diff options
Diffstat (limited to 'doc')
| -rw-r--r-- | doc/GUIX-Reproducible-from-source.org | 21 | ||||
| -rw-r--r-- | doc/GUIX-archive.org | 106 | ||||
| -rw-r--r-- | doc/README.org | 678 | ||||
| -rw-r--r-- | doc/database.org | 710 | ||||
| -rw-r--r-- | doc/new_variable_names.txt | 6 | ||||
| -rw-r--r-- | doc/notes_DA.txt | 10 | ||||
| -rw-r--r-- | doc/old/gn_installation_notes.txt (renamed from doc/gn_installation_notes.txt) | 4 | ||||
| -rw-r--r-- | doc/old/notes.txt (renamed from doc/notes.txt) | 0 | ||||
| -rw-r--r-- | doc/requirements.txt | 36 | ||||
| -rw-r--r-- | doc/todo.txt | 2 |
10 files changed, 1502 insertions, 71 deletions
diff --git a/doc/GUIX-Reproducible-from-source.org b/doc/GUIX-Reproducible-from-source.org index b88eb9e8..4399ea26 100644 --- a/doc/GUIX-Reproducible-from-source.org +++ b/doc/GUIX-Reproducible-from-source.org @@ -4,6 +4,7 @@ - [[#introduction][Introduction]] - [[#binary-deployment][Binary deployment]] - [[#from-source-deployment][From source deployment]] + - [[#create-archive][Create archive]] * Introduction @@ -31,5 +32,23 @@ Next build guix (and run) following the instructions in [[https://github.com/pjo Once that is done we can add the guix-bioinformatics path with -: env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -A slurm +: env GUIX_PACKAGE_PATH=../guix-bioinformatics command +So + +#+begin_src sh :lang bash +#+begin_src sh :lang bash +gn-stable-guix$ env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -A genenetwork +genenetwork1 1.0-d622c803b out ../guix-bioinformatics/gn/packages/bioinformatics.scm:163:2 +genenetwork2 2.0-9e9475053 out ../guix-bioinformatics/gn/packages/bioinformatics.scm:215:2 +#+end_src sh :lang bash + +Install with + +#+begin_src sh :lang bash +gn-stable-guix$ env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -i genenetwork2 +#+end_src sh :lang bash + +* Create archive + +: env GUIX_PACKAGE_PATH=../../genenetwork/guix-bioinformatics/ ./pre-inst-env guix archive --export -r genenetwork2 > guix_gn2-2.0-9e9475053.nar diff --git a/doc/GUIX-archive.org b/doc/GUIX-archive.org new file mode 100644 index 00000000..67ab5cd0 --- /dev/null +++ b/doc/GUIX-archive.org @@ -0,0 +1,106 @@ +* Binary deployment + +Note binary deployment is not working pending a few improvements +to GNU Guix. See source deployment instead. + +** Install Guix using a tar ball + +GN can be deployed either as a binary tarball or as a GNU Guix +package. First install GNU Guix following the instructions of the +[[https://www.gnu.org/software/guix/manual/html_node/Binary-Installation.html#Binary-Installation][binary installation]] using a tar ball from [[https://www.gnu.org/software/guix/download/][here]]. + +With guix-daemon running you should be able to install the hello +package: + +: guix package -i hello + +** Fix locale + +You may want to + +#+begin_src sh :lang bash +export GUIX_LOCPATH=$HOME/.guix-profile/lib/locale +export LC_ALL=en_US.utf8 +#+end_src sh :lang bash + +** Authorize our archives + +Next add our archive key to guix (as root): + +#+begin_src scheme +echo "(public-key + (ecc + (curve Ed25519) + (q #E9A95686D8437186302E07C7AB9BF3913F435026C2D389AF27D9C66FD6EBB649#) + ) + ) +"|guix archive --authorize +#+end_src scheme + +if you have trouble finding a suitable guix try + +: ls /gnu/store/*guix-*/bin/guix + +and you should be able to use this directly, e.g. + +: alias guix=/gnu/store/632msbms2yaldfnlrb5lbnlnmn9yjisw-guix-0.9.0/bin/guix +: guix --version + +** Download and install the GN2 archive + +Find the archive on + + http://files.genenetwork.org/software/ + +download and install with + +#+begin_src bash +guix archive --import < genenetwork2-data-hash.nar +#+end_src bash + +and you should see a list of packages installing, e.g. + +#+begin_src bash +importing path `/gnu/store/l1zs2drn3zdzl5ysjcmhibcpa35p9zfc-python2-mysqlclient-1.3.7' +importing path `/gnu/store/n7kfg4knibvblggy8ci2liscl7vz5wkg-python2-parallel-1.6.4' +importing path `/gnu/store/qvv16qwlq59gp5d07lwbf5n8ndsi3il3-python2-sqlalchemy-1.0.11' +importing path `/gnu/store/qw872mbmr9ir0a9drv9xw9pvjk05ywwy-python2-xlsxwriter-0.8.4' +importing path `/gnu/store/wc112m1xfy3p08v14bdzay2ki2rirdsm-pylmm-gn2-1.0-3c6d1cac8' +importing path `/gnu/store/zfkcy17c2ks3cd9ks14irdabqvmlfpyn-python2-flask-sqlalchemy-2.1' +importing path `/gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff4' +(etc.) +#+end_src bash + +The following packages need to be added and the R path set + +: export R_LIBS_SITE="/home/wrk/.guix-profile/site-library/" +: guix package -i /gnu/store/w0dqg9dshq53j8xhcnqgvnvms2s6y5k5-r-wgcna-1.49-425bc170cc0873ddbd414675ac40f6d4d724c7cb +: guix package -i /gnu/store/k60bdlm0v7xic88j2z5c1jb1jvc371mn-r-qtl-1.38-4 + +You can add the last one to your profile + +: guix package -i /gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff +: export PATH=~/.guix-profile/bin:$PATH +: genenetwork2 + + or run it directly with + +: /gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff/bin/genenetwork2 + + + +** Other + +Update guix with a 'guix pull' and make guix visible in the path. +More information exists also in my [[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org][guix-notes]]. + +With guix running you should be able to install python, for example. + +: guix package -i python2 + +This will make python appear in $HOME/.guix-profile/bin/python. Suggested +environment settings can be seen with + +: guix package --search-paths + + diff --git a/doc/README.org b/doc/README.org index f6ab6a52..345341e1 100644 --- a/doc/README.org +++ b/doc/README.org @@ -1,28 +1,678 @@ -#+TITLE: Installing GeneNetwork services with GNU Guix + +#+TITLE: Installing GeneNetwork services * Table of Contents :TOC: - [[#introduction][Introduction]] - - [[#binary-deployment][Binary deployment]] - - [[#from-source-deployment][From source deployment]] + - [[#source-deployment][Source deployment]] + - [[#install-guix][Install guix]] + - [[#checkout-the-git-repositories][Checkout the git repositories]] + - [[#update-guix][Update guix]] + - [[#install-gn2][Install GN2]] + - [[#run-gn2][Run GN2]] + - [[#run-mysql-server][Run MySQL server]] + - [[#run-your-own-copy-of-gn2][Run your own copy of GN2]] + - [[#set-up-nginx-port-forwarding][Set up nginx port forwarding]] + - [[#source-deployment-and-other-information-on-reproducibility][Source deployment and other information on reproducibility]] + - [[#trouble-shooting][Trouble shooting]] + - [[#importerror-no-module-named-jinja2][ImportError: No module named jinja2]] + - [[#error-can-not-find-directory-homegn2_data][ERROR: can not find directory $HOME/gn2_data]] + - [[#cant-run-a-module][Can't run a module]] * Introduction -Large system deployments tend to get very complex. In this document we -explain the GeneNetwork deployment system which is based on GNU Guix -(see Pjotr's [[https://github.com/pjotrp/guix-notes/blob/master/README.md][Guix-notes]]). +Large system deployments can get very complex. In this document we +explain the GeneNetwork version 2 (GN2) reproducible deployment system +which is based on GNU Guix (see also Pjotr's [[https://github.com/pjotrp/guix-notes/blob/master/README.md][Guix-notes]]). The Guix +system can be used to install GN with all its files and dependencies. + +The official installation path is from a checked out version of the +main Guix package tree and that