path: root/doc/database.org

* Database Information

WARNING: This document contains information on the GN databases which
will change over time. The GN database is currently MySQL based and,
while efficient, contains a number of design choices we want to grow
'out' of. Especially with an eye on reproducibility we want to
introduce versioning.

So do not treat the information in this document as a final way of
accessing data. It is better to use the
[[https://github.com/genenetwork/gn_server/blob/master/doc/API.md][REST API]].

* The small test database (2GB)

The default install comes with a smaller database which includes a
number of the BXD's and the Human liver dataset (GSE9588).

* GeneNetwork database

** Estimated table sizes


select table_name,round(((data_length + index_length) / 1024 / 1024), 2) `Size in MB` from information_schema.TABLES where table_schema = "db_webqtl" order by data_length;

+-------------------------+------------+
| table_name              | Size in MB |
+-------------------------+------------+
| ProbeSetData            |   59358.80 |
| SnpAll                  |   15484.67 |
| ProbeData               |   22405.44 |
| SnpPattern              |    9177.05 |
| ProbeSetSE              |   14551.02 |
| QuickSearch             |    5972.86 |
| ProbeSetXRef            |    4532.89 |
| LCorrRamin3             |   18506.53 |
| ProbeSE                 |    6263.83 |
| ProbeSet                |    2880.21 |
| Probe                   |    2150.30 |
| GenoData                |    3291.91 |
| CeleraINFO_mm6          |     989.80 |
| pubmedsearch            |    1032.50 |
| ProbeXRef               |     743.38 |
| GeneRIF_BASIC           |     448.54 |
| BXDSnpPosition          |     224.44 |
| EnsemblProbe            |     133.66 |
| EnsemblProbeLocation    |     105.49 |
| Genbank                 |      37.71 |
| TissueProbeSetData      |      74.42 |
| AccessLog               |      42.38 |
| GeneList                |      34.11 |
| Geno                    |      33.90 |
| MachineAccessLog        |      28.34 |
| IndelAll                |      22.42 |
| PublishData             |      22.54 |
| TissueProbeSetXRef      |      14.73 |
| ProbeH2                 |      13.26 |
| GenoXRef                |      22.83 |
| TempData                |       8.35 |
| GeneList_rn3            |       5.54 |
| GORef                   |       4.97 |
| Phenotype               |       6.50 |
| temporary               |       3.59 |
| InfoFiles               |       3.32 |
| Publication             |       3.42 |
| Homologene              |       5.69 |
| Datasets                |       2.31 |
| GeneList_rn33           |       2.61 |
| PublishSE               |       4.71 |
| GeneRIF                 |       2.18 |
| Vlookup                 |       1.87 |
| H2                      |       2.18 |
| PublishXRef             |       2.18 |
| NStrain                 |       4.80 |
| IndelXRef               |       2.91 |
| Strain                  |       1.07 |
| GeneMap_cuiyan          |       0.51 |
| user_collection         |       0.30 |
| CaseAttributeXRef       |       0.44 |
| StrainXRef              |       0.56 |
| GeneIDXRef              |       0.77 |
| Docs                    |       0.17 |
| News                    |       0.17 |
| ProbeSetFreeze          |       0.22 |
| GeneRIFXRef             |       0.24 |
| Sample                  |       0.06 |
| login                   |       0.06 |
| user                    |       0.04 |
| TableFieldAnnotation    |       0.05 |
| DatasetMapInvestigator  |       0.05 |
| User                    |       0.04 |
| ProbeFreeze             |       0.06 |
| TableComments           |       0.02 |
| Investigators           |       0.02 |
| DBList                  |       0.03 |
| Tissue                  |       0.02 |
| GeneChip                |       0.01 |
| GeneCategory            |       0.01 |
| SampleXRef              |       0.01 |
| InbredSet               |       0.01 |
| SnpAllele_to_be_deleted |       0.00 |
| Organizations           |       0.01 |
| PublishFreeze           |       0.00 |
| GenoFreeze              |       0.00 |
| Chr_Length              |       0.01 |
| SnpSource               |       0.00 |
| AvgMethod               |       0.00 |
| Species                 |       0.00 |
| Dataset_mbat            |       0.00 |
| TissueProbeFreeze       |       0.00 |
| EnsemblChip             |       0.00 |
| TissueProbeSetFreeze    |       0.01 |
| UserPrivilege           |       0.00 |
| CaseAttribute           |       0.00 |
| MappingMethod           |       0.00 |
| DBType                  |       0.00 |
| InfoFilesUser_md5       |       0.00 |
| GenoCode                |       0.00 |
| DatasetStatus           |       0.00 |
| GeneChipEnsemblXRef     |       0.00 |
| GenoSE                  |       0.00 |
| user_openids            |       0.00 |
| roles_users             |       0.00 |
| role                    |       0.00 |
| Temp                    |       NULL |
+-------------------------+------------+
97 rows in set, 1 warning (0.01 sec)

All *Data tables are large

** User access

According to the meta data:

This table tracks access time and IP addresses. Used for logging in
registered users and tracking cookies.

# GN1 uses access table and GN2 uses user table (true/false?)

 select * from AccessLog limit 5;
+-------+---------------------+----------------+
| id    | accesstime          | ip_address     |
+-------+---------------------+----------------+
| 12174 | 2003-10-28 02:17:41 | 130.120.104.71 |
| 12173 | 2003-10-28 02:16:27 | 130.120.104.71 |
|     3 | 2003-02-22 07:38:33 | 192.117.159.1  |
|     4 | 2003-02-22 07:49:13 | 192.117.159.1  |
|     5 | 2003-02-22 07:51:08 | 192.117.159.1  |
+-------+---------------------+----------------+

select * from AccessLog order by accesstime desc limit 5;
+---------+---------------------+---------------+
| id      | accesstime          | ip_address    |
+---------+---------------------+---------------+
| 1025735 | 2016-02-08 14:23:29 | 100.43.81.157 |
| 1025734 | 2016-02-08 13:54:28 | 180.76.15.144 |
| 1025733 | 2016-02-08 13:43:37 | 66.249.65.217 |
| 1025732 | 2016-02-08 13:39:50 | 66.249.65.217 |
| 1025731 | 2016-02-08 13:15:46 | 66.249.65.217 |
+---------+---------------------+---------------+

Quite a few trait page hits:

select count(*) from AccessLog;

+----------+
| count(*) |
+----------+
|  1025685 |
+----------+

show indexes from AccessLog;
+-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Table     | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
+-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| AccessLog |          0 | PRIMARY  |            1 | id          | A         |     1025685 |     NULL | NULL   |      | BTREE      |         |               |
+-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+

This table is being used by both GN1 and GN2 from the trait pages!

: grep -ir AccessLog *|grep -e "^gn1\|^gn2"|grep \.py|grep -v doc

gn1/web/webqtl/showTrait/ShowTraitPage.py:              query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \
gn1/web/webqtl/showTrait/ShowTraitPage.py:                      self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)" ,user_ip)
gn1/web/webqtl/textUI/cmdClass.py:                      query = """SELECT count(id) FROM AccessLog WHERE ip_address = %s AND UNIX_TIMESTAMP()-UNIX_TIMESTAMP(accesstime)<86400"""
gn1/web/webqtl/textUI/cmdClass.py:                      query = """INSERT INTO AccessLog(accesstime,ip_address) values(Now(),%s)"""
gn2/wqflask/wqflask/show_trait/show_trait_page.py:        query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \
gn2/wqflask/wqflask/show_trait/show_trait_page.py:        self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)", user_ip)

When looking at the code in GN1 and GN2 it restricts the daily use of
the trait data page (set to 1,000 - whoever reaches that?). Unlike
mentioned in the schema description, this table does *not* keep track
of cookies.

From the code it looks like GN2 uses a mixture of Redis and sqlalchemy
to keep track of logged in sessions (see
gn2/wqflask/wqflask/user_manager.py) and cookies through a user_uuid in
model.py.

In gn2/wqflask/wqflask/templates/collections/view_anonymous.html it
show_trait_page appears to be loaded (need to check).

** AvgMethod

Probesetfreeze refers to AvgMethod

** BXDSnPosition

Snp table (all snps)

Mapping in GN1 shows snps when  you select a chromosome.

** CaseAttribute(XRef)

Metadata

** CeleralINFO_mm6

?

