genenetwork2
+<pjotrp> it is a script
+<pjotrp> written by guix, open it [09:50]
+<pjotrp> inside it points to paths and our script at
+<pjotrp>
+ /gnu/store/1kma5xszvzsvmbb4k699h7gvdncw901i-genenetwork2-2.0-a8fcff4/bin/.genenetwork2-real
+<pjotrp> if you open that you can see how the webserver is started [09:51]
+<pjotrp> next step is to run a recent version of GN2
+<user01> okay [09:52]
+<pjotrp> See
+ https://github.com/genenetwork/genenetwork2/tree/staging/doc#run-your-own-copy-of-gn2
+<pjotrp> but do not checkout that genetwork2_diet
+<pjotrp> we reverted to the main tree
+<pjotrp> clone git@github.com:genenetwork/genenetwork2.git [09:53]
+<pjotrp> instead and checkout the staging branch
+<pjotrp> that is effectively my branch [09:54]
+<pjotrp> when that is done you should be able to fire up the webserver from
+ there [09:55]
+<pjotrp> using ./bin/genenetwork2
+<user02> now installing DBs
+<user02> Downloading
+<pjotrp> annoyingly the source tree is ~700Mb [09:56]
+<user02> Can it also be done by installing the guix package
+ genenetwork2-database-small?
+<pjotrp> I changed it in the diet version to 8Mb, but I had to revert
+<user01> I need to make my VM bigger...
+<pjotrp> user02: not ready [09:57]
+<user02> ok
+<pjotrp> user01: sorry
+<pjotrp> user01: you could mount a local dir inside the VM for development
+<pjotrp> that would allow you to use MAC tools for editing
+<pjotrp> just an idea
+<user01> yeah, I figure I'll do something like that
+<pjotrp> do you use emacs? [09:58]
+<user01> yep
+<pjotrp> that can also run on remote files over ssh
+<pjotrp> that's an alternative
+<pjotrp> kudos for using emacs :), wdyt user03
+<user02> 79 minutes to go downloading the db
+<pjotrp> user02: sorry about that [09:59]
+<pjotrp> it is 2GB
+<user02> user, you can also mount the directory via sshfs
+<user02> Mac OSX runs OpenSSH
+<pjotrp> user02: sopa
+<user02> You can therefore mount a directory outside the VM to the VM via
+ sshfs [10:00]
+<pjotrp> yes, 3 options now
+<user02> That way, you can set up a VM only for it's logic
+<user02> Apps + the OS it runs [10:01]
+<user02> For data, let it reside on physical host accessible via sshfs
+<user02> Use this Arch wiki reference:
+ https://wiki.archlinux.org/index.php/SSHFS
+<user02> I edited that last somewhere in 2015, may have been updated since
+ then
+<user01> alright, cool! [10:04]
+<pjotrp> user01: you are almost done [10:06]
+<pjotrp> I wrote an elixir package for guix :)
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics/ ./pre-inst-env guix
+ package -A elixir
+ --substitute-urls="http://guix.genenetwork.org:8080" [10:08]
+<pjotrp> elixir 1.2.3 out
+ ../guix-bioinformatics/gn/packages/elixir.scm:31:2
+<pjotrp>
+<pjotrp> I am building it on guix.genenetwork.org right now [10:09]
+<user01> nice [10:10]
#+end_src
+
+** Run GN2
+
+Make a note of the paths with
+
+#+begin_src bash
+./pre-inst-env guix package --search-paths
+#+end_src bash
+
+After setting the paths for the server
+
+#+begin_src bash
+export PATH=~/.guix-profile/bin:$PATH
+export PYTHONPATH="$HOME/.guix-profile/lib/python2.7/site-packages"
+export R_LIBS_SITE="$HOME/.guix-profile/site-library/"
+export GUIX_GTK3_PATH="$HOME/.guix-profile/lib/gtk-3.0"
+export GI_TYPELIB_PATH="$HOME/.guix-profile/lib/girepository-1.0"
+export XDG_DATA_DIRS="$HOME/.guix-profile/share"
+export GIO_EXTRA_MODULES="$HOME/.guix-profile/lib/gio/modules"
+#+end_src bash
+
+run the main script (in ~/.guix-profile/bin)
+
+#+begin_src bash
+genenetwork2
+#+end_src bash
+
+will start the default server which listens on port 5003, i.e.,
+http://localhost:5003/.
+
+** Run MySQL server
+
+At this point we require the underlying distribution to install
+and run mysqld.
+
+Download one of
+
+http://files.genenetwork.org/raw_database/
+https://s3.amazonaws.com/genenetwork2/db_webqtl_s.zip
+
+Check the md5sum.
+
+After installation inflate the database binary in the MySQL directory
+(this is subject to change soon)
+
+: chown -R mysql:mysql db_webqtl_s/
+: chmod 700 db_webqtl_s/
+: chmod 660 db_webqtl_s/*
+
+restart MySQL service (mysqld). Login as root and
+
+: mysql> show databases;
+: +--------------------+
+: | Database |
+: +--------------------+
+: | information_schema |
+: | db_webqtl_s |
+: | mysql |
+: | performance_schema |
+: +--------------------+
+
+Set permissions and match password in your settings file below:
+
+: mysql> grant all privileges on db_webqtl_s.* to gn2@"localhost" identified by 'mysql_password';
+
+Note that if the mysql connection is not working, try connecting to
+the IP address and check server firewall, hosts.allow and mysql IP
+configuration.