of the Genenetwork package +tree. Current supported versions can be found as the SHA values of +'gn-latest' branches of [[https://github.com/genenetwork/guix-bioinformatics/tree/gn-latest][Guix bioinformatics]] and [[https://github.com/genenetwork/guix/tree/gn-latest][GNU Guix main]]. + +* Source deployment +** Install guix -* Binary deployment +Deploying from source is also straightforward. Install GNU Guix using +a binary tar ball as described [[https://github.com/pjotrp/guix-notes][here]]. -NYA +If it works you should be able to install a package with -* From source deployment +: guix package -i hello -GNU Guix allows for [[https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org][reproducible deployment]] based on a checked out -Guix repository - use gn-stable for that: +** Checkout the git repositories -#+begin_src sh :lang bash +Check out the two relevant guix and guix-bioinformatics git +repositories: + +#+begin_src bash +cd ~ mkdir genenetwork cd genenetwork -git checkout https://github.com/genenetwork/guix.git gn-stable-guix -git checkout https://github.com/genenetwork/guix-bioinformatics.git +git clone --branch gn-latest https://github.com/genenetwork/guix-bioinformatics +git clone --branch gn-latest --recursive https://github.com/genenetwork/guix guix-gn-latest +cd guix-gn-latest +#+end_src bash + +** Update guix + +At some point you may decide to create, install and run a recent +version of the guix-daemon by compiling the guix repository. Follow +[[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org#building-gnu-guix-from-source-using-guix][these]] steps carefully. + +** Install GN2 + +#+begin_src bash +env GUIX_PACKAGE_PATH=../guix-bioinformatics/ ./pre-inst-env \ + guix package -i genenetwork2 --fallback +#+end_src bash + +Note that you can use the genenetwork.org guix substitute caching +server at http://guix.genenetwork.org:8080 (which speeds up installs +significantly because all packages are pre-built). Here an IRC session +where we installed GN2 from scratch using GNU Guix and a download +of the test database: + +#+begin_src +<pjotrp> time to get binary install sorted :) [07:03] +<pjotrp> Guix is designed for distributed installation servers +<pjotrp> we have one on guix.genenetwork.org +<pjotrp> it contains all the prebuild packages +<pjotrp> for GN +<user01> okay [07:04] +<pjotrp> let's step back however [07:05] +<pjotrp> I presume the environment is set with all guix package --search-paths +<pjotrp> right? +<user01> yep +<user01> set to the ones in ~/.guix-profile/ +<pjotrp> good, and you are in gn-latest-guix repo [07:06] +<user01> yep [07:07] +<pjotrp> git log shows + +Author: David Thompson <dthompson2@worcester.edu> +Date: Sun Mar 27 21:20:19 2016 -0400 + +<user01> yes +<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix + package -A genenetwork2 [07:08] +<pjotrp> shows + +genenetwork2 2.0-a8fcff4 out ../guix-bioinformatics/gn/packages/genenetwork.scm:144:2 +genenetwork2-database-small 1.0 out ../guix-bioinformatics/gn/packages/genenetwork.scm:270:4 +genenetwork2-files-small 1.0 out ../guix-bioinformatics/gn/packages/genenetwork.scm:228:4 + +<user01> yeah [07:09] +<pjotrp> OK, we are in sync. This means we should be able to install the exact + same software +<pjotrp> I need to start up my guix daemon - I usually run it in a screen +<pjotrp> screen -S guix-daemon +<user01> hah, I don't have screen installed yet [07:11] +<pjotrp> comes with guix ;) [07:12] +<pjotrp> no worries, you can run it any way you want +<pjotrp> $HOME/.guix-profile/bin/guix-daemon --build-users-group=guixbuild +<user01> then something's weird, because it says I don't have it +<pjotrp> oh, you need to install it first [07:13] +<pjotrp> guix package -A screen +<pjotrp> screen 4.3.1 out gnu/packages/screen.scm:34:2 +<pjotrp> but you can skip this install, for now +<user01> alright [07:14] +<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix + package -i genenetwork2 --dry-run +<pjotrp> substitute: updating list of substitutes from + 'https://mirror.hydra.gnu.org'... 79.1% +<pjotrp> you see that? +<pjotrp> followed by [07:15] +substitute: updating list of substitutes from +'https://hydra.gnu.org'... 100.0% +The following derivations would be built: + /gnu/store/rk7nw0rjqqsha958m649wrykadx6mmhl-profile.drv + +/gnu/store/7b0qjybvfx8syzvfs7p5rdablwhbkbvs-module-import-compiled.drv + /gnu/store/cy9zahbbf23d3cqyy404lk9f50z192kp-module-import.drv + /gnu/store/ibdn603i8grf0jziy5gjsly34wx82lmk-gtk-icon-themes.drv + +<pjotrp> which should have the same HASH values /gnu/store/7b0qjybvf... etc. + [07:16] +<user01> profile has a different hash +<pjotrp> but the next ones? +<user01> they're the same +<pjotrp> not sure why profile differs. Do you see the contact with + mirror.hydra.org? [07:17] +<user01> yeah +<pjotrp> OK, that means you set the key correctly for that one :) +<pjotrp> alright we are at the same state now. You can see most packages need + to be rebuild because they are no longer cached as binaries on hydra + [07:18] +<pjotrp> things move fast... +<user01> hehe +<pjotrp> let me also do the same on my laptop - which I have staged before + [07:19] +<pjotrp> btw, to set the path I often do [07:20] +<pjotrp> export + PATH="/home/wrk/.guix-profile/bin:/home/wrk/.guix-profile/sbin":$PATH +<pjotrp> to keep things like 'screen' from Debian +<pjotrp> Once past building guix itself that is normally OK [07:21] +<user01> ah, okay +<user01> will do that +<pjotrp> the guix build requires certain versions of tools, so you don't want + to mix foreign tools in [07:23] +<user01> makes sense [07:24] +<pjotrp> On my laptop I am trying the main updating list of substitutes from + 'http://hydra.gnu.org'... 10.5% [07:27] +<pjotrp> it is a bit slow, but let's see if there is a difference with the + mirror +<pjotrp> you can see there are two servers here. Actually with recent daemons, + if the mirror fails it will try the main server [07:28] +<pjotrp> I documented the use of a caching server here [07:29] +<pjotrp> https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org +<pjotrp> this is exactly what we are doing now +<user01> alrighty [07:35] +<pjotrp> To see if a remote server has a guix server running it should respond + [07:36] +<pjotrp> lynx http://guix.genenetwork.org:8080 --dump +<pjotrp> Resource not found: / +<pjotrp> +<pjotrp> you see that? +<user01> yes [07:37] +<pjotrp> good. The main hydra server is too slow. So on my laptop I forced + using the mirror with [07:38] +<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics/ ./pre-inst-env guix + package -i genenetwork2 --dry-run + --substitute-urls="http://mirror.hydra.gnu.org" +<pjotrp> +<pjotrp> the list looks the same to me [07:40] +<user01> me too +<pjotrp> note that some packages will be built and some downloaded, right? + [07:41] +<user01> yes +<pjotrp> atlas is actually a binary on my system [07:43] +<pjotrp> I mean in that list +<pjotrp> so, it should not build. Same as yours? +<user01> yeah, atlas and r-gtable are the ones to be downloaded +<pjotrp> You should not have seen that error ;) +<pjotrp> we should try and install it this way, try [07:44] +<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix + package -i genenetwork2 --cores=4 --max-jobs=4 --keep-going [07:46] +<pjotrp> set CPUs and max-jobs to something sensible +<pjotrp> Does your VM have multiple