** Chr_Length (/cross/BXD.json)

Default mm9, column for mm8

select * from Chr_Length;

| Name | SpeciesId | OrderId | Length    | Length_mm8 |
| 1    |         1 |       1 | 197195432 |  197069962 |
| 2    |         1 |       2 | 181748087 |  181976762 |

Table should be merged with

** Dataset_mbat

Menu for BXD (linkouts)

** DatasetMapInvestigator

Arthur?

** DataSets

Information/metadata

** DatasetStatus

Arthur private/public

** DBList and DBType

Hooked in API (URL encoding)

** Docs

GN2 only (see menu bar)

** Ensembl*

Probe information

(will be deprecated)

** Genbank

Linkout and not important

** GeneCategory

Not important. GeneWiki notes function classification.

Deprecate.

** GeneChip

** GeneIDXRef

Interspecies gene comparison

** GeneList

Track info

** Genlist_rn3(3)

Rat list

** GeneMap_cuiyan

Link outs

** GeneRIF

Wiki info (nightly updated from NCBI)

XRef should be foreign keys

** Geno (genotype/marker/'marker'.json)

SNP or marker info

INFO:base.trait:.sql: retrieve_info:
                                select Geno.Chr, Geno.Mb from Geno, Species
                                where Species.Name = 'mouse' and
                                Geno.Name = 'rs3693478' and
                                Geno.SpeciesId = Species.Id

| Id | SpeciesId | Name       | Marker_Name | Chr  | Mb        | Sequence                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              | Source  | chr_num | Source2 | Comments | used_by_geno_file | Mb_mm8    | Chr_mm8 |
|  1 |         1 | 01.001.695 | 01.001.695  | 1    |  4.678288 | GCCCTGCCCACCTCAGAGCAAGCTGCCACCCAGGAGTCCGTGTTTCAGGAGATGTGTGAGGAGGGCCTGCTGGAGGAGTGTGATGGTGAGGATGAGGCAGGCCGTGCCGCG[T/C]AGCCAGAGGCTGGTGATGGGACCACCGAGATCTCACCCACTGGTGCTGCTGATCCTGAGAAGAGGATGGAGAAGAAGACGGAGCAGCAGCACACCGGCGGCGGGAGAAAGCTGCTCGTAAGCTGCTCGTAAGCTACGGGTGCAGCAGGCTGCACTTAGGGCAGCCCGGCTTCAGCACCAAGAACTCTTCAGGCTGCATGGGATCAAGGCCCAGGTGGCCCGAAGGCTGGCAGAACTCGCACACGGGAGGGAGCAGCAGCGCATACAGCGACTGGCAGAGGCTGACAAGCCCCGAAGGCTGGGACGACTCAAGTACCAGGCTCCTGACATTGATGTGCAGCTCAGCTCTGAGCTGTCTGGCCCACTCAGGACACTGAAACCAGAAGGTCACATTCTCCAAGACAGGTTCAAGAGCTTCCAGAAGAGAAATATGATTGAGCCCCGAGAACGAGCCAAGTTCAAGCGCAAATAAAAAATGAAGTTGGTGGAGAAGCGGGCCTACCATGAGATTCAGTTGTAGCTGTGCAGATGTCGGAGCCCCGCCCCTCAATAAAGTTCTGTGACAAAAAAAAAAAAAAAAAAAGAAGAAGAAGAAGAAAAGGAAAAAAAAGAAGAAAAAGAAAAAAAAAGAAAAAAGAAAAAGAAAACACATCACTTGGCAAAACTCCATAGACTCTATGTGATTCATGTTTCAAACATGCACCTA | GNF_SNP |       1 | GNF     | NULL     | NULL              |  4.678288 | 1       |

** GenoCode

Belongs to someone else

** GenoData

Allele info

** GenoFreeze

Big menu (Freeze refers to menu)

** GenoSE

SE standard err, not used

** GenoXREF

Very important. Key links between Geno, GenoData

** GORef

GO terms

** H2

Heritability for probeset(?)

** Homologene

Homology, not used much

** InbredSet (/cross/BXD.info)

Group in menu

** Indelall, SnpAll, SnpPattern, SnpSource

Indel Snp browser (variant browser Gn1)

** Info*

Infra system PhP

Data Info button

Infosystem users has separate entries

Also Investigators, User, Organizations,

** LCorrRamin3

Lit. Correlations Prof. Ramin

** Login

GN2 login info

** MachineAccessLog

Old

** MappingMethod

GN1

** News

GN2

** NStrain

pheno           publishfreeze (menu)
                       xref (keys)
                          xref links to publish (pubmed), phenotype, pubishdata
geno            genofreeze
                       xref (keys)
                          xref links to publish (pubmed), genotype, genodata
probeset/expr.  probesetfreeze
                       xref (keys)
                          xref links to publish (pubmed), probeset, probesetdata
probe/expr.  probefreeze
                       xref (keys)
                          xref links to publish (pubmed), probe, probedata

Each dataset has 3 values (real value (1), number of samples (2), stderr (3))

NStrain = number of phenotype samples

ProbesetFreeze contains all data, incl. metabolomic.

** Phenotype

This table contains names, full descriptions, and short symbols for
traits and phenotype used primarily in the Published Phenotypes
databases.

Contains 10k rows, March 2016, of which 5000 are for the BXDs).

| Id | Pre_publication_description | Post_publication_description                                                                                         | Original_description                                                                                                                                        | Units                | Pre_publication_abbreviation | Post_publication_abbreviation | Lab_code | Submitter   | Owner | Authorized_Users |
+----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+
|  1 | NULL                        | Hippocampus weight                                                                                                   | Original post publication description: Hippocampus weight                                                                                                   | Unknown              | NULL                         | HPCWT                         | NULL     | robwilliams | NULL  | robwilliams      |
|  2 | NULL                        | Cerebellum weight                                                                                                    | Original post publication description: Cerebellum weight                                                                                                    | mg                   | NULL                         | CBLWT                         | NULL     | robwilliams | NULL  | robwilliams      |
|  3 | NULL                        | Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide  [units/100 ug protein] | Original post publication description: Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide  [units/100 ug protein] | units/100 ug protein | NULL                         | IL1Activity                   | NULL     | robwilliams | NULL  | robwilliams      |
|  4 | NULL                        | Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg]                 | Original post publication description: Cerebellum weight [mg]                                                                                               | mg                   | NULL                         | CBLWT2                        | NULL     | robwilliams | NULL  | robwilliams      |
|  5 | NULL                        | The coat color of 79 BXD RI strain                                                                                   | Original post publication description: The coat color of 79 BXD RI strain                                                                                   | Unknown              | NULL                         | CoatColor                     | NULL     | robwilliams | NULL  | robwilliams      |
+----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+
5 rows in set (0.00 sec)

** ProbeData

Table with fine-grained probe level Affymetrix data only. Contains 1
billion rows March 2016. This table may be deletable since it is only
used by the Probe Table display in GN1. Not used in GN2
(double-check).

In comparison the "ProbeSetData" table contains more molecular assay
data, including probe set data, RNA-seq data, proteomic data, and
metabolomic data. 2.5 billion rows March 2016. In comparison,
ProbeData contains data only for Affymetrix probe level data
(e.g. Exon array probes and M430 probes).

"ProbeData.StrainId" should be "CaseId" or "SampleId".

"ProbeData" should probably be "AssayData" or something more neutral.

select * from ProbeData limit 2;
+--------+----------+---------+
| Id     | StrainId | value   |
+--------+----------+---------+
| 503636 |       42 | 11.6906 |
| 503636 |       43 | 11.4205 |
+--------+----------+---------+
2 rows in set (0.00 sec)

select count(*) from ProbeData limit 2;
+-----------+
| count(*)  |
+-----------+
| 976753435 |
+-----------+
1 row in set (0.00 sec)

** ProbeSet

Comment: PLEASE CHANGE TABLE NAME and rework fields carefully. This is
a terrible table but it works well (RWW March 2016). It is used in
combination with the crucial TRAIT DATA and ANALYSIS pages in GN1 and
GN2. It is also used by annotators using the UPDATE INFO AND DATA web
form to correct and update annotation. It is used by Arthur to enter
new annotation files and metadata for arrays, genes, proteins,
metabolites. The main problem with this table is that it is doing too
much work.

Initially (2003) this table contained only Affymetrix ProbeSet data
for mouse (U74aV2 initially). Many other array platforms for different
species were added. At least four other major categories of molecular
assays have been added since about 2010.

