Merge /home/gn2/gene

16 files changed, 2872 insertions, 726 deletions

diff --git a/doc/Architecture.org b/doc/Architecture.org
new file mode 100644
index 00000000..c263d3b9
--- /dev/null
+++ b/doc/Architecture.org
@@ -0,0 +1,15 @@
+* GeneNetwork Architecture
+
+** Introduction
+
+This document describes the architecture of GN2. Because GN2 is
+evolving, only a high-level overview is given here.
+
+** Webserver
+
+The webserver is built on [[http://flask.pocoo.org/][Python flask]] and this GN2 source code can be
+found on [[https://github.com/genenetwork/genenetwork2/tree/master/wqflask/wqflask][github]] in the wqflask directory. The routing tables are
+defined in [[https://github.com/genenetwork/genenetwork2/blob/master/wqflask/wqflask/views.py][views.py]]. For example the main page is loaded from a
+template named [[https://github.com/genenetwork/genenetwork2/blob/master/wqflask/wqflask/templates/index_page.htm][index_page.html]] in the [[https://github.com/genenetwork/genenetwork2/tree/master/wqflask/wqflask/templates][templates]] directory. In the 
+template you can find get the form gets filled by a Javascript
+routine defined in [[https://github.com/genenetwork/genenetwork2/blob/master/wqflask/wqflask/static/new/javascript/dataset_select_menu.js][data_select_menu.js]].
diff --git a/doc/GUIX-Reproducible-from-source.org b/doc/GUIX-Reproducible-from-source.org
index b88eb9e8..4399ea26 100644
--- a/doc/GUIX-Reproducible-from-source.org
+++ b/doc/GUIX-Reproducible-from-source.org
@@ -4,6 +4,7 @@
  - [[#introduction][Introduction]]
  - [[#binary-deployment][Binary deployment]]
  - [[#from-source-deployment][From source deployment]]
+ - [[#create-archive][Create archive]]
 
 * Introduction
 
@@ -31,5 +32,23 @@ Next build guix (and run) following the instructions in [[https://github.com/pjo
 
 Once that is done we can add the guix-bioinformatics path with
 
-: env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -A slurm
+: env GUIX_PACKAGE_PATH=../guix-bioinformatics command
 
+So
+
+#+begin_src sh   :lang bash
+#+begin_src sh   :lang bash
+gn-stable-guix$ env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -A genenetwork
+genenetwork1    1.0-d622c803b   out     ../guix-bioinformatics/gn/packages/bioinformatics.scm:163:2
+genenetwork2    2.0-9e9475053   out     ../guix-bioinformatics/gn/packages/bioinformatics.scm:215:2
+#+end_src sh   :lang bash
+
+Install with
+
+#+begin_src sh   :lang bash
+gn-stable-guix$ env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix package -i genenetwork2
+#+end_src sh   :lang bash
+
+* Create archive
+
+: env GUIX_PACKAGE_PATH=../../genenetwork/guix-bioinformatics/ ./pre-inst-env guix archive --export -r genenetwork2 > guix_gn2-2.0-9e9475053.nar
diff --git a/doc/GUIX-archive.org b/doc/GUIX-archive.org
new file mode 100644
index 00000000..67ab5cd0
--- /dev/null
+++ b/doc/GUIX-archive.org
@@ -0,0 +1,106 @@
+* Binary deployment
+
+Note binary deployment is not working pending a few improvements
+to GNU Guix. See source deployment instead.
+
+** Install Guix using a tar ball
+
+GN can be deployed either as a binary tarball or as a GNU Guix
+package. First install GNU Guix following the instructions of the
+[[https://www.gnu.org/software/guix/manual/html_node/Binary-Installation.html#Binary-Installation][binary installation]] using a tar ball from [[https://www.gnu.org/software/guix/download/][here]].
+
+With guix-daemon running you should be able to install the hello
+package:
+
+: guix package -i hello
+
+** Fix locale
+
+You may want to 
+
+#+begin_src sh   :lang bash
+export GUIX_LOCPATH=$HOME/.guix-profile/lib/locale
+export LC_ALL=en_US.utf8
+#+end_src sh   :lang bash
+
+** Authorize our archives
+
+Next add our archive key to guix (as root):
+
+#+begin_src scheme
+echo "(public-key   
+ (ecc 
+  (curve Ed25519)
+  (q #E9A95686D8437186302E07C7AB9BF3913F435026C2D389AF27D9C66FD6EBB649#)
+  )
+ )
+"|guix archive --authorize
+#+end_src scheme
+
+if you have trouble finding a suitable guix try
+
+: ls /gnu/store/*guix-*/bin/guix
+
+and you should be able to use this directly, e.g.
+
+: alias guix=/gnu/store/632msbms2yaldfnlrb5lbnlnmn9yjisw-guix-0.9.0/bin/guix
+: guix --version
+
+** Download and install the GN2 archive
+
+Find the archive on 
+
+  http://files.genenetwork.org/software/
+
+download and install with
+
+#+begin_src bash
+guix archive --import < genenetwork2-data-hash.nar
+#+end_src bash
+
+and you should see a list of packages installing, e.g.
+
+#+begin_src bash
+importing path `/gnu/store/l1zs2drn3zdzl5ysjcmhibcpa35p9zfc-python2-mysqlclient-1.3.7'
+importing path `/gnu/store/n7kfg4knibvblggy8ci2liscl7vz5wkg-python2-parallel-1.6.4'
+importing path `/gnu/store/qvv16qwlq59gp5d07lwbf5n8ndsi3il3-python2-sqlalchemy-1.0.11'
+importing path `/gnu/store/qw872mbmr9ir0a9drv9xw9pvjk05ywwy-python2-xlsxwriter-0.8.4'
+importing path `/gnu/store/wc112m1xfy3p08v14bdzay2ki2rirdsm-pylmm-gn2-1.0-3c6d1cac8'
+importing path `/gnu/store/zfkcy17c2ks3cd9ks14irdabqvmlfpyn-python2-flask-sqlalchemy-2.1'
+importing path `/gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff4'
+(etc.)
+#+end_src bash
+
+The following packages need to be added and the R path set
+
+: export R_LIBS_SITE="/home/wrk/.guix-profile/site-library/"
+: guix package -i /gnu/store/w0dqg9dshq53j8xhcnqgvnvms2s6y5k5-r-wgcna-1.49-425bc170cc0873ddbd414675ac40f6d4d724c7cb
+: guix package -i /gnu/store/k60bdlm0v7xic88j2z5c1jb1jvc371mn-r-qtl-1.38-4
+
+You can add the last one to your profile
+
+: guix package -i /gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff
+: export PATH=~/.guix-profile/bin:$PATH
+: genenetwork2
+
+ or run it directly with
+
+: /gnu/store/cgcjdiz1qylbc372gc3nda3372ihkpqb-genenetwork2-2.0-a8fcff/bin/genenetwork2
+
+
+
+** Other
+
+Update guix with a 'guix pull' and make guix visible in the path.
+More information exists also in my [[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org][guix-notes]].
+
+With guix running you should be able to install python, for example.
+
+: guix package -i python2
+
+This will make python appear in $HOME/.guix-profile/bin/python. Suggested
+environment settings can be seen with
+
+: guix package --search-paths
+
+
diff --git a/doc/README.org b/doc/README.org
index f6ab6a52..3754dbbd 100644
--- a/doc/README.org
+++ b/doc/README.org
@@ -1,28 +1,857 @@
-#+TITLE: Installing GeneNetwork services with GNU Guix
+
+#+TITLE: Installing GeneNetwork services
 