cores? +<pjotrp> note you can always press Ctrl-C during install +<user01> it doesn't, I'll reboot it and give it another core [07:47] +<user02> Hey [07:48] +<user02> I'm here +<user02> Will be stepping away for some breakfast +<pjotrp> Can you do the same as us +<pjotrp> Can you see the irc log +<user02> Alright +<user02> Yes, I can +<user02> Please email me a copy in five minutes +<pjotrp> user01: so when I use the GN server [07:56] +<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix + package -i genenetwork2 --dry-run + --substitute-urls=http://guix.genenetwork.org:8080 +<pjotrp> I don't need to build anything [07:57] +<pjotrp> (this won't work for you, yet) +<pjotrp> to get it to work you need to 'trust' it [07:58] +<pjotrp> but, first get the build going +<pjotrp> I'll have a coffee while you and get building +<user01> yeah it's doing its thing now [08:01] +<pjotrp> cool [08:02] +<pjotrp> in a separate terminal you can try and install with the gn mirror + [08:05] +<pjotrp> I'll send you the public key and you can paste it as said + https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org + [08:06] +<user01> alright +<pjotrp> should be in the E-mail [08:09] +<pjotrp> getting it working it kinda nasty since the server gives no feedback +<pjotrp> it works when you see no more in the build list ;) [08:11] +<pjotrp> btw, you can install software in parallel. Guix does that. +<pjotrp> even the same packages +<pjotrp> so keep building ;) +<pjotrp> try and do this with Debian... +<pjotrp> coffee for me [08:12] +<user01> the first build failed [08:15] +<pjotrp> OK, Dennis fixed that one yesterday [08:27] +<pjotrp> the problem is that sometime source tarballs disappear [08:28] +<pjotrp> R is notorious for that +<user01> haha, that's inconvenient.. +<pjotrp> well, it is good that Guix catches them +<pjotrp> but we do not cache sources +<pjotrp> binaries are cached - to some degree - so we don't have to rebuild + those [08:29] +<pjotrp> time to use the guix cache at guix.genenetwork.org +<pjotrp> try and install the key (it is in the E-mail) +<pjotrp> and see what this lists [08:31] +<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix + package -i genenetwork2 + --substitute-urls=http://guix.genenetwork.org:8080 --dry-run +<pjotrp> should be all binary installs +<user01> it's not.. [08:32] +<user01> if I remove --substitute-urls, the list changes, does that mean I + have the key set up correctly at least? [08:33] +<pjotrp> dunno [08:35] +<pjotrp> how many packages does it want to build? +<pjotrp> should be zero +<user01> four +<pjotrp> Ah, that is OK - those are default profile things +<user01> genenetwork2 is among the ones to be downloaded so [08:36] +<pjotrp> remove --dry-run +<pjotrp> yeah, good sign :) +<pjotrp> we'll still hit a snag, but run it +<pjotrp> should be fast +<user01> doing it [08:37] +<user01> it worked! [08:38] +<user01> I think [08:39] +<pjotrp> heh [08:40] +<pjotrp> you mean it is finished? +<user01> yep +<pjotrp> type genenetwork2 +<user01> complains about not being able to connect to the database [08:41] +<pjotrp> last snag :) +<pjotrp> no database +<pjotrp> well, we succeeded in installing a same-byte install of a very + complex system :) [08:42] +<pjotrp> (always take time to congratulate yourself) +<pjotrp> now we need to install mysql +<user01> hehe :) +<pjotrp> this can be done throug guix or through debian [08:43] +<pjotrp> the latter is a bit easier here, so let's do that +<pjotrp> fun note: you can mix debian and guix +<pjotrp> Follow instructions on [08:44] +<pjotrp> + https://github.com/genenetwork/genenetwork2/tree/staging/doc#run-mysql-server +<pjotrp> apt-get install mysql-common [08:45] +<pjotrp> may do it +<pjotrp> You can also install with guix, but I need to document that +<pjotrp> btw your internet must be fast :) [08:46] +<user01> hehe it is ;) +<pjotrp> when the database is installed [08:48] +<pjotrp> be sure to set the password as instructed [08:50] +<pjotrp> when mysql is set the genenetwork2 command should fire up the web + server on localhost:5003 [08:58] +<pjotrp> btw my internet is way slower :) [09:00] +<user02> I'm back [09:04] +<user02> fixed router firmware upgrade problem +<user02> unbricking +<pjotrp> tssk [09:07] +<user02> I'll never leave routers to update themselves again [09:08] +<user02> self-brick highway +<user02> Resuming [09:09] +<pjotrp> auto-updates are evil +<pjotrp> always switch them off +<pjotrp> user02: can you install genenetwork like user has done? [09:10] +<pjotrp> pretty well documented here now :) +<user02> Yes I can [09:11] +<user02> Already installed key +<pjotrp> user02: you are getting binary packages only now? [09:13] +<user02> That's the sanest way to go now +<user02> seriously +<pjotrp> everything should be pre-built from guix.genenetwork.org +<pjotrp> you are downloading? +<user02> yes [09:15] +<pjotrp> cool. Maybe an idea to set up a server +<pjotrp> for your own use +<user02> Stuck at downloading preprocesscore +<pjotrp> should not [09:24] +<pjotrp> what does env GUIX_PACKAGE_PATH=../guix-bioinformatics/ + ./pre-inst-env guix package -i genenetwork2 + --substitute-urls="http://guix.genenetwork.org:8080" --dry-run + [09:25] +<pjotrp> say for r-prepocesscore +<pjotrp> download or build? +<pjotrp> mine says download [09:26] +<user02> it only lists the derivatives to be built +<user02> nothing else happens [09:27] +<pjotrp> OK, so there is a problem +<pjotrp> your key may not be working +<pjotrp> everything should be listed as 'to be download' [09:28] +<user02> Hmm +<user02> Ah +<user02> I know where I messed up +<pjotrp> where? +<user02> I did add the key +<user02> However +<pjotrp> (I am documenting) +<user02> I did not tell guix to trust it +<pjotrp> yes +<pjotrp> and there is another potential problem +<user02> Remember the documentation on installing guix? +<user02> You have to tell guix to trust the default key [09:29] +<user02> Right? +<user02> So in this case +<pjotrp> read the IRC log +<user02> That step is mandatory +<pjotrp> user01: how are you doing? +<pjotrp> user02: + https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org#using-gnu-guix-archive + [09:30] +<user01> a little bit left on the db download +<pjotrp> user02: you should see no more building +<pjotrp> user02: another issue may be that you updated r-preprocesscore + package in guix-buinformatics [09:32] +<pjotrp> all downstream packages will want to rebuild +<user02> no, not really +<user02> It's not even installed +<pjotrp> checkout a branch of the the old version - make sure we are in synch +<pjotrp> should be at + /gnu/store/y1f3r2xs3fhyadd46nd2aqbr2p9qv2ra-r-biocpreprocesscore-1.32.0 + [09:33] +<pjotrp> +<user03> pjotrp: Possibly we should use the archive utility of Guix to do + deployment to avoid such out-of-sync differences :) [09:34] +<pjotrp> maybe. I did not get archive to update profiles properly [09:37] +<pjotrp> Also it is good that they get to understand guix + this way +<pjotrp> carved in stone, eh [09:38] +<user02> Yeah, all good [09:39] +<user02> My mistake was skipping the guix archive part +<user02> Can we begin with the install? +<user02> It's telling me of derivatives that will be downloaded [09:40] +<user02> So we're good +<user02> Here goes +<pjotrp> yeeha [09:42] +<user02> pjotrp, where is this guix.genenetwork.org located at? +<pjotrp> Tennessee +<user02> It's...it's....sloooooooowwwwwwwwwwwwww +<pjotrp> not from Europe +<pjotrp> is it downloading at all? +<user02> It should be extended +<user02> Yes...like at 100KB/s [09:43] +<user02> tear-jerker +<user02> Verizon problems +<user02> who's the host? +<pjotrp> I am getting 500Kb/s +<pjotrp> UT +<user02> Guix's servers can run off more than one server, right? +<user02> I'd like to host that particular server here +<user02> For speed +<pjotrp> yes +<user02> Sooner or later +<user02> It will be a necessity [09:45] +<pjotrp> exactly what I am doing - this is our server +<pjotrp> guix.genenetwork.org:8080 +<user02> All done installing [09:46] +<pjotrp> what? +<user02> Now the databases +<pjotrp> what do you mean by slow exactly? +<user02> Yes, it's installed +<pjotrp> can you run genenetwork2 +<user02> setting variables +<user02> If I try running it now, it will fail as I don't have the DBs [09:47] +<pjotrp> cool - you had a lot of prebuilt packages already +<pjotrp> OK, follow the instructions I wrote above +<user01> now everything seems to be working for me :) +<user02> OK +<pjotrp> user01: excellent! +<pjotrp> you see a webserver? +<user01> yep, can connect to localhost:5003 [09:48] +<pjotrp> So now you are running a guix copy of GN2 +<pjotrp> you can see where it lives with `which genenetwork2` or ls -l + ~/.guix-profile/bin/genenetwork2 [09:49] +<pjotrp> + /gnu/store/1kma5xszvzsvmbb4k699h7gvdncw901i-genenetwork2-2.0-a8fcff4/bin/genenetwork2 +<pjotrp> it is a script +<pjotrp> written by guix, open it [09:50] +<pjotrp> inside it points to paths and our script at +<pjotrp> + /gnu/store/1kma5xszvzsvmbb4k699h7gvdncw901i-genenetwork2-2.0-a8fcff4/bin/.genenetwork2-real +<pjotrp> if you open that you can see how the webserver is started [09:51] +<pjotrp> next step is to run a recent version of GN2 +<user01> okay [09:52] +<pjotrp> See + https://github.com/genenetwork/genenetwork2/tree/staging/doc#run-your-own-copy-of-gn2 +<pjotrp> but do not checkout that genetwork2_diet +<pjotrp> we reverted to the main tree +<pjotrp> clone git@github.com:genenetwork/genenetwork2.git [09:53] +<pjotrp> instead and checkout the staging branch +<pjotrp> that is effectively my branch [09:54] +<pjotrp> when that is done you should be able to fire up the webserver from + there [09:55] +<pjotrp> using ./bin/genenetwork2 +<user02> now installing DBs +<user02> Downloading +<pjotrp> annoyingly the source tree is ~700Mb [09:56] +<user02> Can it also be done by installing the guix package + genenetwork2-database-small? +<pjotrp> I changed it in the diet version to 8Mb, but I had to revert +<user01> I need to make my VM bigger... +<pjotrp> user02: not ready [09:57] +<user02> ok +<pjotrp> user01: sorry +<pjotrp> user01: you could mount a local dir inside the VM for development +<pjotrp> that would allow you to use MAC tools for editing +<pjotrp> just an idea +<user01> yeah, I figure I'll do something like that +<pjotrp> do you use emacs? [09:58] +<user01> yep +<pjotrp> that can also run on remote files over ssh +<pjotrp> that's an alternative +<pjotrp> kudos for using emacs :), wdyt user03 +<user02> 79 minutes to go downloading the db +<pjotrp> user02: sorry about that [09:59] +<pjotrp> it is 2GB +<user02> user, you can also mount the directory via sshfs +<user02> Mac OSX runs OpenSSH +<pjotrp> user02: sopa +<user02> You can therefore mount a directory outside the VM to the VM via + sshfs [10:00] +<pjotrp> yes, 3 options now +<user02> That way, you can set up a VM only for it's logic +<user02> Apps + the OS it runs [10:01] +<user02> For data, let it reside on physical host accessible via sshfs +<user02> Use this Arch wiki reference: + https://wiki.archlinux.org/index.php/SSHFS +<user02> I edited that last somewhere in 2015, may have been updated since + then +<user01> alright, cool! [10:04] +<pjotrp> user01: you are almost done [10:06] +<pjotrp> I wrote an elixir package for guix :) +<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics/ ./pre-inst-env guix + package -A elixir + --substitute-urls="http://guix.genenetwork.org:8080" [10:08] +<pjotrp> elixir 1.2.3 out + ../guix-bioinformatics/gn/packages/elixir.scm:31:2 +<pjotrp> +<pjotrp> I am building it on guix.genenetwork.org right now [10:09] +<user01> nice [10:10] #+end_src + +** Run GN2 + +Make a note of the paths with + +#+begin_src bash +./pre-inst-env guix package --search-paths +#+end_src bash + +After setting the paths for the server + +#+begin_src bash +export PATH=~/.guix-profile/bin:$PATH +export PYTHONPATH="$HOME/.guix-profile/lib/python2.7/site-packages" +export R_LIBS_SITE="$HOME/.guix-profile/site-library/" +export GUIX_GTK3_PATH="$HOME/.guix-profile/lib/gtk-3.0" +export GI_TYPELIB_PATH="$HOME/.guix-profile/lib/girepository-1.0" +export XDG_DATA_DIRS="$HOME/.guix-profile/share" +export GIO_EXTRA_MODULES="$HOME/.guix-profile/lib/gio/modules" +#+end_src bash + +run the main script (in ~/.guix-profile/bin) + +#+begin_src bash +genenetwork2 +#+end_src bash + +will start the default server which listens on port 5003, i.e., +http://localhost:5003/. + +** Run MySQL server + +At this point we require the underlying distribution to install +and run mysqld. + +Download one of + +http://files.genenetwork.org/raw_database/ +https://s3.amazonaws.com/genenetwork2/db_webqtl_s.zip + +Check the md5sum. + +After installation inflate the database binary in the MySQL directory +(this is subject to change soon) + +: chown -R mysql:mysql db_webqtl_s/ +: chmod 700 db_webqtl_s/ +: chmod 660 db_webqtl_s/* + +restart MySQL service (mysqld). Login as root and + +: mysql> show databases; +: +--------------------+ +: | Database | +: +--------------------+ +: | information_schema | +: | db_webqtl_s | +: | mysql | +: | performance_schema | +: +--------------------+ + +Set permissions and match password in your settings file below: + +: mysql> grant all privileges on db_webqtl_s.* to gn2@"localhost" identified by 'mysql_password'; + +Note that if the mysql connection is not working, try connecting to +the IP address and check server firewall, hosts.allow and mysql IP +configuration. + +** Run your own copy of GN2 + +At some point you may want to fix the source code. Assuming you have +Guix and Genenetwork2 installed (as described above) clone the GN2 +repository from https://github.com/genenetwork/genenetwork2_diet + +Copy-paste the paths into your terminal (mainly so PYTHON_PATH and +R_LIBS_SITE are set) from the information given by guix: + +: guix package --search-paths + +Inside the repository: + +: cd genenetwork2 +: ./bin/genenetwork2 + +Will fire up your local repo http://localhost:5003/ using the +settings in ./etc/default_settings.py. These settings may +not reflect your system. To override settings create your own from a copy of +default_settings.py and pass it into GN2 with + +: ./bin/genenetwork2 $HOME/my_settings.py + +and everything *should* work (note the full path to the settings +file). This way we develop against the exact same dependency graph of +software. + +If something is not working, take a hint from the settings file +that comes in the Guix installation. It sits in something like + +: cat ~/.guix-profile/lib/python2.7/site-packages/genenetwork2-2.0-py2.7.egg/etc/default_settings.py + +** Set up nginx port forwarding + +nginx can be used as a reverse proxy for GN2. For example, we want to +expose GN2 on