1. RNA-seq annotation and sequence data for transcripts using ENSEMBL
   identifiers or NCBI NM_XXXXX and NR_XXXXX type identifiers

2. Protein and peptide annotation and sequence data (see BXD Liver
   Proteome data, SRM and SWATH type data) with identifiers such as
   "abcb10_q9ji39_t311" for SRM data and "LLGNMIVIVLGHHLGKDFTPAAQAA"
   for SWATH data where the latter is just the peptide fragment that
   has been quantified. Data first entered in 2015 for work by Rudi
   Aebersold and colleagues.

3. Metabolite annotation and metadata (see BXD Liver Metabolome data)
   with identifiers that are usually Mass charge ratios such as
   "149.0970810_MZ"

4. Epigenomic and methylome data (e.g. Human CANDLE Methylation data
   with identifiers such as "cg24523000")

It would make good sense to break this table into four or more types
of molecular assay metadata or annotation tables) (AssayRNA_Anno,
AssayProtein_Anno, AssayMetabolite_Anno, AssayEpigenome_Anno,
AssayMetagenome_Anno), since these assays will have many differences
in annotation content compared to RNAs.

Some complex logic is used to update contents of this table when
annotators modify and correct the information (for example, updating
gene symbols). These features requested by Rob so that annotating one
gene symbol in one species would annotate all gene symbols in the same
species based on common NCBI GeneID number. For example, changing the
gene alias for one ProbeSet.Id will changing the list of aliases in
all instances with the same gene symbol.

If the ProbeSet.BlatSeq (or is this ProbSetTargetSeq) is identical
between different ProbeSet.Ids then annotation is forced to be the
same even if the symbol or geneID is different. This "feature" was
implemented when we found many probe sets with identical sequence but
different annotations and identifiers.


select count(*) from ProbeSet limit 5;
+----------+
| count(*) |
+----------+
|  4351030 |
+----------+

| Id   | ChipId | Name     | TargetId | Symbol | description                                  | Chr  | Mb        | alias    | GeneId | GenbankId | SNP  | BlatSeq                                                                                                                                                                      | TargetSeq                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             | UniGeneId | Strand_Probe | Strand_Gene | OMIM   | comments | Probe_set_target_region | Probe_set_specificity | Probe_set_BLAT_score | Probe_set_Blat_Mb_start | Probe_set_Blat_Mb_end | Probe_set_strand | Probe_set_Note_by_RW | flag | Symbol_H | description_H | chromosome_H | MB_H | alias_H | GeneId_H | chr_num | name_num | Probe_Target_Description | RefSeq_TranscriptId | Chr_mm8 | Mb_mm8    | Probe_set_Blat_Mb_start_mm8 | Probe_set_Blat_Mb_end_mm8 | HomoloGeneID | Biotype_ENS | ProteinID | ProteinName | Flybase_Id | HMDB_ID | Confidence | ChEBI_ID | ChEMBL_ID | CAS_number | PubChem_ID | ChemSpider_ID | UNII_ID | EC_number | KEGG_ID | Molecular_Weight | Nugowiki_ID | Type | Tissue | PrimaryName | SecondaryNames | PeptideSequence |
+------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+
| 7282 |      1 | 93288_at | NULL     | Arpc2  | actin related protein 2/3 complex, subunit 2 | 1    | 74.310961 | AK008777 | 76709  | AI835883  |    0 | CCGACTTCCTTAAGGTGCTCAACCGGACTGCTTGCTACTGGATAATCGTGAGGGATTCTCCATTTGGGTTCCATTTTGTACGAGTTTGGCAAATAACCTGCAGAAACGAGCTGTGCTTGCAAGGACTTGATAGTTCCTAATCCTTTTCCAAGCTGTTTGCTTTGCAATATGT | ccgacttccttaaggtgctcaaccgtnnnnnnccnannnnccnagaaaaaagaaatgaaaannnnnnnnnnnnnnnnnnnttcatcccgctaactcttgggaactgaggaggaagcgctgtcgaccgaagnntggactgcttgctactggataatcgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgagggattctccatttgggttccattttgtacgagtttggcaaataacctgcagaaacgagctgtgcttgcaaggacttgatagttcctaagaattanaanaaaaaaaanaanttccacttgatcaanttaattcccttttatttttcctccctcantccccttccttttccaagctgtttgctttgcaatatgt                                                                                                                                                                                                                                     | Mm.337038 | +            |             | 604224 |          | NULL                    |                  8.45 |                  169 |               74.310961 |              74.31466 | NULL             | NULL                 | 3    | NULL     | NULL          | NULL         | NULL | NULL    | NULL     |       1 |    93288 | NULL                     | XM_129773           | 1       | 74.197594 |                   74.197594 |                 74.201293 | 4187         | NULL        | NULL      | NULL        | NULL       | NULL    |       NULL |     NULL | NULL      | NULL       |       NULL |          NULL | NULL    | NULL      | NULL    |             NULL |        NULL | NULL | NULL   | NULL        | NULL           | NULL            |
+------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+
2 rows in set (0.00 sec)

** ProbeSetXRef (phenotypes/dataset_name.json)

For every probe set (read dataset measuring point):

select * from ProbeSetXRef;

| ProbeSetFreezeId | ProbeSetId | DataId   | Locus_old | LRS_old | pValue_old | mean             | se   | Locus      | LRS               | pValue | additive              | h2   |
|              112 |     123528 | 23439389 | NULL      |    NULL |       NULL |  6.7460707070707 | NULL | rs6239372  |  10.9675593568894 |  0.567 |    0.0448545966228878 | NULL |
|              112 |     123527 | 23439388 | NULL      |    NULL |       NULL | 6.19416161616162 | NULL | rs13476936 |  10.9075670392762 |  0.567 |   -0.0358456732993988 | NULL |

where ProbeSetFreezeId is the dataset (experiment). ProbesetId refers
to the probe set information (measuring point). DataId points to the
data point. The othe values are used for search.

It is used in search thus:

SELECT distinct ProbeSet.Name as TNAME,
  ProbeSetXRef.Mean as TMEAN, ProbeSetXRef.LRS as TLRS,
  ProbeSetXRef.PVALUE as TPVALUE, ProbeSet.Chr_num as TCHR_NUM,
  ProbeSet.Mb as TMB, ProbeSet.Symbol as TSYMBOL,
  ProbeSet.name_num as TNAME_NUM
FROM ProbeSetXRef, ProbeSet
WHERE ProbeSet.Id = ProbeSetXRef.ProbeSetId
  and ProbeSetXRef.ProbeSetFreezeId = 112
  ORDER BY ProbeSet.symbol ASC limit 5;

| TNAME      | TMEAN            | TLRS               | TPVALUE               | TCHR_NUM | TMB        | TSYMBOL       | TNAME_NUM |
| 1445618_at | 7.05679797979798 |   13.5417452764616 |                  0.17 |        8 |  75.077895 | NULL          |   1445618 |
| 1452452_at |            7.232 |   30.4944361132252 | 0.0000609756097560421 |       12 |    12.6694 | NULL          |   1452452 |

** ProbeSetData

Probedata - main molecular data. Probesets, metabolome,

Almost all important molecular assay data is in this table including
probe set data, RNA-seq data, proteomic data, and metabolomic
data. 2.5 billion rows March 2016. In comparison, ProbeData contains
data only for Affymetrix probe level data (e.g. Exon array probes and
M430 probes).

select count(*) from ProbeSetData limit 5;
+---------------+
| count(*)      |
+---------------+
| 2,510,566,472 |
+---------------+


select * from ProbeSetData limit 5;
+----+----------+-------+
| Id | StrainId | value |
+----+----------+-------+
|  1 |        1 | 5.742 |
|  1 |        2 | 5.006 |
|  1 |        3 | 6.079 |
|  1 |        4 | 6.414 |
|  1 |        5 | 4.885 |
+----+----------+-------+

show indexes  from ProbeSetData;
+--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Table        | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
+--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| ProbeSetData |          0 | DataId   |            1 | Id          | A         |    34868978 |     NULL | NULL   |      | BTREE      |         |               |
| ProbeSetData |          0 | DataId   |            2 | StrainId    | A         |  2510566472 |     NULL | NULL   |      | BTREE      |         |               |
+--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+

select * from Strain limit 5;
+----+----------+----------+-----------+--------+-------+
| Id | Name     | Name2    | SpeciesId | Symbol | Alias |
+----+----------+----------+-----------+--------+-------+
|  1 | B6D2F1   | B6D2F1   |         1 | NULL   | NULL  |
|  2 | C57BL/6J | C57BL/6J |         1 | B6J    | NULL  |
|  3 | DBA/2J   | DBA/2J   |         1 | D2J    | NULL  |
|  4 | BXD1     | BXD1     |         1 | NULL   | NULL  |
|  5 | BXD2     | BXD2     |         1 | NULL   | NULL  |
+----+----------+----------+-----------+--------+-------+

show indexes from Strain;
+--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Table  | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
+--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Strain |          0 | PRIMARY  |            1 | Id          | A         |       14368 |     NULL | NULL   |      | BTREE      |         |               |
| Strain |          0 | Name     |            1 | Name        | A         |       14368 |     NULL | NULL   | YES  | BTREE      |         |               |
| Strain |          0 | Name     |            2 | SpeciesId   | A         |       14368 |     NULL | NULL   |      | BTREE      |         |               |
| Strain |          1 | Symbol   |            1 | Symbol      | A         |       14368 |     NULL | NULL   | YES  | BTREE      |         |               |
+--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+