 * Table of Contents                                                     :TOC:
  - [[#introduction][Introduction]]
- - [[#binary-deployment][Binary deployment]]
- - [[#from-source-deployment][From source deployment]]
+ - [[#quick-installation-recipe][Quick installation recipe]]
+   - [[#step-1-install-gnu-guix][Step 1: Install GNU Guix]]
+   - [[#step-2-checkout-the-gn2-git-repositories][Step 2: Checkout the GN2 git repositories]]
+   - [[#step-3-authorize-the-gn-guix-server][Step 3: Authorize the GN Guix server]]
+   - [[#step-4-install-and-run-gn2-][Step 4: Install and run GN2 ]]
+ - [[#run-mysql-server][Run MySQL server]]
+ - [[#gn2-dependency-graph][GN2 Dependency Graph]]
+ - [[#source-deployment][Source deployment]]
+   - [[#run-your-own-copy-of-gn2][Run your own copy of GN2]]
+   - [[#set-up-nginx-port-forwarding][Set up nginx port forwarding]]
+ - [[#source-deployment-and-other-information-on-reproducibility][Source deployment and other information on reproducibility]]
+   - [[#update-to-recent-guix][Update to recent guix]]
+   - [[#install-gn2][Install GN2]]
+   - [[#run-gn2][Run GN2]]
+ - [[#trouble-shooting][Trouble shooting]]
+   - [[#importerror-no-module-named-jinja2][ImportError: No module named jinja2]]
+   - [[#error-can-not-find-directory-homegn2_data][ERROR: can not find directory $HOME/gn2_data]]
+   - [[#cant-run-a-module][Can't run a module]]
+ - [[#irc-session][IRC session]]
 
 * Introduction
 
-Large system deployments tend to get very complex. In this document we
-explain the GeneNetwork deployment system which is based on GNU Guix
-(see Pjotr's [[https://github.com/pjotrp/guix-notes/blob/master/README.md][Guix-notes]]).
+If you want to understand the architecture of GN2 read
+[[Architecture.org]].  The rest of this document is mostly on deployment
+of GN2.
+
+Large system deployments can get very [[http://biobeat.org/gn2.svg][complex]]. In this document we
+explain the GeneNetwork version 2 (GN2) reproducible deployment system
+which is based on GNU Guix (see also Pjotr's [[https://github.com/pjotrp/guix-notes/blob/master/README.md][Guix-notes]]). The Guix
+system can be used to install GN with all its files and dependencies.
+
+The official installation path is from a checked out version of the
+main Guix package tree and that of the Genenetwork package
+tree. Current supported versions can be found as the SHA values of
+'gn-latest' branches of [[https://github.com/genenetwork/guix-bioinformatics/tree/gn-latest][Guix bioinformatics]] and [[https://github.com/genenetwork/guix/tree/gn-latest][GNU Guix main]].
+
+For a full view of runtime dependencies as defined by GNU Guix, see
+the [[#gn2-dependency-graph][GN2 Dependency Graph]].
+
+* Quick installation recipe
+
+This is a recipe for quick and dirty installation of GN2. For
+convenience everything is installed as root, though in reality only
+GNU Guix has to be installed as root. I tested this recipe on a fresh
+install of Debian 8.3.0 (in KVM) though it should work on any modern
+Linux distribution (including CentOS). For more elaborate installation
+instructions see [[#source-deployment][Source deployment]].
+
+Note that GN2 consists of an approx. 5 GB installation including
+database.
+
+** Step 1: Install GNU Guix
+
+Fetch the GNU Guix binary from [[https://www.gnu.org/software/guix/download/][here]] (middle panel) and follow
+[[https://www.gnu.org/software/guix/manual/html_node/Binary-Installation.html][instructions]]. Essentially you have to download and unpack the tar ball
+(which creates directories in /gnu and /var/guix), add build users and
+group (Guix builds software as unpriviliged users) and run the Guix
+daemon after fixing the paths (also known as the 'profile').
+
+Once you have succeeded, you have to [[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org#set-the-key][set the key]] (getting permission
+to download binaries from the GNU server) and you should be able to
+install the hello package using binary packages (no building)
+
+#+begin_src bash
+export PATH=~/.guix-profile/bin:$PATH
+guix pull
+guix package -i hello --dry-run
+#+end_src
+
+Which should show something like
+
+: The following files would be downloaded:
+:   /gnu/store/zby49aqfbd9w9br4l52mvb3y6f9vfv22-hello-2.10
+:   ...
+#+end_src
+
+means binary installs.  The actual installation command of 'hello' is
+
+#+begin_src bash
+guix package -i hello
+hello
+  Hello, world!
+#+end_src
 
-* Binary deployment
+If you actually see things building it means that Guix is not yet
+properly installed and up-to-date, i.e., the key is missing or you
+need to do a 'guix pull'. Press Ctrl-C to interrupt.
 
-NYA
+If you need more help we have another writeup in [[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org#binary-installation][guix-notes]]. To get
+rid of the locale warning see [[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org#set-locale][set-locale]].
 