port 80 while it is running on port 5003. Essentially +the configuration looks like + +#+begin_src js + server { + listen 80; + server_name test-gn2.genenetwork.org; + access_log logs/test-gn2.access.log; + + proxy_connect_timeout 3000; + proxy_send_timeout 3000; + proxy_read_timeout 3000; + send_timeout 3000; + + location / { + proxy_set_header Host $http_host; + proxy_set_header Connection keep-alive; + proxy_set_header X-Real-IP $remote_addr; + proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; + proxy_set_header X-Forwarded-Host $server_name; + proxy_pass http://127.0.0.1:5003; + } +} +#+end_src js + +Install the nginx webserver (as root) + +: guix package -i nginx + +The nginx example configuration examples can be found in the Guix +store through + +: ls -l /root/.guix-profile/sbin/nginx +: lrwxrwxrwx 3 root guixbuild 66 Dec 31 1969 /root/.guix-profile/sbin/nginx -> /gnu/store/g0wrcl5z27rmk5b52rldzvk1bzzbnz2l-nginx-1.8.1/sbin/nginx + +Use that path + +: ls /gnu/store/g0wrcl5z27rmk5b52rldzvk1bzzbnz2l-nginx-1.8.1/share/nginx/conf/ +: fastcgi.conf koi-win scgi_params +: fastcgi.conf.default mime.types scgi_params.default +: fastcgi_params mime.types.default uwsgi_params +: fastcgi_params.default nginx.conf uwsgi_params.default +: koi-utf nginx.conf.default win-utf + +And copy any relevant files to /etc/nginx. A configuration file for +GeneNetwork (reverse proxy) port forwarding can be found in the source +repository under ./etc/nginx-genenetwork.conf. Copy this file to /etc +(still as root) +: cp ./etc/nginx-genenetwork.conf /etc/nginx/ + +Make dirs + +: mkdir -p /var/spool/nginx/logs + +Add users + +: adduser nobody ; addgroup nobody + +Run nginx + +: /root/.guix-profile/sbin/nginx -c /etc/nginx/nginx-genenetwork.conf -p /var/spool/nginx + +* Source deployment and other information on reproducibility + +See the document [[GUIX-Reproducible-from-source.org]]. + +* Trouble shooting + +** ImportError: No module named jinja2 + +If you have all the Guix packages installed this error points out that +the environment variables are not set. Copy-paste the paths into your +terminal (mainly so PYTHON_PATH and R_LIBS_SITE are set) from the +information given by guix: + +: guix package --search-paths + +On one system: + +: export PYTHONPATH="$HOME/.guix-profile/lib/python2.7/site-packages" +: export R_LIBS_SITE="$HOME/.guix-profile/site-library/" +: export GEM_PATH="$HOME/.guix-profile/lib/ruby/gems/2.2.0" + +and perhaps a few more. +** ERROR: can not find directory $HOME/gn2_data + +The default settings file looks in your $HOME/gn2_data. Since these +files come with a Guix installation you should take a hint from the +values in the installed version of default_settings.py (see above in +this document). + +** Can't run a module + +In rare cases, development modules are not brought in with Guix +because no source code is available. This can lead to missing modules +on a running server. Please check with the authors when a module +is missing. diff --git a/doc/database.org b/doc/database.org new file mode 100644 index 00000000..e06ac1ff --- /dev/null +++ b/doc/database.org @@ -0,0 +1,710 @@ +- github Document reduction issue + + +* GeneNetwork Database + +** Estimated table sizes + + +select table_name,round(((data_length + index_length) / 1024 / 1024), 2) `Size in MB` from information_schema.TABLES where table_schema = "db_webqtl" order by data_length; + ++-------------------------+------------+ +| table_name | Size in MB | ++-------------------------+------------+ +| ProbeSetData | 59358.80 | +| SnpAll | 15484.67 | +| ProbeData | 22405.44 | +| SnpPattern | 9177.05 | +| ProbeSetSE | 14551.02 | +| QuickSearch | 5972.86 | +| ProbeSetXRef | 4532.89 | +| LCorrRamin3 | 18506.53 | +| ProbeSE | 6263.83 | +| ProbeSet | 2880.21 | +| Probe | 2150.30 | +| GenoData | 3291.91 | +| CeleraINFO_mm6 | 989.80 | +| pubmedsearch | 1032.50 | +| ProbeXRef | 743.38 | +| GeneRIF_BASIC | 448.54 | +| BXDSnpPosition | 224.44 | +| EnsemblProbe | 133.66 | +| EnsemblProbeLocation | 105.49 | +| Genbank | 37.71 | +| TissueProbeSetData | 74.42 | +| AccessLog | 42.38 | +| GeneList | 34.11 | +| Geno | 33.90 | +| MachineAccessLog | 28.34 | +| IndelAll | 22.42 | +| PublishData | 22.54 | +| TissueProbeSetXRef | 14.73 | +| ProbeH2 | 13.26 | +| GenoXRef | 22.83 | +| TempData | 8.35 | +| GeneList_rn3 | 5.54 | +| GORef | 4.97 | +| Phenotype | 6.50 | +| temporary | 3.59 | +| InfoFiles | 3.32 | +| Publication | 3.42 | +| Homologene | 5.69 | +| Datasets | 2.31 | +| GeneList_rn33 | 2.61 | +| PublishSE | 4.71 | +| GeneRIF | 2.18 | +| Vlookup | 1.87 | +| H2 | 2.18 | +| PublishXRef | 2.18 | +| NStrain | 4.80 | +| IndelXRef | 2.91 | +| Strain | 1.07 | +| GeneMap_cuiyan | 0.51 | +| user_collection | 0.30 | +| CaseAttributeXRef | 0.44 | +| StrainXRef | 0.56 | +| GeneIDXRef | 0.77 | +| Docs | 0.17 | +| News | 0.17 | +| ProbeSetFreeze | 0.22 | +| GeneRIFXRef | 0.24 | +| Sample | 0.06 | +| login | 0.06 | +| user | 0.04 | +| TableFieldAnnotation | 0.05 | +| DatasetMapInvestigator | 0.05 | +| User | 0.04 | +| ProbeFreeze | 0.06 | +| TableComments | 0.02 | +| Investigators | 0.02 | +| DBList | 0.03 | +| Tissue | 0.02 | +| GeneChip | 0.01 | +| GeneCategory | 0.01 | +| SampleXRef | 0.01 | +| InbredSet | 0.01 | +| SnpAllele_to_be_deleted | 0.00 | +| Organizations | 0.01 | +| PublishFreeze | 0.00 | +| GenoFreeze | 0.00 | +| Chr_Length | 0.01 | +| SnpSource | 0.00 | +| AvgMethod | 0.00 | +| Species | 0.00 | +| Dataset_mbat | 0.00 | +| TissueProbeFreeze | 0.00 | +| EnsemblChip | 0.00 | +| TissueProbeSetFreeze | 0.01 | +| UserPrivilege | 0.00 | +| CaseAttribute | 0.00 | +| MappingMethod | 0.00 | +| DBType | 0.00 | +| InfoFilesUser_md5 | 0.00 | +| GenoCode | 0.00 | +| DatasetStatus | 0.00 | +| GeneChipEnsemblXRef | 0.00 | +| GenoSE | 0.00 | +| user_openids | 0.00 | +| roles_users | 0.00 | +| role | 0.00 | +| Temp | NULL | ++-------------------------+------------+ +97 rows in set, 1 warning (0.01 sec) + +All *Data tables are large + +** User access + +According to the meta data: + +This table tracks access time and IP addresses. Used for logging in +registered users and tracking cookies. + +# GN1 uses access table and GN2 uses user table (true/false?) + + select * from AccessLog limit 5; ++-------+---------------------+----------------+ +| id | accesstime | ip_address | ++-------+---------------------+----------------+ +| 12174 | 2003-10-28 02:17:41 | 130.120.104.71 | +| 12173 | 2003-10-28 02:16:27 | 130.120.104.71 | +| 3 | 2003-02-22 07:38:33 | 192.117.159.1 | +| 4 | 2003-02-22 07:49:13 | 192.117.159.1 | +| 5 | 2003-02-22 07:51:08 | 192.117.159.1 | ++-------+---------------------+----------------+ + +select * from AccessLog order by accesstime desc limit 5; ++---------+---------------------+---------------+ +| id | accesstime | ip_address | ++---------+---------------------+---------------+ +| 1025735 | 2016-02-08 14:23:29 | 100.43.81.157 | +| 1025734 | 2016-02-08 13:54:28 | 180.76.15.144 | +| 1025733 | 2016-02-08 13:43:37 | 66.249.65.217 | +| 1025732 | 2016-02-08 13:39:50 | 66.249.65.217 | +| 1025731 | 2016-02-08 13:15:46 | 66.249.65.217 | ++---------+---------------------+---------------+ + +Quite a few trait page hits: + +select count(*) from AccessLog; + ++----------+ +| count(*) | ++----------+ +| 1025685 | ++----------+ + +show indexes from