A typical query may look like

SELECT Strain.Name, ProbeSetData.value, ProbeSetSE.error, ProbeSetData.Id
                    FROM (ProbeSetData, ProbeSetFreeze, Strain, ProbeSet, ProbeSetXRef)
                    left join ProbeSetSE on
                      (ProbeSetSE.DataId = ProbeSetData.Id AND ProbeSetSE.StrainId = ProbeSetData.StrainId)
                    WHERE
                      ProbeSetFreeze.name = 'B139_K_1206_M' AND
                      ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
                      ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND
                      ProbeSetXRef.DataId = ProbeSetData.Id AND
                      ProbeSetData.StrainId = Strain.Id
                    Order BY Strain.Name

+-------+-------+-------+----------+
| Name  | value | error | Id       |
+-------+-------+-------+----------+
| SM001 |  38.3 |  NULL | 25309550 |
| SM001 |   2.7 |  NULL | 25309520 |
| SM001 |  20.3 |  NULL | 25309507 |
| SM001 | 125.8 |  NULL | 25309511 |
| SM001 |   8.2 |  NULL | 25309534 |
+-------+-------+-------+----------+
5 rows in set (22.28 sec)

select * from ProbeSetFreeze limit 5;
+----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
| Id | ProbeFreezeId | AvgID | Name        | Name2                           | FullName                                    | ShortName               | CreateTime | OrderList | public | confidentiality | AuthorisedUsers | DataScale |
+----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
|  1 |             3 |     1 | Br_U_0803_M | BXDMicroArray_ProbeSet_August03 | UTHSC Brain mRNA U74Av2 (Aug03) MAS5        | Brain U74Av2 08/03 MAS5 | 2003-08-01 |      NULL |      0 |               0 | NULL            | log2      |
|  2 |            10 |     1 | Br_U_0603_M | BXDMicroArray_ProbeSet_June03   | UTHSC Brain mRNA U74Av2 (Jun03) MAS5        | Brain U74Av2 06/03 MAS5 | 2003-06-01 |      NULL |      0 |               0 | NULL            | log2      |
|  3 |             8 |     1 | Br_U_0303_M | BXDMicroArray_ProbeSet_March03  | UTHSC Brain mRNA U74Av2 (Mar03) MAS5        | Brain U74Av2 03/03 MAS5 | 2003-03-01 |      NULL |      0 |               0 | NULL            | log2      |
|  4 |             5 |     1 | Br_U_0503_M | BXDMicroArray_ProbeSet_May03    | UTHSC Brain mRNA U74Av2 (May03) MAS5        | Brain U74Av2 05/03 MAS5 | 2003-05-01 |      NULL |      0 |               0 | NULL            | log2      |
|  5 |             4 |     1 | HC_U_0303_M | GNFMicroArray_ProbeSet_March03  | GNF Hematopoietic Cells U74Av2 (Mar03) MAS5 | GNF U74Av2 03/03 MAS5   | 2003-03-01 |      NULL |      0 |               0 | NULL            | log2      |
+----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+

 select * from ProbeSetXRef limit 5;
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old  | LRS_old            | pValue_old | mean              | se                  | Locus           | LRS                | pValue | additive             | h2   |
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
|                1 |          1 |      1 | 10.095.400 |   13.3971627898894 |      0.163 |  5.48794285714286 | 0.08525787814808819 | rs13480619      | 12.590069931048001 |  0.269 |          -0.28515625 | NULL |
|                1 |          2 |      2 | D15Mit189  | 10.042057464356201 |      0.431 |  9.90165714285714 |  0.0374686634976217 | CEL-17_50896182 |   10.5970737900941 |  0.304 | -0.11678333333333299 | NULL |
|                1 |          3 |      3 | D5Mit139   |   5.43678531742749 |      0.993 |  7.83948571428571 |  0.0457583416912569 | rs13478499      |    6.0970532702754 |  0.988 |    0.112957489878542 | NULL |
|                1 |          4 |      4 | D1Mit511   |   9.87815279480766 |      0.483 | 8.315628571428569 |  0.0470396593931327 | rs6154379       | 11.774867551173099 |  0.286 |   -0.157113725490196 | NULL |
|                1 |          5 |      5 | D16H21S16  | 10.191723834264499 |      0.528 |  9.19345714285714 |  0.0354801718293322 | rs4199265       | 10.923263374016202 |  0.468 |  0.11476470588235299 | NULL |
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+


Note that the following unlimited search is very slow:

select max(value) from ProbeSetData;

+------------+
| max(value) |
+------------+
|   26436006 |
+------------+
1 row in set (2 min 16.31 sec)

which is in some form is used in the search page, see [[https://github.com/genenetwork/genenetwork2_diet/blob/master/wqflask/wqflask/do_search.py#L811][the search code]].


*** Improvements?

Suggestions on the schema page:

"StrainId" should be "CaseId" or "SampleId".

"ProbeSetData" should probably be "AssayData" or something more neutral.

*** Comments

I think the ProbeSetData table should be generalized to a 'phenotypes'
table with an 'sample_id' column and a 'value' column.

A new table 'samples' will link each sample against an 'experiment',
an 'individual' and which in turn can link to a 'strain'.

Experiment is here in a wide sense, GTex can be one - I don't want to
use dataset ;)

This means a (slight) reordering:

phenotypes:  (id), sample_id, value
samples:     experiment_id, individual_id
experiments: name, version
individual:  strain_id
strains:     species_id
species:     ...

ProbeData is also interesting, because it has the same structure as
ProbeSetData, but only contains microarrays. This tables should be one
(when we clear up the cross-referencing) as they both contain
phenotype values. Both are large tables.

PublishData is another phenotype table with values only which can be
merged into that same table.

So we have phenotype data in 3 tables with exactly the same
layout. There is also TissueProbeSet*, but we'll ignore those for
now. I think we should merge these into one and have the sample ref
refer to the type of data (probeset, probe, metabolomics,
whatever). These are all phenotype values and by having them split
into different tables they won't play well when looking for
correlations.

ProbeSet contains the metadata on the probes and should (eventually)
move into NoSQL. There is plenty redundancy in that table now.

I know it is going to be a pain to reorganize the database, but if we
want to use it in the long run we are going to have to simplify it.