-* From source deployment
+** Step 2: Checkout the GN2 git repositories
 
-GNU Guix allows for [[https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org][reproducible deployment]] based on a checked out
-Guix repository - use gn-stable for that:
+To fixate the software dependency graph GN2 uses git repositories of
+Guix packages. First install git if it is missing
 
-#+begin_src sh   :lang bash
+#+begin_src bash
+guix package -i git
+export GIT_SSL_CAINFO=/etc/ssl/certs/ca-certificates.crt
+#+end_src
+
+check out the git repsitories (gn-latest branch)
+
+#+begin_src bash
+cd ~
 mkdir genenetwork
 cd genenetwork
-git checkout https://github.com/genenetwork/guix.git gn-stable-guix
-git checkout https://github.com/genenetwork/guix-bioinformatics.git
+git clone --branch gn-latest https://github.com/genenetwork/guix-bioinformatics
+git clone --branch gn-latest --recursive https://github.com/genenetwork/guix guix-gn-latest
+cd guix-gn-latest
+#+end_src bash
+
+** Step 3: Authorize the GN Guix server
+
+GN2 has its own GNU Guix binary distribution server. To trust it you have
+to add the following key 
+
+#+begin_src scheme
+(public-key
+ (ecc
+  (curve Ed25519)
+  (q #11217788B41ADC8D5B8E71BD87EF699C65312EC387752899FE9C888856F5C769#)
+ )
+)
+#+end_src
+
+by pasting it into the command
+
+#+begin_src bash
+guix archive --authorize
+#+end_src
+
+and hit Ctrl-D.
+
+Now you can use the substitute server to install GN2 binaries. 
+
+** Step 4: Install and run GN2 
+
+Since this is a quick and dirty install we are going to override the
+GNU Guix package path by pointing the package path to our repository:
+
+#+begin_src bash
+rm /root/.config/guix/latest
+ln -s ~/genenetwork/guix-gn-latest/ /root/.config/guix/latest
+#+end_src
+
+Now check whether you can find the GN2 package with
+
+#+begin_src bash
+env GUIX_PACKAGE_PATH=~/genenetwork/guix-bioinformatics/ guix package -A genenetwork2
+  genenetwork2    2.0-a8fcff4     out     gn/packages/genenetwork.scm:144:2
+#+end_src
+
+(ignore the source file newer then ... messages, this is caused by the
+/root/.config/guix/latest override).
+
+And install with
+
+#+begin_src bash
+env GUIX_PACKAGE_PATH=~/genenetwork/guix-bioinformatics/ \
+  guix package -i genenetwork2 \
+  --substitute-urls="http://guix.genenetwork.org:8080 https://mirror.guixsd.org" \
+  --fallback
+#+end_src
+
+Note: the order of the substitute url's may make a difference in speed
+(put the one first that is fastest for your location and time of day).
+
+After installation you should be able to run genenetwork2 after updating
+the Guix suggested environment vars. Check the output of
+
+#+begin_src bash
+guix package --search-paths
+export PYTHONPATH="/root/.guix-profile/lib/python2.7/site-packages"
+export R_LIBS_SITE="/root/.guix-profile/site-library/"
+#+end_src
+
+and copy-paste the listed exports into the terminal before running:
+
+#+begin_src bash
+genenetwork2
+#+end_src
+
+It will complain that the database is missing. See the next section on
+running MySQL server for downloading and installing a MySQL GN2
+database. After installing the database restart genenetwork2 and point
+your browser at [[http://localhost:5003/]].
+
+End of the GN2 installation recipe!
+
+* Run MySQL server
+
+At this point we require the underlying distribution to install and
+run mysqld. Currently we have two databases for deployment,
+'db_webqtl_s' is the small testing database containing experiments
+from BXD mice and 'db_webqtl_plant' which contains all plant related
+material.
+
+Download one database from
+
+http://files.genenetwork.org/raw_database/
+https://s3.amazonaws.com/genenetwork2/db_webqtl_s.zip
+
+Check the md5sum.
+
+After installation inflate the database binary in the MySQL directory
+(this installation path is subject to change soon) 
+
+: chown -R mysql:mysql db_webqtl_s/
+: chmod 700 db_webqtl_s/
+: chmod 660 db_webqtl_s/*
+
+restart MySQL service (mysqld). Login as root and
+
+: mysql> show databases;
+: +--------------------+
+: | Database           |
+: +--------------------+
+: | information_schema |
+: | db_webqtl_s        |
+: | mysql              |
+: | performance_schema |
+: +--------------------+
+
+Set permissions and match password in your settings file below:
+
+: mysql> grant all privileges on db_webqtl_s.* to gn2@"localhost" identified by 'mysql_password';
+
+Note that if the mysql connection is not working, try connecting to
+the IP address and check server firewall, hosts.allow and mysql IP
+configuration.
+
+Note for the plant database you can rename it to db_webqtl_s, or
+change the settings in etc/default_settings.py to match your path.
+
+* GN2 Dependency Graph
+
+Graph of all runtime dependencies as installed by GNU Guix.
+
+#+ATTR_HTML: :title GN2_graph
+[[http://biobeat.org/gn2.svg]]
+
+* Source deployment
+
+This section gives a more elaborate instruction for installing GN2
+from source.
+
+First execute above 4 steps:
+
+   - [[#step-1-install-gnu-guix][Step 1: Install GNU Guix]]
+   - [[#step-2-checkout-the-gn2-git-repositories][Step 2: Checkout the GN2 git repositories]]
+   - [[#step-3-authorize-the-gn-guix-server][Step 3: Authorize the GN Guix server]]
+   - [[#step-4-install-and-run-gn2-][Step 4: Install and run GN2 ]]
+
+
+** Run your own copy of GN2
+
+At some point you may want to fix the source code. Assuming you have
+Guix and Genenetwork2 installed (as described above) clone the GN2
+repository from https://github.com/genenetwork/genenetwork2.
+
+Copy-paste the paths into your terminal (mainly so PYTHON_PATH and
+R_LIBS_SITE are set) from the information given by guix:
+
+: guix package --search-paths
+
+Inside the repository:
+
+: cd genenetwork2
+: ./bin/genenetwork2 
+
+Will fire up your local repo http://localhost:5003/ using the  
+settings in ./etc/default_settings.py. These settings may 
+not reflect your system. To override settings create your own from a copy of
+default_settings.py and pass it into GN2 with
+
+: ./bin/genenetwork2 $HOME/my_settings.py
+
+and everything *should* work (note the full path to the settings