AccessLog; ++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | ++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| AccessLog | 0 | PRIMARY | 1 | id | A | 1025685 | NULL | NULL | | BTREE | | | ++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ + +This table is being used by both GN1 and GN2 from the trait pages! + +: grep -ir AccessLog *|grep -e "^gn1\|^gn2"|grep \.py|grep -v doc + +gn1/web/webqtl/showTrait/ShowTraitPage.py: query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \ +gn1/web/webqtl/showTrait/ShowTraitPage.py: self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)" ,user_ip) +gn1/web/webqtl/textUI/cmdClass.py: query = """SELECT count(id) FROM AccessLog WHERE ip_address = %s AND UNIX_TIMESTAMP()-UNIX_TIMESTAMP(accesstime)<86400""" +gn1/web/webqtl/textUI/cmdClass.py: query = """INSERT INTO AccessLog(accesstime,ip_address) values(Now(),%s)""" +gn2/wqflask/wqflask/show_trait/show_trait_page.py: query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \ +gn2/wqflask/wqflask/show_trait/show_trait_page.py: self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)", user_ip) + +When looking at the code in GN1 and GN2 it restricts the daily use of +the trait data page (set to 1,000 - whoever reaches that?). Unlike +mentioned in the schema description, this table does *not* keep track +of cookies. + +From the code it looks like GN2 uses a mixture of Redis and sqlalchemy +to keep track of logged in sessions (see +gn2/wqflask/wqflask/user_manager.py) and cookies through a user_uuid in +model.py. + +In gn2/wqflask/wqflask/templates/collections/view_anonymous.html it +show_trait_page appears to be loaded (need to check). + +** AvgMethod + +Probesetfreeze refers to AvgMethod + +** BXDSnPosition + +Snp table (all snps) + +Mapping in GN1 shows snps when you select a chromosome. + +** CaseAttribute(XRef) + +Metadata + +** CeleralINFO_mm6 + +? + +** Chr_Length + +Default mm9, column for mm8 + +** Dataset_mbat + +Menu for BXD (linkouts) + +** DatasetMapInvestigator + +Arthur? + +** DataSets + +Information/metadata + +** DatasetStatus + +Arthur private/public + +** DBList and DBType + +Hooked in API (URL encoding) + +** Docs + +GN2 only (see menu bar) + +** Ensembl* + +Probe information + +(will be deprecated) + +** Genbank + +Linkout and not important + +** GeneCategory + +Not important. GeneWiki notes function classification. + +Deprecate. + +** GeneChip + +** GeneIDXRef + +Interspecies gene comparison + +** GeneList + +Track info + +** Genlist_rn3(3) + +Rat list + +** GeneMap_cuiyan + +Link outs + +** GeneRIF + +Wiki info (nightly updated from NCBI) + +XRef should be foreign keys + +** Geno + +SNP or marker info + +** GenoCode + +Belongs to someone else + +** GenoData + +Allele info + +** GenoFreeze + +Big menu (Freeze refers to menu) + +** GenoSE + +SE standard err, not used + +** GenoXREF + +Very important. Key links between Geno, GenoData + +** GORef + +GO terms + +** H2 + +Heritability for probeset(?) + +** Homologene + +Homology, not used much + +** InbredSet + +Group in menu + +** Indelall, SnpAll, SnpPattern, SnpSource + +Indel Snp browser (variant browser Gn1) + +** Info* + +Infra system PhP + +Data Info button + +Infosystem users has separate entries + +Also Investigators, User, Organizations, + +** LCorrRamin3 + +Lit. Correlations Prof. Ramin + +** Login + +GN2 login info + +** MachineAccessLog + +Old + +** MappingMethod + +GN1 + +** News + +GN2 + +** NStrain + +pheno publishfreeze (menu) + xref (keys) + xref links to publish (pubmed), phenotype, pubishdata +geno genofreeze + xref (keys) + xref links to publish (pubmed), genotype, genodata +probeset/expr. probesetfreeze + xref (keys) + xref links to publish (pubmed), probeset, probesetdata +probe/expr. probefreeze + xref (keys) + xref links to publish (pubmed), probe, probedata + +Each dataset has 3 values (real value (1), number of samples (2), stderr (3)) + +NStrain = number of phenotype samples + +ProbesetFreeze contains all data, incl. metabolomic. + +** Phenotype + +This table contains names, full descriptions, and short symbols for +traits and phenotype used primarily in the Published Phenotypes +databases. + +Contains 10k rows, March 2016, of which 5000 are for the BXDs). + +| Id | Pre_publication_description | Post_publication_description | Original_description | Units | Pre_publication_abbreviation | Post_publication_abbreviation | Lab_code | Submitter | Owner | Authorized_Users | ++----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+ +| 1 | NULL | Hippocampus weight | Original post publication description: Hippocampus weight | Unknown | NULL | HPCWT | NULL | robwilliams | NULL | robwilliams | +| 2 | NULL | Cerebellum weight | Original post publication description: Cerebellum weight | mg | NULL | CBLWT | NULL | robwilliams | NULL | robwilliams | +| 3 | NULL | Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide [units/100 ug protein] | Original post publication description: Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide [units/100 ug protein] | units/100 ug protein | NULL | IL1Activity | NULL | robwilliams | NULL | robwilliams | +| 4 | NULL | Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg] | Original post publication description: Cerebellum weight [mg] | mg | NULL | CBLWT2 | NULL | robwilliams | NULL | robwilliams | +| 5 | NULL | The coat color of 79 BXD RI strain | Original post publication description: The coat color of 79 BXD RI strain | Unknown | NULL | CoatColor | NULL | robwilliams | NULL | robwilliams | ++----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+ +5 rows in set (0.00 sec) + +** ProbeData + +Table with fine-grained probe level Affymetrix data only. Contains 1 +billion rows March 2016. This table may be deletable since it is only +used by the Probe Table display in GN1. Not used in GN2 +(double-check). + +In comparison the "ProbeSetData" table contains more molecular assay +data, including probe set data, RNA-seq data, proteomic data, and +metabolomic data. 2.5 billion rows March 2016. In comparison, +ProbeData contains data only for Affymetrix probe level data +(e.g. Exon array probes and M430 probes). + +"ProbeData.StrainId" should be "CaseId" or "SampleId". + +"ProbeData" should probably be "AssayData" or something more neutral. + +select * from ProbeData limit 2; ++--------+----------+---------+ +| Id | StrainId | value | ++--------+----------+---------+ +| 503636 | 42 | 11.6906 | +| 503636 | 43 | 11.4205 | ++--------+----------+---------+ +2 rows in set (0.00 sec) + +select count(*) from ProbeData limit 2; ++-----------+ +| count(*) | ++-----------+ +| 976753435 | ++-----------+ +1 row in set (0.00 sec) + +** ProbeSet + +Comment: PLEASE CHANGE TABLE NAME and rework fields carefully. This is +a terrible table but it works well (RWW March 2016). It is used in +combination with the crucial TRAIT DATA and ANALYSIS pages in GN1 and +GN2. It is also used by annotators using the UPDATE INFO AND DATA web +form to correct and update annotation. It is used by Arthur to enter +new annotation files and metadata for arrays, genes, proteins, +metabolites. The main problem with this table is that it is doing too +much work. + +Initially (2003) this table contained only Affymetrix ProbeSet data +for mouse (U74aV2 initially). Many other array platforms for different +species were added. At least four other major categories of molecular +assays have been added since