** ProbeSetFreeze and ProbeFreeze (/dataset/name.json)

GN_SERVER: /dataset/HC_M2_0606_P.json

ProbesetFreeze contains DataSet information, such as name, fullname of
datasets, as well as whether they are public and how the data is
scaled:

select * from ProbeSetFreeze;
| Id  | ProbeFreezeId | AvgID | Name         | Name2                              | FullName                                      | ShortName                                     | CreateTime | OrderList | public | confidentiality | AuthorisedUsers | DataScale |
| 112 |            30 |     2 | HC_M2_0606_P | Hippocampus_M430_V2_BXD_PDNN_Jun06 | Hippocampus Consortium M430v2 (Jun06) PDNN    | Hippocampus M430v2 BXD 06/06 PDNN             | 2006-06-23 |      NULL |      2 |               0 | NULL            | log2      |

Another table contains a tissue reference and a back reference to the cross
type:

select * from ProbeFreeze;
| Id  | ProbeFreezeId | ChipId | TissueId | Name                                        | FullName | ShortName | CreateTime | InbredSetId |
|  30 |            30 |      4 |        9 | Hippocampus Consortium M430v2 Probe (Jun06) |          |           | 2006-07-07 |           1 |

NOTE: these tables can probably be merged into one.

show indexes from ProbeSetFreeze;
+----------------+------------+-----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Table          | Non_unique | Key_name  | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
+----------------+------------+-----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| ProbeSetFreeze |          0 | PRIMARY   |            1 | Id          | A         |           2 |     NULL | NULL   |      | BTREE      |         |               |
| ProbeSetFreeze |          0 | FullName  |            1 | FullName    | A         |           2 |     NULL | NULL   |      | BTREE      |         |               |
| ProbeSetFreeze |          0 | Name      |            1 | Name        | A         |           2 |     NULL | NULL   | YES  | BTREE      |         |               |
| ProbeSetFreeze |          1 | NameIndex |            1 | Name2       | A         |           2 |     NULL | NULL   |      | BTREE      |         |               |
+----------------+------------+-----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+

** ProbeSetSE

 select * from ProbeSetSE limit 5;
+--------+----------+----------+
| DataId | StrainId | error    |
+--------+----------+----------+
|      1 |        1 | 0.681091 |
|      1 |        2 | 0.361151 |
|      1 |        3 | 0.364342 |
|      1 |        4 | 0.827588 |
|      1 |        5 | 0.303492 |
+--------+----------+----------+

** Publication

Publication:

| Id   | PubMed_ID | Abstract    | Title   | Pages   | Month | Year |


** Publishdata (all pheno)

One of three phenotype tables.

mysql> select * from PublishData limit 5;
+---------+----------+-------+
| Id      | StrainId | value |
+---------+----------+-------+
| 8966353 |      349 |  29.6 |
| 8966353 |      350 |  27.8 |
| 8966353 |      351 |  26.6 |
| 8966353 |      352 |  28.5 |
| 8966353 |      353 |  24.6 |
+---------+----------+-------+
5 rows in set (0.25 sec)

See below for phenotype access.

** QuickSearch

No longer used

** role

empty

** Sample*

No longer used

** Species & Strain (should be sample)

select * from Species;
+----+-----------+----------------------+----------------+----------------------+-------------------------+------------+---------+
| Id | SpeciesId | SpeciesName          | Name           | MenuName             | FullName                | TaxonomyId | OrderId |
+----+-----------+----------------------+----------------+----------------------+-------------------------+------------+---------+
|  1 |         1 | Mouse                | mouse          | Mouse                | Mus musculus            |      10090 |      30 |
|  2 |         2 | Rat                  | rat            | Rat                  | Rattus norvegicus       |      10116 |      40 |
|  3 |         3 | Arabidopsis thaliana | arabidopsis    | Arabidopsis thaliana | Arabidopsis thaliana    |       3702 |      60 |
|  4 |         4 | Human                | human          | Human                | Homo sapiens            |       9606 |      10 |
|  5 |         5 | Barley               | barley         | Barley               | Hordeum vulgare         |       4513 |      70 |
|  6 |         6 | Drosophila           | drosophila     | Drosophila           | Drosophila melanogaster |       7227 |      50 |
|  7 |         7 | Macaque monkey       | macaque monkey | Macaque monkey       | Macaca mulatta          |       9544 |      20 |
|  8 |         8 | Soybean              | soybean        | Soybean              | Soybean                 |       3847 |      80 |
|  9 |         9 | Tomato               | tomato         | Tomato               | Tomato                  |       4081 |      90 |
+----+-----------+----------------------+----------------+----------------------+-------------------------+------------+---------+


** InbredSet

Menu

** TableComments

Metadata on DB

** Temp*

User upload data

** Tissue

Menu - 3rd level

** TissueP*

Correlation tables

** User collection

User selection - retained

** UserPrivilege

** Vlookup

* Fetching Data

** Search

What happens at the main search menu can be emulated with curl.

*** Search Mouse mRNA from HC_M2_0606_P dataset

: curl "http://localhost:5003/search?species=mouse&group=BXD&ppocampus+mRNA&dataset=HC_M2_0606_P&search_terms_or=&search_terms_and=MEAN%3D%2815+16%29+LRS%3D%2823+46%29+&FormID=searchResult"

the first SQL query checks whether a dataset is confidential or not ayd
fetches full name info

INFO:base.data_set:.sql: geno_mrna_confidentiality: u'SELECT Id, Name,
FullName, confidentiality,AuthorisedUsers FROM ProbeSetFreeze WHERE
Name = "HC_M2_0606_P"'

The following is executed once per search:

INFO:db.call:.sql: retrieve_other_names:
                        SELECT ProbeSetFreeze.Id, ProbeSetFreeze.Name, ProbeSetFreeze.FullName, ProbeSetFreeze.ShortName, ProbeSetFreeze.DataScale, Tissue.Name
                        FROM ProbeSetFreeze, ProbeFreeze, Tissue
                        WHERE ProbeSetFreeze.public > 0 AND
                              ProbeSetFreeze.ProbeFreezeId = ProbeFreeze.Id AND
                              ProbeFreeze.TissueId = Tissue.Id AND
                             (ProbeSetFreeze.Name = 'HC_M2_0606_P' OR ProbeSetFreeze.FullName = 'HC_M2_0606_P' OR ProbeSetFreeze.ShortName = 'HC_M2_0606_P')

INFO:db.call:.sql: (112, 'HC_M2_0606_P', 'Hippocampus Consortium M430v2 (Jun06) PDNN', 'Hippocampus M430v2 BXD 06/06 PDNN', 'log2', 'Hippocampus mRNA')

INFO:db.call:.sql: __init__:
                        SELECT
                                InbredSet.Name, InbredSet.Id
                        FROM
                                InbredSet, ProbeSetFreeze, ProbeFreeze
                        WHERE
                                ProbeFreeze.InbredSetId = InbredSet.Id AND
                                ProbeFreeze.Id = ProbeSetFreeze.ProbeFreezeId AND
                                ProbeSetFreeze.Name = "HC_M2_0606_P"

INFO:db.call:.sql: ('BXD', 1)

The actual search is

SELECT distinct ProbeSet.Name as TNAME, 0 as thistable,
  ProbeSetXRef.Mean as TMEAN, ProbeSetXRef.LRS as TLRS,
  ProbeSetXRef.PVALUE as TPVALUE, ProbeSet.Chr_num as TCHR_NUM,
  ProbeSet.Mb as TMB, ProbeSet.Symbol as TSYMBOL,
  ProbeSet.name_num as TNAME_NUM
FROM ProbeSetXRef, ProbeSet
WHERE ProbeSet.Id = ProbeSetXRef.ProbeSetId
  and ProbeSetXRef.ProbeSetFreezeId = 112
  ORDER BY ProbeSet.symbol ASC limit 5;

INFO:base.species:.sql: __init__:
                Select
                        Chr_Length.Name, Chr_Length.OrderId, Length from Chr_Length, InbredSet
                where
                        Chr_Length.SpeciesId = InbredSet.SpeciesId AND
                        InbredSet.Name = 'BXD'
                Order by OrderId

And the following are executed for every trait:

INFO:wqflask.do_search:.sql: execute: SELECT distinct ProbeSet.Name as TNAME, 0 as thistable, ProbeSetXRef.Mean as TMEAN, ProbeSetXRef.LRS as TLRS, ProbeSetXRef.PVALUE as TPVALUE, ProbeSet.Chr_num as TCHR_NUM, ProbeSet.Mb as TMB, ProbeSet.Symbol as TSYMBOL, ProbeSet.name_num as TNAME_NUM FROM ProbeSetXRef, ProbeSet WHERE (( ProbeSetXRef.mean > 15.0 and ProbeSetXRef.mean < 16.0 )AND( ProbeSetXRef.LRS > 23.0 and ProbeSetXRef.LRS < 46.0 )) and ProbeSet.Id = ProbeSetXRef.ProbeSetId and ProbeSetXRef.ProbeSetFreezeId = 112 ORDER BY ProbeSet.symbol ASC

INFO:base.trait:.sql: retrieve_info: SELECT ProbeSet.name,
                    ProbeSet.symbol, ProbeSet.description,
                    ProbeSet.probe_target_description, ProbeSet.chr,
                    ProbeSet.mb, ProbeSet.alias, ProbeSet.geneid,
                    ProbeSet.genbankid, ProbeSet.unigeneid,
                    ProbeSet.omim, ProbeSet.refseq_transcriptid,
                    ProbeSet.blatseq, ProbeSet.targetseq,
                    ProbeSet.chipid, ProbeSet.comments,
                    ProbeSet.strand_probe, ProbeSet.strand_gene,
                    ProbeSet.probe_set_target_region,
                    ProbeSet.probe_set_specificity,
                    ProbeSet.probe_set_blat_score,
                    ProbeSet.probe_set_blat_mb_start,
                    ProbeSet.probe_set_blat_mb_end,
                    ProbeSet.probe_set_strand,
                    ProbeSet.probe_set_note_by_rw, ProbeSet.flag

