aboutsummaryrefslogtreecommitdiff
path: root/api
diff options
context:
space:
mode:
Diffstat (limited to 'api')
-rw-r--r--api/GN3-REST-API-Implementation.md267
1 files changed, 239 insertions, 28 deletions
diff --git a/api/GN3-REST-API-Implementation.md b/api/GN3-REST-API-Implementation.md
index 200ca72..0147fcb 100644
--- a/api/GN3-REST-API-Implementation.md
+++ b/api/GN3-REST-API-Implementation.md
@@ -1051,63 +1051,274 @@ Expected Result:
{
"@context": {
"alias": "skos:altLabel",
+ "alignID": "gnt:hasAlignID",
"blatMbEnd": "gnt:hasBlatMbEnd",
- "blatMbEnd2016": "gnt:hasBlatMbEnd2016",
"blatMbStart": "gnt:hasBlatMbStart",
- "blatMbStart2016": "gnt:hasBlatMbStart2016",
"blatScore": "gnt:hasBlatScore",
"blatSeq": "gnt:hasBlatSeq",
- "chebi": "gnt:hasChebiId",
"chip": "gnt:hasChip",
"chr": "gnt:chr",
+ "chromosome": "gnt:chromosome",
+ "comments": "rdfs:comments",
"data": "@graph",
"dct": "http://purl.org/dc/terms/",
"description": "dct:description",
+ "gene": "gnt:gene",
+ "gnc": "http://genenetwork.org/category/",
"gnt": "http://genenetwork.org/term/",
- "homologene": "gnt:hasHomologeneId",
"id": "@id",
- "kegg": "gnt:hasKeggId",
+ "kgID": "gnt:hasKgID",
+ "location": "gnt:location",
"mb": "gnt:mb",
- "mb2016": "gnt:mb2016",
- "mbMm8": "gnt:mbMm8",
"name": "rdfs:label",
- "omim": "gnt:hasOmimId",
- "pubchem": "gnt:hasPubChemId",
- "rdf": "http://www.w3.org/1999/02/22-rdf-syntax-ns#",
+ "rdf": "http://www.w3.org/1999/02/22-rdf-syntax-ns#>",
"rdfs": "http://www.w3.org/2000/01/rdf-schema#",
+ "references": "dct:references",
"skos": "http://www.w3.org/2004/02/skos/core#",
+ "species": "gnt:belongsToSpecies",
"specificity": "gnt:hasSpecificity",
+ "strand": "gnt:Strand",
+ "strandProbe": "gnt:strandProbe",
"symbol": "gnt:symbol",
- "targetId": "gnt:hasTargetId",
- "targetSeq": "gnt:hasTargetSeq",
- "targetsRegion": "gnt:targetsRegion",
+ "targetID": "gnt:hasTargetId",
+ "targetRegion": "gnt:targetsRegion",
+ "targetSequence": "gnt:hasTargetSeq",
+ "transcript": "gnt:transcript",
+ "txEnd": "gnt:TxEnd",
+ "txStart": "gnt:TxStart",
"type": "@type",
- "uniprot": "gnt:hasUniprotId"
+ "unigenID": "gnt:hasUnigenID",
+ "uniprot": "gnt:uniprot"
},
"alias": "HHG1; HLP3; HPE3; SMMCI; Dsh; Hhg1",
"blatMbEnd": 28.4573,
- "blatMbEnd2016": 28.7837,
"blatMbStart": 28.4572,
- "blatMbStart2016": 28.7837,
"blatScore": "72",
"blatSeq": "CATGGGGGTCCACAAATTATATTTTAATTTAACTATTTTCCAATGTAATAGCCGTCTTCTGTACTGCCTTCTT",
- "chip": "Affy Mouse Genome 430 2.0 (GPL1261)",
+ "chip": {
+ "id": "http://genenetwork.org/id/platformMouse430_2",
+ "name": "Affy Mouse Genome 430 2.0 (GPL1261)"
+ },
"chr": "5",
"description": "sonic hedgehog hedgehog",
- "homologene": {
- "id": "https://bio2rdf.org/homologene:30961"
- },
"id": "http://genenetwork.org/id/probeset1436869_at",