+file). This way we develop against the exact same dependency graph of
+software.
+
+If something is not working, take a hint from the settings file
+that comes in the Guix installation. It sits in something like
+
+: cat ~/.guix-profile/lib/python2.7/site-packages/genenetwork2-2.0-py2.7.egg/etc/default_settings.py
+
+** Set up nginx port forwarding
+
+nginx can be used as a reverse proxy for GN2. For example, we want to
+expose GN2 on port 80 while it is running on port 5003. Essentially
+the configuration looks like
+
+#+begin_src js
+    server {
+        listen 80;
+        server_name test-gn2.genenetwork.org;
+        access_log  logs/test-gn2.access.log;
+
+        proxy_connect_timeout       3000;
+        proxy_send_timeout          3000;
+        proxy_read_timeout          3000;
+        send_timeout                3000;
+
+        location / {
+            proxy_set_header   Host      $http_host;
+            proxy_set_header   Connection keep-alive;
+            proxy_set_header   X-Real-IP $remote_addr;
+            proxy_set_header   X-Forwarded-For $proxy_add_x_forwarded_for;
+            proxy_set_header   X-Forwarded-Host $server_name;
+            proxy_pass         http://127.0.0.1:5003;
+        }
+}
+#+end_src js
+
+Install the nginx webserver (as root)
+
+: guix package -i nginx
+
+The nginx example configuration examples can be found in the Guix
+store through
+
+: ls -l /root/.guix-profile/sbin/nginx
+: lrwxrwxrwx 3 root guixbuild 66 Dec 31  1969 /root/.guix-profile/sbin/nginx -> /gnu/store/g0wrcl5z27rmk5b52rldzvk1bzzbnz2l-nginx-1.8.1/sbin/nginx
+
+Use that path
+
+: ls /gnu/store/g0wrcl5z27rmk5b52rldzvk1bzzbnz2l-nginx-1.8.1/share/nginx/conf/
+:   fastcgi.conf            koi-win             scgi_params
+:   fastcgi.conf.default    mime.types          scgi_params.default
+:   fastcgi_params          mime.types.default  uwsgi_params
+:   fastcgi_params.default  nginx.conf          uwsgi_params.default
+:   koi-utf                 nginx.conf.default  win-utf
+
+And copy any relevant files to /etc/nginx.  A configuration file for
+GeneNetwork (reverse proxy) port forwarding can be found in the source
+repository under ./etc/nginx-genenetwork.conf. Copy this file to /etc
+(still as root)
+: cp ./etc/nginx-genenetwork.conf /etc/nginx/
+
+Make dirs
+
+: mkdir -p /var/spool/nginx/logs
+
+Add users
+
+: adduser nobody ; addgroup nobody 
+
+Run nginx
+
+: /root/.guix-profile/sbin/nginx -c /etc/nginx/nginx-genenetwork.conf -p /var/spool/nginx
+
+* Source deployment and other information on reproducibility
+
+See the document [[GUIX-Reproducible-from-source.org]].
+
+** Update to recent guix
+
+We now compile Guix from scratch.
+
+Create, install and run a recent version of the guix-daemon by
+compiling the guix repository you have installed with git in
+step 2. Follow [[https://github.com/pjotrp/guix-notes/blob/master/INSTALL.org#building-gnu-guix-from-source-using-guix][these]] steps carefully after
+
+: cd ~/genenetwork/guix-gn-latest
+
+Make sure to restart the guix daemon and run guix client from this
+directory.
+
+** Install GN2
+
+Reinstall genenetwork2 using the new tree
+
+#+begin_src bash
+env GUIX_PACKAGE_PATH=~/genenetwork/guix-bioinformatics/ ./pre-inst-env guix package -i genenetwork2 --substitute-urls="http://guix.genenetwork.org:8080 https://mirror.guixsd.org"
+#+end_src bash
+
+Note the use of ./pre-inst-env here!
+
+Actually, it should be the same installation as in step 4, so nothing
+gets downloaded.
+
+** Run GN2
+
+Make a note of the paths with
+
+#+begin_src bash
+./pre-inst-env guix package --search-paths
+#+end_src bash
+
+After setting the paths for the server
+
+#+begin_src bash
+export PATH=~/.guix-profile/bin:$PATH
+export PYTHONPATH="$HOME/.guix-profile/lib/python2.7/site-packages"
+export R_LIBS_SITE="$HOME/.guix-profile/site-library/"
+export GUIX_GTK3_PATH="$HOME/.guix-profile/lib/gtk-3.0"
+export GI_TYPELIB_PATH="$HOME/.guix-profile/lib/girepository-1.0"
+export XDG_DATA_DIRS="$HOME/.guix-profile/share"
+export GIO_EXTRA_MODULES="$HOME/.guix-profile/lib/gio/modules"
+#+end_src bash
+
+run the main script (in ~/.guix-profile/bin)
+
+#+begin_src bash
+genenetwork2
+#+end_src bash
+
+will start the default server which listens on port 5003, i.e.,
+http://localhost:5003/.
+
+OK, we are where we were before with step 4. Only difference is that we 
+used our own compiled guix server.
+
+* Trouble shooting
+
+** ImportError: No module named jinja2
+
+If you have all the Guix packages installed this error points out that
+the environment variables are not set. Copy-paste the paths into your
+terminal (mainly so PYTHON_PATH and R_LIBS_SITE are set) from the
+information given by guix:
+
+: guix package --search-paths
+
+On one system:
+
+: export PYTHONPATH="$HOME/.guix-profile/lib/python2.7/site-packages"
+: export R_LIBS_SITE="$HOME/.guix-profile/site-library/"
+: export GEM_PATH="$HOME/.guix-profile/lib/ruby/gems/2.2.0"
+
+and perhaps a few more. 
+** ERROR: can not find directory $HOME/gn2_data
+
+The default settings file looks in your $HOME/gn2_data. Since these
+files come with a Guix installation you should take a hint from the
+values in the installed version of default_settings.py (see above in
+this document).
+
+** Can't run a module
+
+In rare cases, development modules are not brought in with Guix
+because no source code is available. This can lead to missing modules
+on a running server. Please check with the authors when a module
+is missing.
+* IRC session
+
+Here an IRC session where we installed GN2 from scratch using GNU Guix
+and a download of the test database.
+
+#+begin_src
+<pjotrp> time to get binary install sorted :)  [07:03]
+<pjotrp> Guix is designed for distributed installation servers
+<pjotrp> we have one on guix.genenetwork.org
+<pjotrp> it contains all the prebuild packages
+<pjotrp> for GN
+<user01> okay  [07:04]
+<pjotrp> let's step back however  [07:05]
+<pjotrp> I presume the environment is set with all guix package --search-paths
+<pjotrp> right?
+<user01> yep