+
+** Run your own copy of GN2
+
+At some point you may want to fix the source code. Assuming you have
+Guix and Genenetwork2 installed (as described above) clone the GN2
+repository from https://github.com/genenetwork/genenetwork2_diet
+
+Copy-paste the paths into your terminal (mainly so PYTHON_PATH and
+R_LIBS_SITE are set) from the information given by guix:
+
+: guix package --search-paths
+
+Inside the repository:
+
+: cd genenetwork2
+: ./bin/genenetwork2
+
+Will fire up your local repo http://localhost:5003/ using the
+settings in ./etc/default_settings.py. These settings may
+not reflect your system. To override settings create your own from a copy of
+default_settings.py and pass it into GN2 with
+
+: ./bin/genenetwork2 $HOME/my_settings.py
+
+and everything *should* work (note the full path to the settings
+file). This way we develop against the exact same dependency graph of
+software.
+
+If something is not working, take a hint from the settings file
+that comes in the Guix installation. It sits in something like
+
+: cat ~/.guix-profile/lib/python2.7/site-packages/genenetwork2-2.0-py2.7.egg/etc/default_settings.py
+
+** Set up nginx port forwarding
+
+nginx can be used as a reverse proxy for GN2. For example, we want to
+expose GN2 on port 80 while it is running on port 5003. Essentially
+the configuration looks like
+
+#+begin_src js
+ server {
+ listen 80;
+ server_name test-gn2.genenetwork.org;
+ access_log logs/test-gn2.access.log;
+
+ proxy_connect_timeout 3000;
+ proxy_send_timeout 3000;
+ proxy_read_timeout 3000;
+ send_timeout 3000;
+
+ location / {
+ proxy_set_header Host $http_host;
+ proxy_set_header Connection keep-alive;
+ proxy_set_header X-Real-IP $remote_addr;
+ proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for;
+ proxy_set_header X-Forwarded-Host $server_name;
+ proxy_pass http://127.0.0.1:5003;
+ }
+}
+#+end_src js
+
+Install the nginx webserver (as root)
+
+: guix package -i nginx
+
+The nginx example configuration examples can be found in the Guix
+store through
+
+: ls -l /root/.guix-profile/sbin/nginx
+: lrwxrwxrwx 3 root guixbuild 66 Dec 31 1969 /root/.guix-profile/sbin/nginx -> /gnu/store/g0wrcl5z27rmk5b52rldzvk1bzzbnz2l-nginx-1.8.1/sbin/nginx
+
+Use that path
+
+: ls /gnu/store/g0wrcl5z27rmk5b52rldzvk1bzzbnz2l-nginx-1.8.1/share/nginx/conf/
+: fastcgi.conf koi-win scgi_params
+: fastcgi.conf.default mime.types scgi_params.default
+: fastcgi_params mime.types.default uwsgi_params
+: fastcgi_params.default nginx.conf uwsgi_params.default
+: koi-utf nginx.conf.default win-utf
+
+And copy any relevant files to /etc/nginx. A configuration file for
+GeneNetwork (reverse proxy) port forwarding can be found in the source
+repository under ./etc/nginx-genenetwork.conf. Copy this file to /etc
+(still as root)
+: cp ./etc/nginx-genenetwork.conf /etc/nginx/
+
+Make dirs
+
+: mkdir -p /var/spool/nginx/logs
+
+Add users
+
+: adduser nobody ; addgroup nobody
+
+Run nginx
+
+: /root/.guix-profile/sbin/nginx -c /etc/nginx/nginx-genenetwork.conf -p /var/spool/nginx
+
+* Source deployment and other information on reproducibility
+
+See the document [[GUIX-Reproducible-from-source.org]].
+
+* Trouble shooting
+
+** ImportError: No module named jinja2
+
+If you have all the Guix packages installed this error points out that
+the environment variables are not set. Copy-paste the paths into your
+terminal (mainly so PYTHON_PATH and R_LIBS_SITE are set) from the
+information given by guix:
+
+: guix package --search-paths
+
+On one system:
+
+: export PYTHONPATH="$HOME/.guix-profile/lib/python2.7/site-packages"
+: export R_LIBS_SITE="$HOME/.guix-profile/site-library/"
+: export GEM_PATH="$HOME/.guix-profile/lib/ruby/gems/2.2.0"
+
+and perhaps a few more.
+** ERROR: can not find directory $HOME/gn2_data
+
+The default settings file looks in your $HOME/gn2_data. Since these
+files come with a Guix installation you should take a hint from the
+values in the installed version of default_settings.py (see above in
+this document).