                    FROM ProbeSet, ProbeSetFreeze, ProbeSetXRef
                    WHERE
                            ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND
                            ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
                            ProbeSetFreeze.Name = 'HC_M2_0606_P' AND
                            ProbeSet.Name = '1443823_s_at'

INFO:base.trait:.sql: retrieve_info:
                            SELECT
                                    HomologeneId
                            FROM
                                    Homologene, Species, InbredSet
                            WHERE
                                    Homologene.GeneId =98660 AND
                                    InbredSet.Name = 'BXD' AND
                                    InbredSet.SpeciesId = Species.Id AND
                                    Species.TaxonomyId = Homologene.TaxonomyId

INFO:base.trait:.sql: retrieve_info:
                            SELECT
                                    ProbeSetXRef.Locus, ProbeSetXRef.LRS, ProbeSetXRef.pValue, ProbeSetXRef.mean, ProbeSetXRef.additive
                            FROM
                                    ProbeSetXRef, ProbeSet
                            WHERE
                                    ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
                                    ProbeSet.Name = "1443823_s_at" AND
                                    ProbeSetXRef.ProbeSetFreezeId =112

INFO:base.trait:.sql: retrieve_info:
                                select Geno.Chr, Geno.Mb from Geno, Species
                                where Species.Name = 'mouse' and
                                Geno.Name = 'NES13033186' and
                                Geno.SpeciesId = Species.Id


and finally mean and chromosome positions are fetched a second time
for every trait with

INFO:base.data_set:.sql: get_trait_info: select ProbeSetXRef.mean from ProbeSetXRef, ProbeSet
                where ProbeSetXRef.ProbeSetFreezeId = 112 and
                ProbeSet.Id = ProbeSetXRef.ProbeSetId and
                ProbeSet.Name = '1443823_s_at'

INFO:base.data_set:.sql: get_trait_info:
                    select Geno.Chr, Geno.Mb from Geno, Species
                    where Species.Name = 'mouse' and
                        Geno.Name = 'NES13033186' and
                        Geno.SpeciesId = Species.Id

(that is a bug!).

** Fetch phenotype information
*** Through the trait page

When hitting the trait page, e.g.

curl "http://localhost:5003/show_trait?trait_id=1443823_s_aet=HC_M2_0606_P"

First the BXD's are queried with

DEBUG:base.data_set:.get_samplelist: Sample list: : ['BXD1',
 'BXD2',
 'BXD5',
 ...

main probeset info (trait) is retrieved with

SELECT ProbeSet.name, ProbeSet.symbol, ProbeSet.description, ProbeSet.probe_target_description, ProbeSet.chr, ProbeSet.mb, ProbeSet.alias, ProbeSet.geneid, ProbeSet.genbankid, ProbeSet.unigeneid, ProbeSet.omim, ProbeSet.refseq_transcriptid, ProbeSet.blatseq, ProbeSet.targetseq, ProbeSet.chipid, ProbeSet.comments, ProbeSet.strand_probe, ProbeSet.strand_gene, ProbeSet.probe_set_target_region, ProbeSet.probe_set_specificity, ProbeSet.probe_set_blat_score, ProbeSet.probe_set_blat_mb_start, ProbeSet.probe_set_blat_mb_end, ProbeSet.probe_set_strand, ProbeSet.probe_set_note_by_rw, ProbeSet.flag
                    FROM ProbeSet, ProbeSetFreeze, ProbeSetXRef
                    WHERE
                            ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND
                            ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
                            ProbeSetFreeze.Name = 'HC_M2_0606_P' AND
                            ProbeSet.Name = '1443823_s_at'

Followed by

INFO:base.trait:.sql: retrieve_info:
   SELECT
                                    ProbeSetXRef.Locus, ProbeSetXRef.LRS, ProbeSetXRef.pValue, ProbeSetXRef.mean, ProbeSetXRef.additive
                            FROM
                                    ProbeSetXRef, ProbeSet
                            WHERE
                                    ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
                                    ProbeSet.Name = "1443823_s_at" AND
                                    ProbeSetXRef.ProbeSetFreezeId =112

| Locus       | LRS             | pValue                 | mean             | additive             |
| NES13033186 | 35.466324074542 | 0.00000900000000003676 | 15.0551313131313 | -0.16750405405405402 |

Then the interesting bit, the sample data is fetched with

INFO:base.data_set:.sql: retrieve_sample_data:
                   SELECT
                            Strain.Name, ProbeSetData.value, ProbeSetSE.error, ProbeSetData.Id, Strain.Name2
                    FROM
                            (ProbeSetData, ProbeSetFreeze, Strain, ProbeSet, ProbeSetXRef)
                    left join ProbeSetSE on
                            (ProbeSetSE.DataId = ProbeSetData.Id AND ProbeSetSE.StrainId = ProbeSetData.StrainId)
                    WHERE
                            ProbeSet.Name = '1443823_s_at' AND ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
                            ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND
                            ProbeSetFreeze.Name = 'HC_M2_0606_P' AND
                            ProbeSetXRef.DataId = ProbeSetData.Id AND
                            ProbeSetData.StrainId = Strain.Id
                    Order BY
                            Strain.Name

| Name        | value  | error | Id       | Name2       |
| 129S1/SvImJ | 14.552 |  NULL | 23422417 | 129S1/SvImJ |
| A/J         |  14.34 |  NULL | 23422417 | A/J         |
| AKR/J       | 14.338 |  NULL | 23422417 | AKR/J       |
| B6D2F1      | 15.251 |  NULL | 23422417 | B6D2F1      |
| BALB/cByJ   | 14.164 |  NULL | 23422417 | BALB/cByJ   |
| BALB/cJ     | 14.563 |  NULL | 23422417 | BALB/cJ     |
| BXD1        | 15.198 |  NULL | 23422417 | BXD1        |
| BXD11       | 15.084 |  NULL | 23422417 | BXD11       |
| BXD12       | 15.192 |  NULL | 23422417 | BXD12       |
 etc.

Then some repeated queries and this fetchest the nearest SNP

INFO:wqflask.show_trait.show_trait:.sql: get_nearest_marker:
 SELECT Geno.Name FROM Geno, GenoXRef, GenoFreeze WHERE Geno.Chr = '1'
 AND GenoXRef.GenoId = Geno.Id AND GenoFreeze.Id =
 GenoXRef.GenoFreezeId AND GenoFreeze.Name = 'BXDGeno' ORDER BY ABS(
 Geno.Mb - 173.149434) limit 1;

| Name        |
| NES13033186 |

*** Digging deeper

To get at phenotype data ProbeSetData is the main table (almost all
important molecular assay data is in this table including probe set
data, RNA-seq data, proteomic data, and metabolomic data. 2.5 billion
rows March 2016)

select count(*) from ProbeSetData limit 5;
+---------------+
| count(*)      |
+---------------+
| 2,510,566,472 |
+---------------+

select * from ProbeSetData limit 5;
+----+----------+-------+
| Id | StrainId | value |
+----+----------+-------+
|  1 |        1 | 5.742 |
|  1 |        2 | 5.006 |
|  1 |        3 | 6.079 |
|  1 |        4 | 6.414 |
|  1 |        5 | 4.885 |
+----+----------+-------+

This table is used in

: wqflask/base/do_search.py
: wqflask/base/data_set.py
: wqflask/utility/AJAX_table.py
: wqflask/wqflask/correlation/show_corr_results.py

In there we find 'ProbeSetData.Id = ProbeSetXRef.dataId'.

select * from ProbeSetXRef limit 5;
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old  | LRS_old            | pValue_old | mean              | se                  | Locus           | LRS                | pValue | additive             | h2   |
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
|                1 |          1 |      1 | 10.095.400 |   13.3971627898894 |      0.163 |  5.48794285714286 | 0.08525787814808819 | rs13480619      | 12.590069931048001 |  0.269 |          -0.28515625 | NULL |
|                1 |          2 |      2 | D15Mit189  | 10.042057464356201 |      0.431 |  9.90165714285714 |  0.0374686634976217 | CEL-17_50896182 |   10.5970737900941 |  0.304 | -0.11678333333333299 | NULL |
|                1 |          3 |      3 | D5Mit139   |   5.43678531742749 |      0.993 |  7.83948571428571 |  0.0457583416912569 | rs13478499      |    6.0970532702754 |  0.988 |    0.112957489878542 | NULL |
|                1 |          4 |      4 | D1Mit511   |   9.87815279480766 |      0.483 | 8.315628571428569 |  0.0470396593931327 | rs6154379       | 11.774867551173099 |  0.286 |   -0.157113725490196 | NULL |
|                1 |          5 |      5 | D16H21S16  | 10.191723834264499 |      0.528 |  9.19345714285714 |  0.0354801718293322 | rs4199265       | 10.923263374016202 |  0.468 |  0.11476470588235299 | NULL |
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+

i.e., for Strain Id 1 (DataId) 1, the locus '10.095.400' has a
phenotype value of 5.742.