+<user01> set to the ones in ~/.guix-profile/
+<pjotrp> good, and you are in gn-latest-guix repo  [07:06]
+<user01> yep  [07:07]
+<pjotrp> git log shows 
+
+Author: David Thompson <dthompson2@worcester.edu>
+Date:   Sun Mar 27 21:20:19 2016 -0400
+
+<user01> yes
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+         package -A genenetwork2  [07:08]
+<pjotrp> shows
+
+genenetwork2    2.0-a8fcff4     out ../guix-bioinformatics/gn/packages/genenetwork.scm:144:2
+genenetwork2-database-small     1.0     out ../guix-bioinformatics/gn/packages/genenetwork.scm:270:4
+genenetwork2-files-small        1.0     out ../guix-bioinformatics/gn/packages/genenetwork.scm:228:4
+
+<user01> yeah  [07:09]
+<pjotrp> OK, we are in sync. This means we should be able to install the exact
+         same software
+<pjotrp> I need to start up my guix daemon - I usually run it in a screen
+<pjotrp> screen -S guix-daemon
+<user01> hah, I don't have screen installed yet  [07:11]
+<pjotrp> comes with guix ;)  [07:12]
+<pjotrp> no worries, you can run it any way you want
+<pjotrp> $HOME/.guix-profile/bin/guix-daemon --build-users-group=guixbuild 
+<user01> then something's weird, because it says I don't have it
+<pjotrp> oh, you need to install it first  [07:13]
+<pjotrp> guix package -A screen
+<pjotrp> screen  4.3.1   out     gnu/packages/screen.scm:34:2
+<pjotrp> but you can skip this install, for now
+<user01> alright  [07:14]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+         package -i genenetwork2 --dry-run
+<pjotrp> substitute: updating list of substitutes from
+         'https://mirror.hydra.gnu.org'...  79.1%
+<pjotrp> you see that?
+<pjotrp> followed by  [07:15]
+substitute: updating list of substitutes from
+'https://hydra.gnu.org'... 100.0%
+The following derivations would be built:
+   /gnu/store/rk7nw0rjqqsha958m649wrykadx6mmhl-profile.drv
+
+/gnu/store/7b0qjybvfx8syzvfs7p5rdablwhbkbvs-module-import-compiled.drv
+   /gnu/store/cy9zahbbf23d3cqyy404lk9f50z192kp-module-import.drv
+   /gnu/store/ibdn603i8grf0jziy5gjsly34wx82lmk-gtk-icon-themes.drv
+
+<pjotrp> which should have the same HASH values /gnu/store/7b0qjybvf... etc.
+                                                                        [07:16]
+<user01> profile has a different hash
+<pjotrp> but the next ones?
+<user01> they're the same
+<pjotrp> not sure why profile differs. Do you see the contact with
+         mirror.hydra.org?  [07:17]
+<user01> yeah
+<pjotrp> OK, that means you set the key correctly for that one :)
+<pjotrp> alright we are at the same state now. You can see most packages need
+         to be rebuild because they are no longer cached as binaries on hydra
+                                                                        [07:18]
+<pjotrp> things move fast...
+<user01> hehe
+<pjotrp> let me also do the same on my laptop - which I have staged before
+                                                                        [07:19]
+<pjotrp> btw, to set the path I often do  [07:20]
+<pjotrp> export
+         PATH="/home/wrk/.guix-profile/bin:/home/wrk/.guix-profile/sbin":$PATH
+<pjotrp> to keep things like 'screen' from Debian
+<pjotrp> Once past building guix itself that is normally OK  [07:21]
+<user01> ah, okay
+<user01> will do that
+<pjotrp> the guix build requires certain versions of tools, so you don't want
+         to mix foreign tools in  [07:23]
+<user01> makes sense  [07:24]
+<pjotrp> On my laptop I am trying the main updating list of substitutes from
+         'http://hydra.gnu.org'...  10.5%  [07:27]
+<pjotrp> it is a bit slow, but let's see if there is a difference with the
+         mirror
+<pjotrp> you can see there are two servers here. Actually with recent daemons,
+         if the mirror fails it will try the main server  [07:28]
+<pjotrp> I documented the use of a caching server here  [07:29]
+<pjotrp> https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org
+<pjotrp> this is exactly what we are doing now
+<user01> alrighty  [07:35]
+<pjotrp> To see if a remote server has a guix server running it should respond 
+                                                                        [07:36]
+<pjotrp> lynx http://guix.genenetwork.org:8080 --dump
+<pjotrp> Resource not found: /
+<pjotrp> 
+<pjotrp> you see that?
+<user01> yes  [07:37]
+<pjotrp> good. The main hydra server is too slow. So on my laptop I forced
+         using the mirror with  [07:38]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics/ ./pre-inst-env guix
+         package -i genenetwork2 --dry-run
+         --substitute-urls="http://mirror.hydra.gnu.org"
+<pjotrp> 
+<pjotrp> the list looks the same to me  [07:40]
+<user01> me too
+<pjotrp> note that some packages will be built and some downloaded, right?
+                                                                        [07:41]
+<user01> yes
+<pjotrp> atlas is actually a binary on my system  [07:43]
+<pjotrp> I mean in that list
+<pjotrp> so, it should not build. Same as yours?
+<user01> yeah, atlas and r-gtable are the ones to be downloaded
+<pjotrp> You should not have seen that error ;)
+<pjotrp> we should try and install it this way, try  [07:44]
+<pjotrp>  env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+         package -i genenetwork2 --cores=4 --max-jobs=4 --keep-going  [07:46]
+<pjotrp> set CPUs and max-jobs to something sensible
+<pjotrp> Does your VM have multiple cores?
+<pjotrp> note you can always press Ctrl-C during install
+<user01> it doesn't, I'll reboot it and give it another core  [07:47]
+<user02> Hey  [07:48]
+<user02> I'm here
+<user02> Will be stepping away for some breakfast
+<pjotrp> Can you do the same as us
+<pjotrp> Can you see the irc log
+<user02> Alright
+<user02> Yes, I can
+<user02> Please email me a copy in five minutes
+<pjotrp> user01: so when I use the GN server  [07:56]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+         package -i genenetwork2 --dry-run
+         --substitute-urls=http://guix.genenetwork.org:8080
+<pjotrp> I don't need to build anything  [07:57]