+
+** Can't run a module
+
+In rare cases, development modules are not brought in with Guix
+because no source code is available. This can lead to missing modules
+on a running server. Please check with the authors when a module
+is missing.
diff --git a/doc/database.org b/doc/database.org
new file mode 100644
index 00000000..e06ac1ff
--- /dev/null
+++ b/doc/database.org
@@ -0,0 +1,710 @@
+- github Document reduction issue
+
+
+* GeneNetwork Database
+
+** Estimated table sizes
+
+
+select table_name,round(((data_length + index_length) / 1024 / 1024), 2) `Size in MB` from information_schema.TABLES where table_schema = "db_webqtl" order by data_length;
+
++-------------------------+------------+
+| table_name | Size in MB |
++-------------------------+------------+
+| ProbeSetData | 59358.80 |
+| SnpAll | 15484.67 |
+| ProbeData | 22405.44 |
+| SnpPattern | 9177.05 |
+| ProbeSetSE | 14551.02 |
+| QuickSearch | 5972.86 |
+| ProbeSetXRef | 4532.89 |
+| LCorrRamin3 | 18506.53 |
+| ProbeSE | 6263.83 |
+| ProbeSet | 2880.21 |
+| Probe | 2150.30 |
+| GenoData | 3291.91 |
+| CeleraINFO_mm6 | 989.80 |
+| pubmedsearch | 1032.50 |
+| ProbeXRef | 743.38 |
+| GeneRIF_BASIC | 448.54 |
+| BXDSnpPosition | 224.44 |
+| EnsemblProbe | 133.66 |
+| EnsemblProbeLocation | 105.49 |
+| Genbank | 37.71 |
+| TissueProbeSetData | 74.42 |
+| AccessLog | 42.38 |
+| GeneList | 34.11 |
+| Geno | 33.90 |
+| MachineAccessLog | 28.34 |
+| IndelAll | 22.42 |
+| PublishData | 22.54 |
+| TissueProbeSetXRef | 14.73 |
+| ProbeH2 | 13.26 |
+| GenoXRef | 22.83 |
+| TempData | 8.35 |
+| GeneList_rn3 | 5.54 |
+| GORef | 4.97 |
+| Phenotype | 6.50 |
+| temporary | 3.59 |
+| InfoFiles | 3.32 |
+| Publication | 3.42 |
+| Homologene | 5.69 |
+| Datasets | 2.31 |
+| GeneList_rn33 | 2.61 |
+| PublishSE | 4.71 |
+| GeneRIF | 2.18 |
+| Vlookup | 1.87 |
+| H2 | 2.18 |
+| PublishXRef | 2.18 |
+| NStrain | 4.80 |
+| IndelXRef | 2.91 |
+| Strain | 1.07 |
+| GeneMap_cuiyan | 0.51 |
+| user_collection | 0.30 |
+| CaseAttributeXRef | 0.44 |
+| StrainXRef | 0.56 |
+| GeneIDXRef | 0.77 |
+| Docs | 0.17 |
+| News | 0.17 |
+| ProbeSetFreeze | 0.22 |
+| GeneRIFXRef | 0.24 |
+| Sample | 0.06 |
+| login | 0.06 |
+| user | 0.04 |
+| TableFieldAnnotation | 0.05 |
+| DatasetMapInvestigator | 0.05 |
+| User | 0.04 |
+| ProbeFreeze | 0.06 |
+| TableComments | 0.02 |
+| Investigators | 0.02 |
+| DBList | 0.03 |
+| Tissue | 0.02 |
+| GeneChip | 0.01 |
+| GeneCategory | 0.01 |
+| SampleXRef | 0.01 |
+| InbredSet | 0.01 |
+| SnpAllele_to_be_deleted | 0.00 |
+| Organizations | 0.01 |
+| PublishFreeze | 0.00 |
+| GenoFreeze | 0.00 |
+| Chr_Length | 0.01 |
+| SnpSource | 0.00 |
+| AvgMethod | 0.00 |
+| Species | 0.00 |
+| Dataset_mbat | 0.00 |
+| TissueProbeFreeze | 0.00 |
+| EnsemblChip | 0.00 |
+| TissueProbeSetFreeze | 0.01 |
+| UserPrivilege | 0.00 |
+| CaseAttribute | 0.00 |
+| MappingMethod | 0.00 |
+| DBType | 0.00 |
+| InfoFilesUser_md5 | 0.00 |
+| GenoCode | 0.00 |
+| DatasetStatus | 0.00 |
+| GeneChipEnsemblXRef | 0.00 |
+| GenoSE | 0.00 |
+| user_openids | 0.00 |
+| roles_users | 0.00 |
+| role | 0.00 |
+| Temp | NULL |
++-------------------------+------------+
+97 rows in set, 1 warning (0.01 sec)
+
+All *Data tables are large
+
+** User access
+
+According to the meta data:
+
+This table tracks access time and IP addresses. Used for logging in
+registered users and tracking cookies.
+
+# GN1 uses access table and GN2 uses user table (true/false?)
+
+ select * from AccessLog limit 5;
++-------+---------------------+----------------+
+| id | accesstime | ip_address |
++-------+---------------------+----------------+
+| 12174 | 2003-10-28 02:17:41 | 130.120.104.71 |
+| 12173 | 2003-10-28 02:16:27 | 130.120.104.71 |
+| 3 | 2003-02-22 07:38:33 | 192.117.159.1 |
+| 4 | 2003-02-22 07:49:13 | 192.117.159.1 |
+| 5 | 2003-02-22 07:51:08 | 192.117.159.1 |
++-------+---------------------+----------------+
+
+select * from AccessLog order by accesstime desc limit 5;
++---------+---------------------+---------------+
+| id | accesstime | ip_address |
++---------+---------------------+---------------+
+| 1025735 | 2016-02-08 14:23:29 | 100.43.81.157 |
+| 1025734 | 2016-02-08 13:54:28 | 180.76.15.144 |
+| 1025733 | 2016-02-08 13:43:37 | 66.249.65.217 |
+| 1025732 | 2016-02-08 13:39:50 | 66.249.65.217 |
+| 1025731 | 2016-02-08 13:15:46 | 66.249.65.217 |
++---------+---------------------+---------------+
+
+Quite a few trait page hits:
+
+select count(*) from AccessLog;
+
++----------+
+| count(*) |
++----------+
+| 1025685 |
++----------+
+
+show indexes from AccessLog;
++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| AccessLog | 0 | PRIMARY | 1 | id | A | 1025685 | NULL | NULL | | BTREE | | |
++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+
+This table is being used by both GN1 and GN2 from the trait pages!