+ "location": "Chr 5 @ 28.457155 on the minus strand",
"mb": 28.4572,
- "mb2016": 28.7837,
- "mbMm8": 28.7879,
"name": "1436869_at",
- "omim": {
- "id": "https://www.omim.org/entry/600725"
- },
+ "references": [
+ {
+ "id": "http://www.ncbi.nlm.nih.gov/homologene/?term=30961"
+ },
+ {
+ "id": "http://www.ncbi.nlm.nih.gov/omim/600725"
+ },
+ {
+ "id": "http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids=20423"
+ }
+ ],
"specificity": "3.6",
- "symbol": "Shh",
- "targetSeq": "catgggggtccacaaattatatttttatacacagaattgtanattanatttttgagagatcaatacctaantgaatgacatttcattttttgaaagtgtaaaatatgnaaatatattattttaatttaactattttccaatgtaatagccgtcttctgtactgccttctt",
- "type": "http://genenetwork.org/category/Probeset"
+ "strandProbe": "-",
+ "symbol": {
+ "alignID": [
+ "uc008wua.2",
+ "R17645"
+ ],
+ "chromosome": [
+ "4",
+ "7",
+ "5"
+ ],
+ "description": "sonic hedgehog",
+ "gene": [
+ {
+ "id": "http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids=6469"
+ },
+ {
+ "id": "http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids=29499"
+ },
+ {
+ "id": "http://www.ncbi.nlm.nih.gov/gene?cmd=Retrieve&dopt=Graphics&list_uids=20423"
+ }
+ ],
+ "gnt:hasProteinID": [
+ "Q62226",
+ "SHH"
+ ],
+ "gnt:hasRgdID": "3673",
+ "id": "http://genenetwork.org/id/geneShh",
+ "kgID": [
+ "L27340",
+ "uc008wua.2"
+ ],
+ "name": [
+ "SHH",
+ "Shh"
+ ],
+ "references": [
+ {
+ "comments": "Expression across many tissues and cell types",
+ "id": "http://biogps.org/?org=mouse#goto=genereport&id=20423",
+ "name": [
+ "BioGPS",
+ "BioGPS Resource Link"
+ ]
+ },
+ {
+ "comments": "GeneMANIA",
+ "id": "https://genemania.org/search/homo-sapiens/6469",
+ "name": "GeneMANIA"
+ },
+ {
+ "id": "http://www.pantherdb.org/genes/geneList.do?searchType=basic&fieldName=all&organism=all&listType=1&fieldValue=SHH"
+ },
+ {
+ "comments": "GTEx Portal",
+ "id": "https://www.gtexportal.org/home/gene/SHH",
+ "name": "GTEx Portal"
+ },
+ {
+ "comments": "GTEx Portal",
+ "id": "https://www.gtexportal.org/home/gene/Shh",
+ "name": "GTEx Portal"
+ },
+ {
+ "comments": "Human Protein Atlas",
+ "id": "http://www.proteinatlas.org/search/Shh",
+ "name": "Protein Atlas"
+ },
+ {
+ "comments": "Meta-analysis of gene expression data",
+ "id": "http://www.chibi.ubc.ca/Gemma/gene/showGene.html?ncbiid=29499",
+ "name": "Gemma"
+ },
+ {
+ "comments": "Rat Genome DB",
+ "id": "https://rgd.mcw.edu/rgdweb/elasticResults.html?term=Shh&category=Gene&species=Mouse",
+ "name": "Rat Genome DB"
+ },
+ {
+ "comments": "Allen Brain Atlas",
+ "id": "http://mouse.brain-map.org/search/show?search_type=gene&search_term=",
+ "name": "ABA"
+ },
+ {
+ "comments": "Protein interactions: known and inferred",
+ "id": "http://string-db.org/newstring_cgi/show_network_section.pl?identifier=SHH",
+ "name": "STRING"
+ },
+ {
+ "comments": "EBI GWAS",