+<pjotrp> (this won't work for you, yet)
+<pjotrp> to get it to work you need to 'trust' it   [07:58]
+<pjotrp> but, first get the build going
+<pjotrp> I'll have a coffee while you and get building
+<user01> yeah it's doing its thing now  [08:01]
+<pjotrp> cool  [08:02]
+<pjotrp> in a separate terminal you can try and install with the gn mirror
+                                                                        [08:05]
+<pjotrp> I'll  send you the public key and you can paste it as said
+         https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org
+                                                                        [08:06]
+<user01> alright
+<pjotrp> should be in the E-mail  [08:09]
+<pjotrp> getting it working it kinda nasty since the server gives no feedback
+<pjotrp> it works when you see no more in the build list ;)  [08:11]
+<pjotrp> btw, you can install software in parallel. Guix does that.
+<pjotrp> even the same packages
+<pjotrp> so keep building ;)
+<pjotrp> try and do this with Debian...
+<pjotrp> coffee for me  [08:12]
+<user01> the first build failed                                                                        [08:15]
+<pjotrp> OK, Dennis fixed that one yesterday  [08:27]
+<pjotrp> the problem is that sometime source tarballs disappear  [08:28]
+<pjotrp> R is notorious for that
+<user01> haha, that's inconvenient..
+<pjotrp> well, it is good that Guix catches them
+<pjotrp> but we do not cache sources
+<pjotrp> binaries are cached - to some degree - so we don't have to rebuild
+         those  [08:29]
+<pjotrp> time to use the guix cache at guix.genenetwork.org
+<pjotrp> try and install the key (it is in the E-mail)
+<pjotrp> and see what this lists  [08:31]
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics ./pre-inst-env guix
+         package -i genenetwork2
+         --substitute-urls=http://guix.genenetwork.org:8080 --dry-run
+<pjotrp> should be all binary installs
+<user01> it's not..  [08:32]
+<user01> if I remove --substitute-urls, the list changes, does that mean I
+             have the key set up correctly at least?  [08:33]
+<pjotrp> dunno  [08:35]
+<pjotrp> how many packages does it want to build?
+<pjotrp> should be zero
+<user01> four
+<pjotrp> Ah, that is OK - those are default profile things
+<user01> genenetwork2 is among the ones to be downloaded so  [08:36]
+<pjotrp> remove --dry-run
+<pjotrp> yeah, good sign :)
+<pjotrp> we'll still hit a snag, but run it
+<pjotrp> should be fast
+<user01> doing it  [08:37]
+<user01> it worked!  [08:38]
+<user01> I think  [08:39]
+<pjotrp> heh  [08:40]
+<pjotrp> you mean it is finished?
+<user01> yep
+<pjotrp> type genenetwork2
+<user01> complains about not being able to connect to the database  [08:41]
+<pjotrp> last snag :)
+<pjotrp> no database
+<pjotrp> well, we succeeded in installing a same-byte install of a very
+         complex system :)  [08:42]
+<pjotrp> (always take time to congratulate yourself)
+<pjotrp> now we need to install mysql
+<user01> hehe :)
+<pjotrp> this can be done throug guix or through debian  [08:43]
+<pjotrp> the latter is a bit easier here, so let's do that
+<pjotrp> fun note: you can mix debian and guix
+<pjotrp> Follow instructions on   [08:44]
+<pjotrp>
+         https://github.com/genenetwork/genenetwork2/tree/staging/doc#run-mysql-server
+<pjotrp> apt-get install mysql-common  [08:45]
+<pjotrp> may do it
+<pjotrp> You can also install with guix, but I need to document that
+<pjotrp> btw your internet must be fast :)  [08:46]
+<user01> hehe it is ;)
+<pjotrp> when the database is installed  [08:48]
+<pjotrp> be sure to set the password as instructed  [08:50]
+<pjotrp> when mysql is set the genenetwork2 command should fire up the web
+         server on localhost:5003  [08:58]
+<pjotrp> btw my internet is way slower :)  [09:00]
+<user02> I'm back  [09:04]
+<user02> fixed router firmware upgrade problem
+<user02> unbricking
+<pjotrp> tssk  [09:07]
+<user02> I'll never leave routers to update themselves again  [09:08]
+<user02> self-brick highway
+<user02> Resuming  [09:09]
+<pjotrp> auto-updates are evil
+<pjotrp> always switch them off
+<pjotrp> user02: can you install genenetwork like user has done?  [09:10]
+<pjotrp> pretty well documented here now :)
+<user02> Yes I can  [09:11]
+<user02> Already installed key
+<pjotrp> user02: you are getting binary packages only now?  [09:13]
+<user02> That's the sanest way to go now
+<user02> seriously
+<pjotrp> everything should be pre-built from guix.genenetwork.org
+<pjotrp> you are downloading?
+<user02> yes  [09:15]
+<pjotrp> cool. Maybe an idea to set up a server 
+<pjotrp> for your own use
+<user02> Stuck at downloading preprocesscore
+<pjotrp> should not  [09:24]
+<pjotrp> what does env GUIX_PACKAGE_PATH=../guix-bioinformatics/
+         ./pre-inst-env guix package -i genenetwork2
+         --substitute-urls="http://guix.genenetwork.org:8080" --dry-run
+                                                                        [09:25]
+<pjotrp> say for r-prepocesscore
+<pjotrp> download or build?
+<pjotrp> mine says download  [09:26]
+<user02> it only lists the derivatives to be built
+<user02> nothing else happens  [09:27]
+<pjotrp> OK, so there is a problem
+<pjotrp> your key may not be working
+<pjotrp> everything should be listed as 'to be download'  [09:28]
+<user02> Hmm
+<user02> Ah
+<user02> I know where I messed up
+<pjotrp> where?
+<user02> I did add the key
+<user02> However
+<pjotrp> (I am documenting)
+<user02> I did not tell guix to trust it
+<pjotrp> yes
+<pjotrp> and there is another potential problem
+<user02> Remember the documentation on installing guix?
+<user02> You have to tell guix to trust the default key  [09:29]
+<user02> Right?
+<user02> So in this case
+<pjotrp> read the IRC log
+<user02> That step is mandatory
+<pjotrp> user01: how are you doing?
+<pjotrp> user02:
+         https://github.com/pjotrp/guix-notes/blob/master/REPRODUCIBLE.org#using-gnu-guix-archive
+                                                                        [09:30]