+
+: grep -ir AccessLog *|grep -e "^gn1\|^gn2"|grep \.py|grep -v doc
+
+gn1/web/webqtl/showTrait/ShowTraitPage.py: query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \
+gn1/web/webqtl/showTrait/ShowTraitPage.py: self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)" ,user_ip)
+gn1/web/webqtl/textUI/cmdClass.py: query = """SELECT count(id) FROM AccessLog WHERE ip_address = %s AND UNIX_TIMESTAMP()-UNIX_TIMESTAMP(accesstime)<86400"""
+gn1/web/webqtl/textUI/cmdClass.py: query = """INSERT INTO AccessLog(accesstime,ip_address) values(Now(),%s)"""
+gn2/wqflask/wqflask/show_trait/show_trait_page.py: query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \
+gn2/wqflask/wqflask/show_trait/show_trait_page.py: self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)", user_ip)
+
+When looking at the code in GN1 and GN2 it restricts the daily use of
+the trait data page (set to 1,000 - whoever reaches that?). Unlike
+mentioned in the schema description, this table does *not* keep track
+of cookies.
+
+From the code it looks like GN2 uses a mixture of Redis and sqlalchemy
+to keep track of logged in sessions (see
+gn2/wqflask/wqflask/user_manager.py) and cookies through a user_uuid in
+model.py.
+
+In gn2/wqflask/wqflask/templates/collections/view_anonymous.html it
+show_trait_page appears to be loaded (need to check).
+
+** AvgMethod
+
+Probesetfreeze refers to AvgMethod
+
+** BXDSnPosition
+
+Snp table (all snps)
+
+Mapping in GN1 shows snps when you select a chromosome.
+
+** CaseAttribute(XRef)
+
+Metadata
+
+** CeleralINFO_mm6
+
+?
+
+** Chr_Length
+
+Default mm9, column for mm8
+
+** Dataset_mbat
+
+Menu for BXD (linkouts)
+
+** DatasetMapInvestigator
+
+Arthur?
+
+** DataSets
+
+Information/metadata
+
+** DatasetStatus
+
+Arthur private/public
+
+** DBList and DBType
+
+Hooked in API (URL encoding)
+
+** Docs
+
+GN2 only (see menu bar)
+
+** Ensembl*
+
+Probe information
+
+(will be deprecated)
+
+** Genbank
+
+Linkout and not important
+
+** GeneCategory
+
+Not important. GeneWiki notes function classification.
+
+Deprecate.
+
+** GeneChip
+
+** GeneIDXRef
+
+Interspecies gene comparison
+
+** GeneList
+
+Track info
+
+** Genlist_rn3(3)
+
+Rat list
+
+** GeneMap_cuiyan
+
+Link outs
+
+** GeneRIF
+
+Wiki info (nightly updated from NCBI)
+
+XRef should be foreign keys
+
+** Geno
+
+SNP or marker info
+
+** GenoCode
+
+Belongs to someone else
+
+** GenoData
+
+Allele info
+
+** GenoFreeze
+
+Big menu (Freeze refers to menu)
+
+** GenoSE
+
+SE standard err, not used
+
+** GenoXREF
+
+Very important. Key links between Geno, GenoData
+
+** GORef
+
+GO terms
+
+** H2
+
+Heritability for probeset(?)
+
+** Homologene
+
+Homology, not used much
+
+** InbredSet
+
+Group in menu
+
+** Indelall, SnpAll, SnpPattern, SnpSource
+
+Indel Snp browser (variant browser Gn1)
+
+** Info*
+
+Infra system PhP
+
+Data Info button
+
+Infosystem users has separate entries
+
+Also Investigators, User, Organizations,
+
+** LCorrRamin3
+
+Lit. Correlations Prof. Ramin
+
+** Login
+
+GN2 login info
+
+** MachineAccessLog
+
+Old
+
+** MappingMethod
+
+GN1
+
+** News
+
+GN2
+
+** NStrain
+
+pheno publishfreeze (menu)
+ xref (keys)
+ xref links to publish (pubmed), phenotype, pubishdata
+geno genofreeze
+ xref (keys)
+ xref links to publish (pubmed), genotype, genodata
+probeset/expr. probesetfreeze
+ xref (keys)
+ xref links to publish (pubmed), probeset, probesetdata
+probe/expr. probefreeze
+ xref (keys)
+ xref links to publish (pubmed), probe, probedata
+
+Each dataset has 3 values (real value (1), number of samples (2), stderr (3))
+
+NStrain = number of phenotype samples
+
+ProbesetFreeze contains all data, incl. metabolomic.