about 2010. + +1. RNA-seq annotation and sequence data for transcripts using ENSEMBL + identifiers or NCBI NM_XXXXX and NR_XXXXX type identifiers + +2. Protein and peptide annotation and sequence data (see BXD Liver + Proteome data, SRM and SWATH type data) with identifiers such as + "abcb10_q9ji39_t311" for SRM data and "LLGNMIVIVLGHHLGKDFTPAAQAA" + for SWATH data where the latter is just the peptide fragment that + has been quantified. Data first entered in 2015 for work by Rudi + Aebersold and colleagues. + +3. Metabolite annotation and metadata (see BXD Liver Metabolome data) + with identifiers that are usually Mass charge ratios such as + "149.0970810_MZ" + +4. Epigenomic and methylome data (e.g. Human CANDLE Methylation data + with identifiers such as "cg24523000") + +It would make good sense to break this table into four or more types +of molecular assay metadata or annotation tables) (AssayRNA_Anno, +AssayProtein_Anno, AssayMetabolite_Anno, AssayEpigenome_Anno, +AssayMetagenome_Anno), since these assays will have many differences +in annotation content compared to RNAs. + +Some complex logic is used to update contents of this table when +annotators modify and correct the information (for example, updating +gene symbols). These features requested by Rob so that annotating one +gene symbol in one species would annotate all gene symbols in the same +species based on common NCBI GeneID number. For example, changing the +gene alias for one ProbeSet.Id will changing the list of aliases in +all instances with the same gene symbol. + +If the ProbeSet.BlatSeq (or is this ProbSetTargetSeq) is identical +between different ProbeSet.Ids then annotation is forced to be the +same even if the symbol or geneID is different. This "feature" was +implemented when we found many probe sets with identical sequence but +different annotations and identifiers. + + +select count(*) from ProbeSet limit 5; ++----------+ +| count(*) | ++----------+ +| 4351030 | ++----------+ + +| Id | ChipId | Name | TargetId | Symbol | description | Chr | Mb | alias | GeneId | GenbankId | SNP | BlatSeq | TargetSeq | UniGeneId | Strand_Probe | Strand_Gene | OMIM | comments | Probe_set_target_region | Probe_set_specificity | Probe_set_BLAT_score | Probe_set_Blat_Mb_start | Probe_set_Blat_Mb_end | Probe_set_strand | Probe_set_Note_by_RW | flag | Symbol_H | description_H | chromosome_H | MB_H | alias_H | GeneId_H | chr_num | name_num | Probe_Target_Description | RefSeq_TranscriptId | Chr_mm8 | Mb_mm8 | Probe_set_Blat_Mb_start_mm8 | Probe_set_Blat_Mb_end_mm8 | HomoloGeneID | Biotype_ENS | ProteinID | ProteinName | Flybase_Id | HMDB_ID | Confidence | ChEBI_ID | ChEMBL_ID | CAS_number | PubChem_ID | ChemSpider_ID | UNII_ID | EC_number | KEGG_ID | Molecular_Weight | Nugowiki_ID | Type | Tissue | PrimaryName | SecondaryNames | PeptideSequence | ++------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+ +| 7282 | 1 | 93288_at | NULL | Arpc2 | actin related protein 2/3 complex, subunit 2 | 1 | 74.310961 | AK008777 | 76709 | AI835883 | 0 | CCGACTTCCTTAAGGTGCTCAACCGGACTGCTTGCTACTGGATAATCGTGAGGGATTCTCCATTTGGGTTCCATTTTGTACGAGTTTGGCAAATAACCTGCAGAAACGAGCTGTGCTTGCAAGGACTTGATAGTTCCTAATCCTTTTCCAAGCTGTTTGCTTTGCAATATGT | ccgacttccttaaggtgctcaaccgtnnnnnnccnannnnccnagaaaaaagaaatgaaaannnnnnnnnnnnnnnnnnnttcatcccgctaactcttgggaactgaggaggaagcgctgtcgaccgaagnntggactgcttgctactggataatcgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgagggattctccatttgggttccattttgtacgagtttggcaaataacctgcagaaacgagctgtgcttgcaaggacttgatagttcctaagaattanaanaaaaaaaanaanttccacttgatcaanttaattcccttttatttttcctccctcantccccttccttttccaagctgtttgctttgcaatatgt | Mm.337038 | + | | 604224 | | NULL | 8.45 | 169 | 74.310961 | 74.31466 | NULL | NULL | 3 | NULL | NULL | NULL | NULL | NULL | NULL | 1 | 93288 | NULL | XM_129773 | 1 | 74.197594 | 74.197594 | 74.201293 | 4187 | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | ++------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+ +2 rows in set (0.00 sec) + + + + +** ProbeSetData + +Probedata - main molecular data. Probesets, metabolome, + +Almost all important molecular assay data is in this table including +probe set data, RNA-seq data, proteomic data, and metabolomic +data. 2.5 billion rows March 2016. In comparison, ProbeData contains +data only for Affymetrix probe level data (e.g. Exon array probes and +M430 probes). + +select count(*) from ProbeSetData limit 5; ++---------------+ +| count(*) | ++---------------+ +| 2,510,566,472 | ++---------------+ + + +select * from ProbeSetData limit 5; ++----+----------+-------+ +| Id | StrainId | value | ++----+----------+-------+ +| 1 | 1 | 5.742 | +| 1 | 2 | 5.006 | +| 1 | 3 | 6.079 | +| 1 | 4 | 6.414 | +| 1 | 5 | 4.885 | ++----+----------+-------+ + +show indexes from ProbeSetData; ++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | ++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| ProbeSetData | 0 | DataId | 1 | Id | A | 34868978 | NULL | NULL | | BTREE | | | +| ProbeSetData | 0 | DataId | 2 | StrainId | A | 2510566472 | NULL | NULL | | BTREE | | | ++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ + +select * from Strain limit 5; ++----+----------+----------+-----------+--------+-------+ +| Id | Name | Name2 | SpeciesId | Symbol | Alias | ++----+----------+----------+-----------+--------+-------+ +| 1 | B6D2F1 | B6D2F1 | 1 | NULL | NULL | +| 2 | C57BL/6J | C57BL/6J | 1 | B6J | NULL | +| 3 | DBA/2J | DBA/2J | 1 | D2J | NULL | +| 4 | BXD1 | BXD1 | 1 | NULL | NULL | +| 5 | BXD2 | BXD2 | 1 | NULL | NULL | ++----+----------+----------+-----------+--------+-------+ + +show indexes from Strain; ++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | ++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| Strain | 0 | PRIMARY | 1 | Id | A | 14368 | NULL | NULL | | BTREE | | | +| Strain | 0 | Name | 1 | Name | A | 14368 | NULL | NULL | YES | BTREE | | | +| Strain | 0 | Name | 2 | SpeciesId | A | 14368 | NULL | NULL | | BTREE | | | +| Strain | 1 | Symbol | 1 | Symbol | A | 14368 | NULL | NULL | YES | BTREE | | | ++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ + +A typical query may look like + +SELECT Strain.Name, ProbeSetData.value, ProbeSetSE.error, ProbeSetData.Id + FROM (ProbeSetData, ProbeSetFreeze, Strain, ProbeSet, ProbeSetXRef) + left join ProbeSetSE on + (ProbeSetSE.DataId = ProbeSetData.Id AND ProbeSetSE.StrainId = ProbeSetData.StrainId) + WHERE + ProbeSetFreeze.name = 'B139_K_1206_M' AND + ProbeSetXRef.ProbeSetId = ProbeSet.Id AND + ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND + ProbeSetXRef.DataId = ProbeSetData.Id AND + ProbeSetData.StrainId = Strain.Id + Order BY Strain.Name + ++-------+-------+-------+----------+ +| Name | value | error | Id | ++-------+-------+-------+----------+ +| SM001 | 38.3 | NULL | 25309550 | +| SM001 | 2.7 | NULL | 25309520 | +| SM001 | 20.3 | NULL | 25309507 | +| SM001 | 125.8 | NULL | 25309511 | +| SM001 | 8.2 | NULL | 25309534 | ++-------+-------+-------+----------+ +5 rows in set (22.28 sec) + +select * from ProbeSetFreeze limit 5; ++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ +| Id | ProbeFreezeId | AvgID | Name | Name2 | FullName | ShortName | CreateTime | OrderList | public | confidentiality | AuthorisedUsers | DataScale | ++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ +| 1 | 3 | 1 | Br_U_0803_M | BXDMicroArray_ProbeSet_August03 | UTHSC