+<user01> a little bit left on the db download
+<pjotrp> user02: you should see no more building
+<pjotrp> user02: another issue may be that you updated r-preprocesscore
+         package in guix-buinformatics  [09:32]
+<pjotrp> all downstream packages will want to rebuild
+<user02> no, not really
+<user02> It's not even installed
+<pjotrp> checkout a branch of the the old version - make sure we are in synch
+<pjotrp> should be at
+         /gnu/store/y1f3r2xs3fhyadd46nd2aqbr2p9qv2ra-r-biocpreprocesscore-1.32.0
+                                                                        [09:33]
+<pjotrp> 
+<user03> pjotrp: Possibly we should use the archive utility of Guix to do
+        deployment to avoid such out-of-sync differences :)  [09:34]
+<pjotrp> maybe. I did not get archive to update profiles properly  [09:37]
+<pjotrp> Also it is good that they get to understand guix
+         this way
+<pjotrp> carved in stone, eh  [09:38]
+<user02> Yeah, all good  [09:39]
+<user02> My mistake was skipping the guix archive part
+<user02> Can we begin with the install?
+<user02> It's telling me of derivatives that will be downloaded  [09:40]
+<user02> So we're good
+<user02> Here goes
+<pjotrp> yeeha  [09:42]
+<user02> pjotrp, where is this guix.genenetwork.org located at?
+<pjotrp> Tennessee
+<user02> It's...it's....sloooooooowwwwwwwwwwwwww
+<pjotrp> not from Europe
+<pjotrp> is it downloading at all?
+<user02> It should be extended
+<user02> Yes...like at 100KB/s  [09:43]
+<user02> tear-jerker
+<user02> Verizon problems
+<user02> who's the host?
+<pjotrp> I am getting 500Kb/s
+<pjotrp> UT
+<user02> Guix's servers can run off more than one server, right?
+<user02> I'd like to host that particular server here
+<user02> For speed
+<pjotrp> yes
+<user02> Sooner or later
+<user02> It will be a necessity  [09:45]
+<pjotrp> exactly what I am doing - this is our server
+<pjotrp> guix.genenetwork.org:8080
+<user02> All done installing  [09:46]
+<pjotrp> what?
+<user02> Now the databases
+<pjotrp> what do you mean by slow exactly?
+<user02> Yes, it's installed
+<pjotrp> can you run genenetwork2
+<user02> setting variables
+<user02> If I try running it now, it will fail as I don't have the DBs  [09:47]
+<pjotrp> cool - you had a lot of prebuilt packages already
+<pjotrp> OK, follow the instructions I wrote above
+<user01> now everything seems to be working for me :)
+<user02> OK
+<pjotrp> user01: excellent!
+<pjotrp> you see a webserver?
+<user01> yep, can connect to localhost:5003  [09:48]
+<pjotrp> So now you are running a guix copy of GN2
+<pjotrp> you can see where it lives with `which genenetwork2` or ls -l
+         ~/.guix-profile/bin/genenetwork2  [09:49]
+<pjotrp>
+         /gnu/store/1kma5xszvzsvmbb4k699h7gvdncw901i-genenetwork2-2.0-a8fcff4/bin/genenetwork2
+<pjotrp> it is a script
+<pjotrp> written by guix, open it  [09:50]
+<pjotrp> inside it points to paths and our script at
+<pjotrp>
+         /gnu/store/1kma5xszvzsvmbb4k699h7gvdncw901i-genenetwork2-2.0-a8fcff4/bin/.genenetwork2-real
+<pjotrp> if you open that you can see how the webserver is started  [09:51]
+<pjotrp> next step is to run a recent version of GN2
+<user01> okay  [09:52]
+<pjotrp> See
+         https://github.com/genenetwork/genenetwork2/tree/staging/doc#run-your-own-copy-of-gn2
+<pjotrp> but do not checkout that genetwork2_diet
+<pjotrp> we reverted to the main tree
+<pjotrp> clone git@github.com:genenetwork/genenetwork2.git  [09:53]
+<pjotrp> instead and checkout the staging branch 
+<pjotrp> that is effectively my branch  [09:54]
+<pjotrp> when that is done you should be able to fire up the webserver from
+         there  [09:55]
+<pjotrp> using ./bin/genenetwork2
+<user02> now installing DBs
+<user02> Downloading
+<pjotrp> annoyingly the source tree is ~700Mb  [09:56]
+<user02> Can it also be done by installing the guix package
+         genenetwork2-database-small?
+<pjotrp> I changed it in the diet version to 8Mb, but I had to revert
+<user01> I need to make my VM bigger...
+<pjotrp> user02: not ready  [09:57]
+<user02> ok
+<pjotrp> user01: sorry
+<pjotrp> user01: you could mount a local dir inside the VM for development
+<pjotrp> that would allow you to use MAC tools for editing
+<pjotrp> just an idea
+<user01> yeah, I figure I'll do something like that
+<pjotrp> do you use emacs?  [09:58]
+<user01> yep
+<pjotrp> that can also run on remote files over ssh
+<pjotrp> that's an alternative
+<pjotrp> kudos for using emacs :), wdyt user03 
+<user02> 79 minutes to go downloading the db
+<pjotrp> user02: sorry about that  [09:59]
+<pjotrp> it is 2GB
+<user02> user, you can also mount the directory via sshfs
+<user02> Mac OSX runs OpenSSH
+<pjotrp> user02: sopa
+<user02> You can therefore mount a directory outside the VM to the VM via
+         sshfs  [10:00]
+<pjotrp> yes, 3 options now
+<user02> That way, you can set up a VM only for it's logic
+<user02> Apps + the OS it runs  [10:01]
+<user02> For data, let it reside on physical host accessible via sshfs
+<user02> Use this Arch wiki reference:
+         https://wiki.archlinux.org/index.php/SSHFS
+<user02> I edited that last somewhere in 2015, may have been updated since
+         then
+<user01> alright, cool!  [10:04]
+<pjotrp> user01: you are almost done  [10:06]
+<pjotrp> I wrote an elixir package for guix :)
+<pjotrp> env GUIX_PACKAGE_PATH=../guix-bioinformatics/ ./pre-inst-env guix
+         package -A elixir
+         --substitute-urls="http://guix.genenetwork.org:8080"   [10:08]
+<pjotrp> elixir  1.2.3   out
+         ../guix-bioinformatics/gn/packages/elixir.scm:31:2
+<pjotrp> 
+<pjotrp> I am building it on guix.genenetwork.org right now  [10:09]
+<user01> nice  [10:10]
 #+end_src
diff --git a/doc/database.org b/doc/database.org
new file mode 100644
index 00000000..2221c4fb
--- /dev/null
+++ b/doc/database.org
@@ -0,0 +1,869 @@
+- github Document reduction issue
+
+* The small test database (2GB)
+
+The default install comes with a smaller database which includes a
+number of the BSD's and the Human liver dataset (GSE9588).
+
+* GeneNetwork database