+
+** Phenotype
+
+This table contains names, full descriptions, and short symbols for
+traits and phenotype used primarily in the Published Phenotypes
+databases.
+
+Contains 10k rows, March 2016, of which 5000 are for the BXDs).
+
+| Id | Pre_publication_description | Post_publication_description | Original_description | Units | Pre_publication_abbreviation | Post_publication_abbreviation | Lab_code | Submitter | Owner | Authorized_Users |
++----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+
+| 1 | NULL | Hippocampus weight | Original post publication description: Hippocampus weight | Unknown | NULL | HPCWT | NULL | robwilliams | NULL | robwilliams |
+| 2 | NULL | Cerebellum weight | Original post publication description: Cerebellum weight | mg | NULL | CBLWT | NULL | robwilliams | NULL | robwilliams |
+| 3 | NULL | Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide [units/100 ug protein] | Original post publication description: Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide [units/100 ug protein] | units/100 ug protein | NULL | IL1Activity | NULL | robwilliams | NULL | robwilliams |
+| 4 | NULL | Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg] | Original post publication description: Cerebellum weight [mg] | mg | NULL | CBLWT2 | NULL | robwilliams | NULL | robwilliams |
+| 5 | NULL | The coat color of 79 BXD RI strain | Original post publication description: The coat color of 79 BXD RI strain | Unknown | NULL | CoatColor | NULL | robwilliams | NULL | robwilliams |
++----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+
+5 rows in set (0.00 sec)
+
+** ProbeData
+
+Table with fine-grained probe level Affymetrix data only. Contains 1
+billion rows March 2016. This table may be deletable since it is only
+used by the Probe Table display in GN1. Not used in GN2
+(double-check).
+
+In comparison the "ProbeSetData" table contains more molecular assay
+data, including probe set data, RNA-seq data, proteomic data, and
+metabolomic data. 2.5 billion rows March 2016. In comparison,
+ProbeData contains data only for Affymetrix probe level data
+(e.g. Exon array probes and M430 probes).
+
+"ProbeData.StrainId" should be "CaseId" or "SampleId".
+
+"ProbeData" should probably be "AssayData" or something more neutral.
+
+select * from ProbeData limit 2;
++--------+----------+---------+
+| Id | StrainId | value |
++--------+----------+---------+
+| 503636 | 42 | 11.6906 |
+| 503636 | 43 | 11.4205 |
++--------+----------+---------+
+2 rows in set (0.00 sec)
+
+select count(*) from ProbeData limit 2;
++-----------+
+| count(*) |
++-----------+
+| 976753435 |
++-----------+
+1 row in set (0.00 sec)
+
+** ProbeSet
+
+Comment: PLEASE CHANGE TABLE NAME and rework fields carefully. This is
+a terrible table but it works well (RWW March 2016). It is used in
+combination with the crucial TRAIT DATA and ANALYSIS pages in GN1 and
+GN2. It is also used by annotators using the UPDATE INFO AND DATA web
+form to correct and update annotation. It is used by Arthur to enter
+new annotation files and metadata for arrays, genes, proteins,
+metabolites. The main problem with this table is that it is doing too
+much work.
+
+Initially (2003) this table contained only Affymetrix ProbeSet data
+for mouse (U74aV2 initially). Many other array platforms for different
+species were added. At least four other major categories of molecular
+assays have been added since about 2010.
+
+1. RNA-seq annotation and sequence data for transcripts using ENSEMBL
+ identifiers or NCBI NM_XXXXX and NR_XXXXX type identifiers
+
+2. Protein and peptide annotation and sequence data (see BXD Liver
+ Proteome data, SRM and SWATH type data) with identifiers such as
+ "abcb10_q9ji39_t311" for SRM data and "LLGNMIVIVLGHHLGKDFTPAAQAA"
+ for SWATH data where the latter is just the peptide fragment that
+ has been quantified. Data first entered in 2015 for work by Rudi
+ Aebersold and colleagues.
+
+3. Metabolite annotation and metadata (see BXD Liver Metabolome data)
+ with identifiers that are usually Mass charge ratios such as
+ "149.0970810_MZ"
+
+4. Epigenomic and methylome data (e.g. Human CANDLE Methylation data
+ with identifiers such as "cg24523000")
+
+It would make good sense to break this table into four or more types
+of molecular assay metadata or annotation tables) (AssayRNA_Anno,
+AssayProtein_Anno, AssayMetabolite_Anno, AssayEpigenome_Anno,
+AssayMetagenome_Anno), since these assays will have many differences
+in annotation content compared to RNAs.
+
+Some complex logic is used to update contents of this table when
+annotators modify and correct the information (for example, updating
+gene symbols). These features requested by Rob so that annotating one
+gene symbol in one species would annotate all gene symbols in the same
+species based on common NCBI GeneID number. For example, changing the
+gene alias for one ProbeSet.Id will changing the list of aliases in
+all instances with the same gene symbol.
+
+If the ProbeSet.BlatSeq (or is this ProbSetTargetSeq) is identical
+between different ProbeSet.Ids then annotation is forced to be the
+same even if the symbol or geneID is different. This "feature" was
+implemented when we found many probe sets with identical sequence but
+different annotations and identifiers.