+ "id": "https://www.ebi.ac.uk/gwas/search?query=SHH",
+ "name": "EBI GWAS"
+ },
+ {
+ "id": "http://www.pantherdb.org/genes/geneList.do?searchType=basic&fieldName=all&organism=all&listType=1&fieldValue=Shh"
+ },
+ {
+ "comments": "GeneMANIA",
+ "id": "https://genemania.org/search/rattus-norvegicus/29499",
+ "name": "GeneMANIA"
+ },
+ {
+ "comments": "EBI GWAS",
+ "id": "https://www.ebi.ac.uk/gwas/search?query=Shh",
+ "name": "EBI GWAS"
+ },
+ {
+ "comments": "Meta-analysis of gene expression data",
+ "id": "http://www.chibi.ubc.ca/Gemma/gene/showGene.html?ncbiid=6469",
+ "name": "Gemma"
+ },
+ {
+ "comments": "Rat Genome DB",
+ "id": "https://rgd.mcw.edu/rgdweb/elasticResults.html?term=SHH&category=Gene&species=Human",
+ "name": "Rat Genome DB"
+ },
+ {
+ "comments": "Meta-analysis of gene expression data",
+ "id": "http://www.chibi.ubc.ca/Gemma/gene/showGene.html?ncbiid=20423",
+ "name": "Gemma"
+ },
+ {
+ "comments": "GeneMANIA",
+ "id": "https://genemania.org/search/mus-musculus/20423",
+ "name": "GeneMANIA"
+ },
+ {
+ "comments": "Expression across many tissues and cell types",
+ "id": "http://biogps.org/?org=human#goto=genereport&id=6469",
+ "name": [
+ "BioGPS Resource Link",
+ "BioGPS"
+ ]
+ },
+ {
+ "comments": "Expression across many tissues and cell types",
+ "id": "http://biogps.org/?org=rat#goto=genereport&id=29499",
+ "name": [
+ "BioGPS Resource Link",
+ "BioGPS"
+ ]
+ },
+ {
+ "comments": "Human Protein Atlas",
+ "id": "http://www.proteinatlas.org/search/SHH",
+ "name": "Protein Atlas"
+ },
+ {
+ "comments": "Protein interactions: known and inferred",
+ "id": "http://string-db.org/newstring_cgi/show_network_section.pl?identifier=Shh",
+ "name": "STRING"
+ }
+ ],
+ "species": [
+ {
+ "id": "http://genenetwork.org/id/Rat"
+ },
+ {
+ "id": "http://genenetwork.org/id/Human"
+ },
+ {
+ "id": "http://genenetwork.org/id/Rattus_norvegicus"
+ },
+ {
+ "id": "http://genenetwork.org/id/Mouse"
+ }
+ ],
+ "strand": [
+ "+",
+ "-"
+ ],
+ "transcript": [
+ {
+ "id": "https://portals.broadinstitute.org/gpp/public/trans/details?transName=NM_017221"
+ },
+ {
+ "id": "https://portals.broadinstitute.org/gpp/public/trans/details?transName=NM_009170"
+ },
+ {
+ "id": "https://portals.broadinstitute.org/gpp/public/trans/details?transName=NM_000193"
+ }
+ ],
+ "txEnd": [
+ 28.4671,
+ 0.727691,
+ 155.104,
+ 2.20966
+ ],
+ "txStart": [
+ 2.2005,
+ 0.718538,
+ 155.095,
+ 28.4568
+ ],
+ "type": "gnc:GeneSymbol",
+ "unigenID": [
+ "Mm.57202",
+ "Hs.164537"
+ ]
+ },
+ "targetSequence": "catgggggtccacaaattatatttttatacacagaattgtanattanatttttgagagatcaatacctaantgaatgacatttcattttttgaaagtgtaaaatatgnaaatatattattttaatttaactattttccaatgtaatagccgtcttctgtactgccttctt",
+ "type": "gnc:Probeset"
}
```
generated by cgit v1.2.3 (git 2.44.0) at 2024-11-10 03:26:55 +0000