Interestingly ProbeData and PublishData have the same layout as
ProbeSetData. ProbeData is only in use for Affy assays - and not used
for computations. PublishData contains trait values. ProbeSetData.id
matches ProbeSetXRef.DataId while PublishData.id matches
PublishXRef.DataId.

select * from PublishXRef limit 3;
+-------+-------------+-------------+---------------+---------+----------------+------------------+-----------+----------+-------------------------------------------------------+
| Id    | InbredSetId | PhenotypeId | PublicationId | DataId  | Locus          | LRS              | additive  | Sequence | comments                                              |
+-------+-------------+-------------+---------------+---------+----------------+------------------+-----------+----------+-------------------------------------------------------+
| 10001 |           8 |           1 |             1 | 8966353 | D2Mit5         |   10.18351644706 |  -1.20875 |        1 |                                                       |
| 10001 |           7 |           2 |            53 | 8966813 | D7Mit25UT      | 9.85534330983917 |  -2.86875 |        1 |                                                       |
| 10001 |           4 |           3 |            81 | 8966947 | CEL-6_57082524 | 11.7119505898121 | -23.28875 |        1 | elissa modified Abstract at Tue Jun  7 11:38:00 2005  |
+-------+-------------+-------------+---------------+---------+----------------+------------------+-----------+----------+-------------------------------------------------------+
3 rows in set (0.00 sec)

ties the trait data (PublishData) with the inbredsetid (matching
PublishFreeze.InbredSetId), locus and publication.

select * from PublishFreeze -> ;
+----+------------+--------------------------+-------------+------------+--------+-------------+-----------------+-----------------+
| Id | Name       | FullName                 | ShortName   | CreateTime | public | InbredSetId | confidentiality | AuthorisedUsers |
+----+------------+--------------------------+-------------+------------+--------+-------------+-----------------+-----------------+
|  1 | BXDPublish | BXD Published Phenotypes | BXDPublish  | 2004-07-17 |      2 |           1 |               0 | NULL            |
| 18 | HLCPublish | HLC Published Phenotypes | HLC Publish | 2012-02-20 |      2 |          34 |               0 | NULL            |
+----+------------+--------------------------+-------------+------------+--------+-------------+-----------------+-----------------+
2 rows in set (0.02 sec)

which gives us the datasets.

GeneNetwork1 has a limited REST interface, if you do

: curl "http://robot.genenetwork.org/webqtl/main.py?cmd=get&probeset=1443823_s_at&db=HC_M2_0606_P"

we get

: ProbeSetID      B6D2F1  C57BL/6J        DBA/2J  BXD1    BXD2    BXD5    BXD6   BXD8     BXD9    BXD11   BXD12   BXD13   BXD15   BXD16   BXD19   BXD20   BXD21  BXD22    BXD23   BXD24   BXD27   BXD28   BXD29   BXD31   BXD32   BXD33   BXD34  BXD38    BXD39   BXD40   BXD42   BXD67   BXD68   BXD43   BXD44   BXD45   BXD48  BXD50    BXD51   BXD55   BXD60   BXD61   BXD62   BXD63   BXD64   BXD65   BXD66  BXD69    BXD70   BXD73   BXD74   BXD75   BXD76   BXD77   BXD79   BXD73a  BXD83  BXD84    BXD85   BXD86   BXD87   BXD89   BXD90   BXD65b  BXD93   BXD94   A/J    AKR/J    C3H/HeJ C57BL/6ByJ      CXB1    CXB2    CXB3    CXB4    CXB5    CXB6   CXB7     CXB8    CXB9    CXB10   CXB11   CXB12   CXB13   BXD48a  129S1/SvImJ    BALB/cJ  BALB/cByJ       LG/J    NOD/ShiLtJ      PWD/PhJ BXD65a  BXD98   BXD99  CAST/EiJ KK/HlJ  WSB/EiJ NZO/HlLtJ       PWK/PhJ D2B6F1
: 1443823_s_at    15.251  15.626  14.716  15.198  14.918  15.057  15.232  14.968 14.87    15.084  15.192  14.924  15.343  15.226  15.364  15.36   14.792  14.908 15.344   14.948  15.08   15.021  15.176  15.14   14.796  15.443  14.636  14.921 15.22    15.62   14.816  15.39   15.428  14.982  15.05   15.13   14.722  14.636 15.242   15.527  14.825  14.416  15.125  15.362  15.226  15.176  15.328  14.895 15.141   15.634  14.922  14.764  15.122  15.448  15.398  15.089  14.765  15.234 15.302   14.774  14.979  15.212  15.29   15.012  15.041  15.448  14.34   14.338 14.809   15.046  14.816  15.232  14.933  15.255  15.21   14.766  14.8    15.506 15.749   15.274  15.599  15.673  14.651  14.692  14.552  14.563  14.164  14.546 15.044   14.695  15.162  14.772  14.645  15.493  14.75   14.786  15.003  15.148 15.221

(see https://github.com/genenetwork/gn_server/blob/master/doc/API.md
for the latest REST API).

getTraitData is defined in the file [[https://github.com/genenetwork/genenetwork/blob/master/web/webqtl/textUI/cmdClass.py#L134][web/webqtl/textUI/cmdClass.py]].
probe is None, so the code at line 199 is run

query = "SELECT Strain.Name, %sData.value from %sData, Strain, %s,
%sXRef WHERE %s.Name = '%s' and %sXRef.%sId = %s.Id and
%sXRef.%sFreezeId = %d and %sXRef.DataId = %sData.Id and
%sData.StrainId = Strain.Id order by Strain.Id" % (prefix, prefix,
prefix, prefix, prefix, probeset,prefix, prefix, prefix, prefix,
prefix, dbId, prefix, prefix, prefix)

where prefix is ProbeSet (one presumes). So, let's see if we can do this by hand

SELECT Strain.Name, ProbeSetData.value from ProbeSetData, Strain, ProbeSet,
ProbeSetXRef WHERE ProbeSet.Name = '1443823_s_at' and ProbeSetXRef.ProbeSetId = ProbeSet.Id and
ProbeSetXRef.ProbeSetFreezeId = $dbid and ProbeSetXRef.DataId = ProbeSetData.Id and
ProbeSetData.StrainId = Strain.Id ORDER BY Strain.Id

The $dbid is listed in the ProbeSetFreeze table,

SELECT ProbeFreezeId,Name FROM ProbeSetFreeze WHERE Name='HC_M2_0606_P' limit 5;

+---------------+--------------+
| ProbeFreezeId | Name         |
+---------------+--------------+
|            30 | HC_M2_0606_P |
+---------------+--------------+

select id,name from ProbeSet WHERE Name = '1443823_s_at' limit 5;
+--------+--------------+
| id     | name         |
+--------+--------------+
| 106556 | 1443823_s_at |
+--------+--------------+

So

query = "SELECT Strain.Name, %sData.value from %sData, Strain, %s,
%sXRef WHERE %s.Name = '%s' and %sXRef.%sId = %s.Id and
%sXRef.%sFreezeId = %d and %sXRef.DataId = %sData.Id and
%sData.StrainId = Strain.Id order by Strain.Id" % (prefix, prefix,
prefix, prefix, prefix, probeset,prefix, prefix, prefix, prefix,
prefix, dbId, prefix, prefix, prefix)

CORRECT NAME:

SELECT Strain.Name, ProbeSetData.value from ProbeSetData, Strain,
ProbeSet, ProbeSetXRef WHERE ProbeSet.Name = 'at_probe' and
ProbeSetXRef.ProbeSetId = ProbeSet.Id and
ProbeSetXRef.ProbeSetFreezeId = dbid and ProbeSetXRef.DataId =
ProbeSetData.Id and ProbeSetData.StrainId = Strain.Id order by
Strain.Id


select * from ProbeSetXRef WHERE probesetfreezeid=30 limit 5;
+------------------+------------+--------+------------+--------------------+------------+--------------------+--------------------+-----------------+--------------------+--------+-------------------+------+
| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old  | LRS_old            | pValue_old | mean               | se                 | Locus           | LRS                | pValue | additive          | h2   |
+------------------+------------+--------+------------+--------------------+------------+--------------------+--------------------+-----------------+--------------------+--------+-------------------+------+
|               30 |          1 | 445962 | 01.059.350 | 7.1753152078069595 |      0.961 |            30.0646 |   1.79763935596594 | rs13475891      | 7.1753152078069204 |  0.973 |        4.71778125 | NULL |
|               30 |          2 | 445963 | D4Mit156   |   7.58944292943285 |      0.724 | 232.38328571428602 |   9.00278909374791 | CEL-4_118751423 |   7.57513435426218 |  0.793 |  25.2660951417004 | NULL |
|               30 |          3 | 445964 | D1Mit134   |  9.766065497826819 |      0.737 |             47.206 |   1.58413526287766 | mCV23431007     |   9.76606549782677 |  0.797 | -4.82405952380952 | NULL |
|               30 |          4 | 445965 | D1Mit155   |   18.0045829157241 |      0.033 | 132.29248571428602 |   4.37799472291842 | rs3689947       |   17.9365068406286 |  0.049 |  -16.945619047619 | NULL |
|               30 |          5 | 445966 | D5Mit197   |   9.51068902627823 |      0.476 |   271.309971428571 | 7.4294268316065395 | rs6239372       |   10.4214974316601 |   0.41 | -25.6148045454546 | NULL |
+------------------+------------+--------+------------+--------------------+------------+--------------------+--------------------+-----------------+--------------------+--------+-------------------+------+

So, apparently ProbeSetFreezeID points to the database identifier in
ProbeSetFreeze which has the name of the 'DB'. OK, that kinda makes
sense now. Meanwhile Probeset.name points to the phenotype name.

ProbeSetXRef binds these tables together. Finally there is the data in

select * from ProbeSetData limit 5;
+----+----------+-------+
| Id | StrainId | value |
+----+----------+-------+
|  1 |        1 | 5.742 |
|  1 |        2 | 5.006 |
|  1 |        3 | 6.079 |
|  1 |        4 | 6.414 |
|  1 |        5 | 4.885 |
+----+----------+-------+
5 rows in set (0.00 sec)

linked by ProbeSetXRef.dataid.

*** For PublishData:

List datasets for BXD (InbredSetId=1):

select * from PublishXRef where InbredSetId=1 limit 3;
+-------+-------------+-------------+---------------+---------+-----------+------------------+------------------+----------+--------------------------------------------------------------------------------+
| Id    | InbredSetId | PhenotypeId | PublicationId | DataId  | Locus     | LRS              | additive         | Sequence | comments                                                                       |
+-------+-------------+-------------+---------------+---------+-----------+------------------+------------------+----------+--------------------------------------------------------------------------------+
| 10001 |           1 |           4 |           116 | 8967043 | rs8253516 | 13.4974914158039 | 2.39444444444444 |        1 | robwilliams modified post_publication_description at Mon Jul 30 14:58:10 2012
 |
| 10002 |           1 |          10 |           116 | 8967044 | rs3666069 | 22.0042692151629 | 2.08178571428572 |        1 | robwilliams modified phenotype at Thu Oct 28 21:43:28 2010
                    |
| 10003 |           1 |          15 |           116 | 8967045 | D18Mit4   | 15.5929163293343 | 19.0882352941176 |        1 | robwilliams modified phenotype at Mon May 23 20:52:19 2011
                    |
+-------+-------------+-------------+---------------+---------+-----------+------------------+------------------+----------+--------------------------------------------------------------------------------+

where ID is the 'record' or, effectively, dataset.

select distinct(publicationid) from PublishXRef where InbredSetId=1 limit 3;
+---------------+
| publicationid |
+---------------+
|           116 |
|           117 |
|           118 |
+---------------+

select distinct PublishXRef.id,publicationid,phenotypeid,Phenotype.post_publication_description from PublishXRef,Phenotype where InbredSetId=1 and phenotypeid=Phenotype.id limit 3;
+-------+---------------+-------------+----------------------------------------------------------------------------------------------------------------------------+
| id    | publicationid | phenotypeid | post_publication_description                                                                                               |
+-------+---------------+-------------+----------------------------------------------------------------------------------------------------------------------------+
| 10001 |           116 |           4 | Central nervous system, morphology: Cerebellum weight [mg]                                                                 |
| 10002 |           116 |          10 | Central nervous system, morphology: Cerebellum weight after adjustment for covariance with brain size [mg]                 |
| 10003 |           116 |          15 | Central nervous system, morphology: Brain weight, male and female adult average, unadjusted for body weight, age, sex [mg] |
+-------+---------------+-------------+----------------------------------------------------------------------------------------------------------------------------+

The id field is the same that is used in the GN2 web interface and the
PublicationID ties the datasets together.

To list trait values:

SELECT Strain.Name, PublishData.id, PublishData.value from
(Strain,PublishData, PublishXRef) Where PublishData.StrainId =
Strain.id limit 3;

+------+---------+-------+
| Name | id      | value |
+------+---------+-------+
| CXB1 | 8966353 |  29.6 |
| CXB1 | 8966353 |  29.6 |
| CXB1 | 8966353 |  29.6 |
+------+---------+-------+

here id should match dataid again:

SELECT Strain.Name, PublishData.id, PublishData.value from
(Strain,PublishData, PublishXRef) Where PublishData.StrainId =
Strain.id and PublishXRef.dataid=8967043 and
PublishXRef.dataid=PublishData.id limit 3;
+------+---------+-------+
| Name | id      | value |
+------+---------+-------+
| BXD1 | 8967043 |  61.4 |
| BXD2 | 8967043 |    49 |
| BXD5 | 8967043 |  62.5 |
+------+---------+-------+

*** Datasets

The REST API aims to present a unified interface for genotype and
phenotype data. Phenotype datasets appear in two major forms in the
database and we want to present them as one resource.

Dataset names are defined in ProbeSetFreeze.name and Published.id ->
publication (we'll ignore the probe dataset that uses
ProbeFreeze.name). These tables should be meshed. It looks like the
ids are non-overlapping with the publish record IDs starting at 10,001
(someone has been smart, though it sets the limit of probesets now to
10,000).

The datasets are organized differently in these tables. All published
BXD data is grouped on BXDpublished with the publications as
'datasets'. So, that is how we list them in the REST API.

To fetch all the datasets we first list ProbeSetFreeze entries. Then
we list the Published entries.

** Fetch genotype information

*** SNPs

The SNP count info for the BXD is calculated like this

#+begin_src python
        while startMb<endMb:
            snp_count = g.db.execute("""
                    select
                            count(*) from BXDSnpPosition
                    where
                            Chr = '%s' AND Mb >= %2.6f AND Mb < %2.6f AND
                            StrainId1 = %d AND StrainId2 = %d
                    """ % (chrName, startMb, startMb+stepMb, strainId1, strainId2)).fetchone()[0]
            SNPCounts.append(snp_count)
            startMb += stepMb
#+end_src

select * from BXDSnpPosition limit 5;
+------+-----------+-----------+----------+
| Chr  | StrainId1 | StrainId2 | Mb       |
+------+-----------+-----------+----------+
| 1    |         2 |         3 | 0.002477 |
| 1    |         2 |         3 | 0.002592 |
| 1    |         2 |         3 |  0.00283 |
| 1    |         2 |         3 | 0.002994 |
| 1    |         2 |         3 | 0.003299 |
+------+-----------+-----------+----------+

Other SNP tables containing

select * from SnpSource limit 5;
Empty set (0.00 sec)

select * from SnpAll limit 5;
Empty set (0.00 sec)

mysql> select * from SnpAll limit 5;
Empty set (0.00 sec)

mysql> select * from SnpPattern limit 5;
Empty set (0.00 sec)

mysql> select * from SnpSource limit 5;
Empty set (0.00 sec)

Hmmm. This is the test database. Then there are the plink files and VCF files.