+
+
+select count(*) from ProbeSet limit 5;
++----------+
+| count(*) |
++----------+
+| 4351030 |
++----------+
+
+| Id | ChipId | Name | TargetId | Symbol | description | Chr | Mb | alias | GeneId | GenbankId | SNP | BlatSeq | TargetSeq | UniGeneId | Strand_Probe | Strand_Gene | OMIM | comments | Probe_set_target_region | Probe_set_specificity | Probe_set_BLAT_score | Probe_set_Blat_Mb_start | Probe_set_Blat_Mb_end | Probe_set_strand | Probe_set_Note_by_RW | flag | Symbol_H | description_H | chromosome_H | MB_H | alias_H | GeneId_H | chr_num | name_num | Probe_Target_Description | RefSeq_TranscriptId | Chr_mm8 | Mb_mm8 | Probe_set_Blat_Mb_start_mm8 | Probe_set_Blat_Mb_end_mm8 | HomoloGeneID | Biotype_ENS | ProteinID | ProteinName | Flybase_Id | HMDB_ID | Confidence | ChEBI_ID | ChEMBL_ID | CAS_number | PubChem_ID | ChemSpider_ID | UNII_ID | EC_number | KEGG_ID | Molecular_Weight | Nugowiki_ID | Type | Tissue | PrimaryName | SecondaryNames | PeptideSequence |
++------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+
+| 7282 | 1 | 93288_at | NULL | Arpc2 | actin related protein 2/3 complex, subunit 2 | 1 | 74.310961 | AK008777 | 76709 | AI835883 | 0 | CCGACTTCCTTAAGGTGCTCAACCGGACTGCTTGCTACTGGATAATCGTGAGGGATTCTCCATTTGGGTTCCATTTTGTACGAGTTTGGCAAATAACCTGCAGAAACGAGCTGTGCTTGCAAGGACTTGATAGTTCCTAATCCTTTTCCAAGCTGTTTGCTTTGCAATATGT | ccgacttccttaaggtgctcaaccgtnnnnnnccnannnnccnagaaaaaagaaatgaaaannnnnnnnnnnnnnnnnnnttcatcccgctaactcttgggaactgaggaggaagcgctgtcgaccgaagnntggactgcttgctactggataatcgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgagggattctccatttgggttccattttgtacgagtttggcaaataacctgcagaaacgagctgtgcttgcaaggacttgatagttcctaagaattanaanaaaaaaaanaanttccacttgatcaanttaattcccttttatttttcctccctcantccccttccttttccaagctgtttgctttgcaatatgt | Mm.337038 | + | | 604224 | | NULL | 8.45 | 169 | 74.310961 | 74.31466 | NULL | NULL | 3 | NULL | NULL | NULL | NULL | NULL | NULL | 1 | 93288 | NULL | XM_129773 | 1 | 74.197594 | 74.197594 | 74.201293 | 4187 | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL |
++------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+
+2 rows in set (0.00 sec)
+
+
+
+
+** ProbeSetData
+
+Probedata - main molecular data. Probesets, metabolome,
+
+Almost all important molecular assay data is in this table including
+probe set data, RNA-seq data, proteomic data, and metabolomic
+data. 2.5 billion rows March 2016. In comparison, ProbeData contains
+data only for Affymetrix probe level data (e.g. Exon array probes and
+M430 probes).
+
+select count(*) from ProbeSetData limit 5;
++---------------+
+| count(*) |
++---------------+
+| 2,510,566,472 |
++---------------+
+
+
+select * from ProbeSetData limit 5;
++----+----------+-------+
+| Id | StrainId | value |
++----+----------+-------+
+| 1 | 1 | 5.742 |
+| 1 | 2 | 5.006 |
+| 1 | 3 | 6.079 |
+| 1 | 4 | 6.414 |
+| 1 | 5 | 4.885 |
++----+----------+-------+
+
+show indexes from ProbeSetData;
++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| ProbeSetData | 0 | DataId | 1 | Id | A | 34868978 | NULL | NULL | | BTREE | | |
+| ProbeSetData | 0 | DataId | 2 | StrainId | A | 2510566472 | NULL | NULL | | BTREE | | |
++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+
+select * from Strain limit 5;
++----+----------+----------+-----------+--------+-------+
+| Id | Name | Name2 | SpeciesId | Symbol | Alias |
++----+----------+----------+-----------+--------+-------+
+| 1 | B6D2F1 | B6D2F1 | 1 | NULL | NULL |
+| 2 | C57BL/6J | C57BL/6J | 1 | B6J | NULL |
+| 3 | DBA/2J | DBA/2J | 1 | D2J | NULL |
+| 4 | BXD1 | BXD1 | 1 | NULL | NULL |
+| 5 | BXD2 | BXD2 | 1 | NULL | NULL |
++----+----------+----------+-----------+--------+-------+
+
+show indexes from Strain;
++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| Strain | 0 | PRIMARY | 1 | Id | A | 14368 | NULL | NULL | | BTREE | | |
+| Strain | 0 | Name | 1 | Name | A | 14368 | NULL | NULL | YES | BTREE | | |
+| Strain | 0 | Name | 2 | SpeciesId | A | 14368 | NULL | NULL | | BTREE | | |
+| Strain | 1 | Symbol | 1 | Symbol | A | 14368 | NULL | NULL | YES | BTREE | | |
++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+