Brain mRNA U74Av2 (Aug03) MAS5 | Brain U74Av2 08/03 MAS5 | 2003-08-01 | NULL | 0 | 0 | NULL | log2 | +| 2 | 10 | 1 | Br_U_0603_M | BXDMicroArray_ProbeSet_June03 | UTHSC Brain mRNA U74Av2 (Jun03) MAS5 | Brain U74Av2 06/03 MAS5 | 2003-06-01 | NULL | 0 | 0 | NULL | log2 | +| 3 | 8 | 1 | Br_U_0303_M | BXDMicroArray_ProbeSet_March03 | UTHSC Brain mRNA U74Av2 (Mar03) MAS5 | Brain U74Av2 03/03 MAS5 | 2003-03-01 | NULL | 0 | 0 | NULL | log2 | +| 4 | 5 | 1 | Br_U_0503_M | BXDMicroArray_ProbeSet_May03 | UTHSC Brain mRNA U74Av2 (May03) MAS5 | Brain U74Av2 05/03 MAS5 | 2003-05-01 | NULL | 0 | 0 | NULL | log2 | +| 5 | 4 | 1 | HC_U_0303_M | GNFMicroArray_ProbeSet_March03 | GNF Hematopoietic Cells U74Av2 (Mar03) MAS5 | GNF U74Av2 03/03 MAS5 | 2003-03-01 | NULL | 0 | 0 | NULL | log2 | ++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ + + select * from ProbeSetXRef limit 5; ++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ +| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old | LRS_old | pValue_old | mean | se | Locus | LRS | pValue | additive | h2 | ++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ +| 1 | 1 | 1 | 10.095.400 | 13.3971627898894 | 0.163 | 5.48794285714286 | 0.08525787814808819 | rs13480619 | 12.590069931048001 | 0.269 | -0.28515625 | NULL | +| 1 | 2 | 2 | D15Mit189 | 10.042057464356201 | 0.431 | 9.90165714285714 | 0.0374686634976217 | CEL-17_50896182 | 10.5970737900941 | 0.304 | -0.11678333333333299 | NULL | +| 1 | 3 | 3 | D5Mit139 | 5.43678531742749 | 0.993 | 7.83948571428571 | 0.0457583416912569 | rs13478499 | 6.0970532702754 | 0.988 | 0.112957489878542 | NULL | +| 1 | 4 | 4 | D1Mit511 | 9.87815279480766 | 0.483 | 8.315628571428569 | 0.0470396593931327 | rs6154379 | 11.774867551173099 | 0.286 | -0.157113725490196 | NULL | +| 1 | 5 | 5 | D16H21S16 | 10.191723834264499 | 0.528 | 9.19345714285714 | 0.0354801718293322 | rs4199265 | 10.923263374016202 | 0.468 | 0.11476470588235299 | NULL | ++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ + + +Note that the following unlimited search is very slow: + +select max(value) from ProbeSetData; + ++------------+ +| max(value) | ++------------+ +| 26436006 | ++------------+ +1 row in set (2 min 16.31 sec) + +which is in some form is used in the search page, see [[https://github.com/genenetwork/genenetwork2_diet/blob/master/wqflask/wqflask/do_search.py#L811][the search code]]. + + +*** Improvements? + +Suggestions on the schema page: + +"StrainId" should be "CaseId" or "SampleId". + +"ProbeSetData" should probably be "AssayData" or something more neutral. + +*** Comments + +I think the ProbeSetData table should be generalized to a 'phenotypes' +table with an 'sample_id' column and a 'value' column. + +A new table 'samples' will link each sample against an 'experiment', +an 'individual' and which in turn can link to a 'strain'. + +Experiment is here in a wide sense, GTex can be one - I don't want to +use dataset ;) + +This means a (slight) reordering: + +phenotypes: (id), sample_id, value +samples: experiment_id, individual_id +experiments: name, version +individual: strain_id +strains: species_id +species: ... + +ProbeData is also interesting, because it has the same structure as +ProbeSetData, but only contains microarrays. This tables should be one +(when we clear up the cross-referencing) as they both contain +phenotype values. Both are large tables. + +PublishData is another phenotype table with values only which can be +merged into that same table. + +So we have phenotype data in 3 tables with exactly the same +layout. There is also TissueProbeSet*, but we'll ignore those for +now. I think we should merge these into one and have the sample ref +refer to the type of data (probeset, probe, metabolomics, +whatever). These are all phenotype values and by having them split +into different tables they won't play well when looking for +correlations. + +ProbeSet contains the metadata on the probes and should (eventually) +move into NoSQL. There is plenty redundancy in that table now. + +I know it is going to be a pain to reorganize the database, but if we +want to use it in the long run we are going to have to simplify it. + + + +** Publication and publishdata (all pheno) + +Phenotype pubs + +** QuickSearch + +No longer used + +** role + +empty + +** Sample* + +No longer used + +** Species & Strain (should be sample) + +Menu + +** InbredSet + +Menu + +** TableComments + +Metadata on DB + +** Temp* + +User upload data + +** Tissue + +Menu - 3rd level + +** TissueP* + +Correlation tables + +** User collection + +User selection - retained + +** UserPrivilege + +** Vlookup + diff --git a/doc/new_variable_names.txt b/doc/new_variable_names.txt deleted file mode 100644 index c11c160e..00000000 --- a/doc/new_variable_names.txt +++ /dev/null @@ -1,6 +0,0 @@ -RISet/riset -> group -webqtlDataset.py -> data_set.py -webqtlDataset (class object) -> DataSet -database/db -> dataset/data_set -DataEditingPage -> show_trait.py/show_trait.html -webqtlTrait -> GeneralTrait \ No newline at end of file diff --git a/doc/notes_DA.txt b/doc/notes_DA.txt deleted file mode 100644 index 410e0182..00000000 --- a/doc/notes_DA.txt +++ /dev/null @@ -1,10 +0,0 @@ -Danny's notes about the genenetwork source - -Location of static files: - -Location of HTML templates: wqflask/wqflask/templates/ - -Entry point of the wqflask app: wqflask/wqflask/__init__.py - -Application routes: wqflask/wqflask/views.py - diff --git a/doc/gn_installation_notes.txt b/doc/old/gn_installation_notes.txt index 584080f7..efea0309 100644 --- a/doc/gn_installation_notes.txt +++ b/doc/old/gn_installation_notes.txt @@ -96,7 +96,7 @@ Before installing from requirements.txt, install numpy separately: pip install numpy==1.7.0 (or whatever version we're using) Install from requirements.txt (after activating virtualenv): -pip install -r gene/misc/requirements.txt +pip install -r gene/doc/requirements.txt =========================================== @@ -343,4 +343,4 @@ python runserver.py To do full upgrade (as opposed to apt-get upgrade) sudo aptitude full-upgrade -=========================================== \ No newline at end of file +=========================================== diff --git a/doc/notes.txt b/doc/old/notes.txt index f8ce2759..f8ce2759 100644 --- a/doc/notes.txt +++ b/doc/old/notes.txt diff --git a/doc/requirements.txt b/doc/requirements.txt deleted file mode 100644 index 39ee5652..00000000 --- a/doc/requirements.txt +++ /dev/null @@ -1,36 +0,0 @@ -BeautifulSoup==3.2.1 -Flask==0.9 -Flask-Login==0.1.3 -Flask-Mail==0.7.6 -Flask-Principal==0.3.4 -Flask-SQLAlchemy==0.16 -Flask-Security==1.6.0 -Flask-WTF==0.8.3 -Jinja2==2.6 -MySQL-python==1.2.4 -PyYAML==3.10 -#Reaper==1.0 -Reindent==0.1.1 -SQLAlchemy==0.8.0 -WTForms==1.0.3 -Werkzeug==0.8.3 -apache-libcloud==0.12.3 -argparse==1.2.1 -blinker==1.2 -cairosvg==1.0.15 -itsdangerous==0.17 -logging-tree==1.2 -logilab-astng==0.24.3 -logilab-common==0.59.1 -#numarray==1.5.2 -numpy==1.7.0 -passlib==1.6.1 -pp==1.6.3 -pylint==0.27.0 -redis==2.7.2 -requests==1.1.0 -scipy==0.11.0 -simplejson==3.0.7 -wsgiref==0.1.2 -yolk==0.4.3 -XlsxWriter==0.7.2 diff --git a/doc/todo.txt b/doc/todo.txt deleted file mode 100644 index 1d781b13..00000000 --- a/doc/todo.txt +++ /dev/null @@ -1,2 +0,0 @@ -- Ask Rob about potentially recoding qtlreaper -- Ask Rob about Probe/cellid traits \ No newline at end of file |