+A typical query may look like
+
+SELECT Strain.Name, ProbeSetData.value, ProbeSetSE.error, ProbeSetData.Id
+ FROM (ProbeSetData, ProbeSetFreeze, Strain, ProbeSet, ProbeSetXRef)
+ left join ProbeSetSE on
+ (ProbeSetSE.DataId = ProbeSetData.Id AND ProbeSetSE.StrainId = ProbeSetData.StrainId)
+ WHERE
+ ProbeSetFreeze.name = 'B139_K_1206_M' AND
+ ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
+ ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND
+ ProbeSetXRef.DataId = ProbeSetData.Id AND
+ ProbeSetData.StrainId = Strain.Id
+ Order BY Strain.Name
+
++-------+-------+-------+----------+
+| Name | value | error | Id |
++-------+-------+-------+----------+
+| SM001 | 38.3 | NULL | 25309550 |
+| SM001 | 2.7 | NULL | 25309520 |
+| SM001 | 20.3 | NULL | 25309507 |
+| SM001 | 125.8 | NULL | 25309511 |
+| SM001 | 8.2 | NULL | 25309534 |
++-------+-------+-------+----------+
+5 rows in set (22.28 sec)
+
+select * from ProbeSetFreeze limit 5;
++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
+| Id | ProbeFreezeId | AvgID | Name | Name2 | FullName | ShortName | CreateTime | OrderList | public | confidentiality | AuthorisedUsers | DataScale |
++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
+| 1 | 3 | 1 | Br_U_0803_M | BXDMicroArray_ProbeSet_August03 | UTHSC Brain mRNA U74Av2 (Aug03) MAS5 | Brain U74Av2 08/03 MAS5 | 2003-08-01 | NULL | 0 | 0 | NULL | log2 |
+| 2 | 10 | 1 | Br_U_0603_M | BXDMicroArray_ProbeSet_June03 | UTHSC Brain mRNA U74Av2 (Jun03) MAS5 | Brain U74Av2 06/03 MAS5 | 2003-06-01 | NULL | 0 | 0 | NULL | log2 |
+| 3 | 8 | 1 | Br_U_0303_M | BXDMicroArray_ProbeSet_March03 | UTHSC Brain mRNA U74Av2 (Mar03) MAS5 | Brain U74Av2 03/03 MAS5 | 2003-03-01 | NULL | 0 | 0 | NULL | log2 |
+| 4 | 5 | 1 | Br_U_0503_M | BXDMicroArray_ProbeSet_May03 | UTHSC Brain mRNA U74Av2 (May03) MAS5 | Brain U74Av2 05/03 MAS5 | 2003-05-01 | NULL | 0 | 0 | NULL | log2 |
+| 5 | 4 | 1 | HC_U_0303_M | GNFMicroArray_ProbeSet_March03 | GNF Hematopoietic Cells U74Av2 (Mar03) MAS5 | GNF U74Av2 03/03 MAS5 | 2003-03-01 | NULL | 0 | 0 | NULL | log2 |
++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
+
+ select * from ProbeSetXRef limit 5;
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old | LRS_old | pValue_old | mean | se | Locus | LRS | pValue | additive | h2 |
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+| 1 | 1 | 1 | 10.095.400 | 13.3971627898894 | 0.163 | 5.48794285714286 | 0.08525787814808819 | rs13480619 | 12.590069931048001 | 0.269 | -0.28515625 | NULL |
+| 1 | 2 | 2 | D15Mit189 | 10.042057464356201 | 0.431 | 9.90165714285714 | 0.0374686634976217 | CEL-17_50896182 | 10.5970737900941 | 0.304 | -0.11678333333333299 | NULL |
+| 1 | 3 | 3 | D5Mit139 | 5.43678531742749 | 0.993 | 7.83948571428571 | 0.0457583416912569 | rs13478499 | 6.0970532702754 | 0.988 | 0.112957489878542 | NULL |
+| 1 | 4 | 4 | D1Mit511 | 9.87815279480766 | 0.483 | 8.315628571428569 | 0.0470396593931327 | rs6154379 | 11.774867551173099 | 0.286 | -0.157113725490196 | NULL |
+| 1 | 5 | 5 | D16H21S16 | 10.191723834264499 | 0.528 | 9.19345714285714 | 0.0354801718293322 | rs4199265 | 10.923263374016202 | 0.468 | 0.11476470588235299 | NULL |
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+
+
+Note that the following unlimited search is very slow:
+
+select max(value) from ProbeSetData;
+
++------------+
+| max(value) |
++------------+
+| 26436006 |
++------------+
+1 row in set (2 min 16.31 sec)
+
+which is in some form is used in the search page, see [[https://github.com/genenetwork/genenetwork2_diet/blob/master/wqflask/wqflask/do_search.py#L811][the search code]].
+
+
+*** Improvements?
+
+Suggestions on the schema page:
+
+"StrainId" should be "CaseId" or "SampleId".
+
+"ProbeSetData" should probably be "AssayData" or something more neutral.
+
+*** Comments
+
+I think the ProbeSetData table should be generalized to a 'phenotypes'
+table with an 'sample_id' column and a 'value' column.
+
+A new table 'samples' will link each sample against an 'experiment',
+an 'individual' and which in turn can link to a 'strain'.
+
+Experiment is here in a wide sense, GTex can be one - I don't want to
+use dataset ;)
+
+This means a (slight) reordering:
+
+phenotypes: (id), sample_id, value
+samples: experiment_id, individual_id
+experiments: name, version
+individual: strain_id
+strains: species_id
+species: ...
+
+ProbeData is also interesting, because it has the same structure as
+ProbeSetData, but only contains microarrays. This tables should be one
+(when we clear up the cross-referencing) as they both contain
+phenotype values. Both are large tables.
+
+PublishData is another phenotype table with values only which can be
+merged into that same table.
+
+So we have phenotype data in 3 tables with exactly the same
+layout. There is also TissueProbeSet*, but we'll ignore those for
+now. I think we should merge these into one and have the sample ref
+refer to the type of data (probeset, probe, metabolomics,
+whatever). These are all phenotype values and by having them split
+into different tables they won't play well when looking for
+correlations.
+
+ProbeSet contains the metadata on the probes and should (eventually)
+move into NoSQL. There is plenty redundancy in that table now.
+
+I know it is going to be a pain to reorganize the database, but if we
+want to use it in the long run we are going to have to simplify it.
+
+
+
+** Publication and publishdata (all pheno)
+
+Phenotype pubs
+
+** QuickSearch
+
+No longer used
+
+** role
+
+empty
+
+** Sample*
+
+No longer used
+
+** Species & Strain (should be sample)
+
+Menu
+
+** InbredSet
+
+Menu
+
+** TableComments
+
+Metadata on DB
+
+** Temp*
+
+User upload data
+
+** Tissue
+
+Menu - 3rd level
+
+** TissueP*
+
+Correlation tables
+
+** User collection
+
+User selection - retained
+
+** UserPrivilege
+
+** Vlookup
+
diff --git a/doc/new_variable_names.txt b/doc/new_variable_names.txt
deleted file mode 100644
index c11c160e..00000000
--- a/doc/new_variable_names.txt
+++ /dev/null
@@ -1,6 +0,0 @@
-RISet/riset -> group
-webqtlDataset.py -> data_set.py
-webqtlDataset (class object) -> DataSet
-database/db -> dataset/data_set
-DataEditingPage -> show_trait.py/show_trait.html
-webqtlTrait -> GeneralTrait \ No newline at end of file
diff --git a/doc/notes_DA.txt b/doc/notes_DA.txt
deleted file mode 100644
index 410e0182..00000000
--- a/doc/notes_DA.txt
+++ /dev/null
@@ -1,10 +0,0 @@
-Danny's notes about the genenetwork source
-
-Location of static files:
-
-Location of HTML templates: wqflask/wqflask/templates/
-
-Entry point of the wqflask app: wqflask/wqflask/__init__.py
-
-Application routes: wqflask/wqflask/views.py
-
diff --git a/doc/gn_installation_notes.txt b/doc/old/gn_installation_notes.txt
index 584080f7..efea0309 100644
--- a/doc/gn_installation_notes.txt
+++ b/doc/old/gn_installation_notes.txt
@@ -96,7 +96,7 @@ Before installing from requirements.txt, install numpy separately:
pip install numpy==1.7.0 (or whatever version we're using)
Install from requirements.txt (after activating virtualenv):
-pip install -r gene/misc/requirements.txt
+pip install -r gene/doc/requirements.txt
===========================================
@@ -343,4 +343,4 @@ python runserver.py
To do full upgrade (as opposed to apt-get upgrade)
sudo aptitude full-upgrade
-=========================================== \ No newline at end of file
+===========================================
diff --git a/doc/notes.txt b/doc/old/notes.txt
index f8ce2759..f8ce2759 100644
--- a/doc/notes.txt
+++ b/doc/old/notes.txt
diff --git a/doc/requirements.txt b/doc/requirements.txt
deleted file mode 100644
index 39ee5652..00000000
--- a/doc/requirements.txt
+++ /dev/null
@@ -1,36 +0,0 @@
-BeautifulSoup==3.2.1
-Flask==0.9
-Flask-Login==0.1.3
-Flask-Mail==0.7.6
-Flask-Principal==0.3.4
-Flask-SQLAlchemy==0.16
-Flask-Security==1.6.0
-Flask-WTF==0.8.3
-Jinja2==2.6
-MySQL-python==1.2.4
-PyYAML==3.10
-#Reaper==1.0
-Reindent==0.1.1
-SQLAlchemy==0.8.0
-WTForms==1.0.3
-Werkzeug==0.8.3
-apache-libcloud==0.12.3
-argparse==1.2.1
-blinker==1.2
-cairosvg==1.0.15
-itsdangerous==0.17
-logging-tree==1.2
-logilab-astng==0.24.3
-logilab-common==0.59.1
-#numarray==1.5.2
-numpy==1.7.0
-passlib==1.6.1
-pp==1.6.3
-pylint==0.27.0
-redis==2.7.2
-requests==1.1.0
-scipy==0.11.0
-simplejson==3.0.7
-wsgiref==0.1.2
-yolk==0.4.3
-XlsxWriter==0.7.2
diff --git a/doc/todo.txt b/doc/todo.txt
deleted file mode 100644
index 1d781b13..00000000
--- a/doc/todo.txt
+++ /dev/null
@@ -1,2 +0,0 @@
-- Ask Rob about potentially recoding qtlreaper
-- Ask Rob about Probe/cellid traits \ No newline at end of file