+
+** Estimated table sizes 
+
+
+select table_name,round(((data_length + index_length) / 1024 / 1024), 2) `Size in MB` from information_schema.TABLES where table_schema = "db_webqtl" order by data_length;
+
++-------------------------+------------+
+| table_name              | Size in MB |
++-------------------------+------------+
+| ProbeSetData            |   59358.80 |
+| SnpAll                  |   15484.67 |
+| ProbeData               |   22405.44 |
+| SnpPattern              |    9177.05 |
+| ProbeSetSE              |   14551.02 |
+| QuickSearch             |    5972.86 |
+| ProbeSetXRef            |    4532.89 |
+| LCorrRamin3             |   18506.53 |
+| ProbeSE                 |    6263.83 |
+| ProbeSet                |    2880.21 |
+| Probe                   |    2150.30 |
+| GenoData                |    3291.91 |
+| CeleraINFO_mm6          |     989.80 |
+| pubmedsearch            |    1032.50 |
+| ProbeXRef               |     743.38 |
+| GeneRIF_BASIC           |     448.54 |
+| BXDSnpPosition          |     224.44 |
+| EnsemblProbe            |     133.66 |
+| EnsemblProbeLocation    |     105.49 |
+| Genbank                 |      37.71 |
+| TissueProbeSetData      |      74.42 |
+| AccessLog               |      42.38 |
+| GeneList                |      34.11 |
+| Geno                    |      33.90 |
+| MachineAccessLog        |      28.34 |
+| IndelAll                |      22.42 |
+| PublishData             |      22.54 |
+| TissueProbeSetXRef      |      14.73 |
+| ProbeH2                 |      13.26 |
+| GenoXRef                |      22.83 |
+| TempData                |       8.35 |
+| GeneList_rn3            |       5.54 |
+| GORef                   |       4.97 |
+| Phenotype               |       6.50 |
+| temporary               |       3.59 |
+| InfoFiles               |       3.32 |
+| Publication             |       3.42 |
+| Homologene              |       5.69 |
+| Datasets                |       2.31 |
+| GeneList_rn33           |       2.61 |
+| PublishSE               |       4.71 |
+| GeneRIF                 |       2.18 |
+| Vlookup                 |       1.87 |
+| H2                      |       2.18 |
+| PublishXRef             |       2.18 |
+| NStrain                 |       4.80 |
+| IndelXRef               |       2.91 |
+| Strain                  |       1.07 |
+| GeneMap_cuiyan          |       0.51 |
+| user_collection         |       0.30 |
+| CaseAttributeXRef       |       0.44 |
+| StrainXRef              |       0.56 |
+| GeneIDXRef              |       0.77 |
+| Docs                    |       0.17 |
+| News                    |       0.17 |
+| ProbeSetFreeze          |       0.22 |
+| GeneRIFXRef             |       0.24 |
+| Sample                  |       0.06 |
+| login                   |       0.06 |
+| user                    |       0.04 |
+| TableFieldAnnotation    |       0.05 |
+| DatasetMapInvestigator  |       0.05 |
+| User                    |       0.04 |
+| ProbeFreeze             |       0.06 |
+| TableComments           |       0.02 |
+| Investigators           |       0.02 |
+| DBList                  |       0.03 |
+| Tissue                  |       0.02 |
+| GeneChip                |       0.01 |
+| GeneCategory            |       0.01 |
+| SampleXRef              |       0.01 |
+| InbredSet               |       0.01 |
+| SnpAllele_to_be_deleted |       0.00 |
+| Organizations           |       0.01 |
+| PublishFreeze           |       0.00 |
+| GenoFreeze              |       0.00 |
+| Chr_Length              |       0.01 |
+| SnpSource               |       0.00 |
+| AvgMethod               |       0.00 |
+| Species                 |       0.00 |
+| Dataset_mbat            |       0.00 |
+| TissueProbeFreeze       |       0.00 |
+| EnsemblChip             |       0.00 |
+| TissueProbeSetFreeze    |       0.01 |
+| UserPrivilege           |       0.00 |
+| CaseAttribute           |       0.00 |
+| MappingMethod           |       0.00 |
+| DBType                  |       0.00 |
+| InfoFilesUser_md5       |       0.00 |
+| GenoCode                |       0.00 |
+| DatasetStatus           |       0.00 |
+| GeneChipEnsemblXRef     |       0.00 |
+| GenoSE                  |       0.00 |
+| user_openids            |       0.00 |
+| roles_users             |       0.00 |
+| role                    |       0.00 |
+| Temp                    |       NULL |
++-------------------------+------------+
+97 rows in set, 1 warning (0.01 sec)
+
+All *Data tables are large
+
+** User access
+
+According to the meta data:
+
+This table tracks access time and IP addresses. Used for logging in
+registered users and tracking cookies.
+
+# GN1 uses access table and GN2 uses user table (true/false?)
+
+ select * from AccessLog limit 5;
++-------+---------------------+----------------+
+| id    | accesstime          | ip_address     |
++-------+---------------------+----------------+
+| 12174 | 2003-10-28 02:17:41 | 130.120.104.71 |
+| 12173 | 2003-10-28 02:16:27 | 130.120.104.71 |
+|     3 | 2003-02-22 07:38:33 | 192.117.159.1  |
+|     4 | 2003-02-22 07:49:13 | 192.117.159.1  |
+|     5 | 2003-02-22 07:51:08 | 192.117.159.1  |
++-------+---------------------+----------------+
+
+select * from AccessLog order by accesstime desc limit 5;
++---------+---------------------+---------------+
+| id      | accesstime          | ip_address    |
++---------+---------------------+---------------+
+| 1025735 | 2016-02-08 14:23:29 | 100.43.81.157 |
+| 1025734 | 2016-02-08 13:54:28 | 180.76.15.144 |
+| 1025733 | 2016-02-08 13:43:37 | 66.249.65.217 |
+| 1025732 | 2016-02-08 13:39:50 | 66.249.65.217 |
+| 1025731 | 2016-02-08 13:15:46 | 66.249.65.217 |
++---------+---------------------+---------------+
+
+Quite a few trait page hits:
+
+select count(*) from AccessLog;
+
++----------+
+| count(*) |
++----------+
+|  1025685 |
++----------+
+
+show indexes from AccessLog;
++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| Table     | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| AccessLog |          0 | PRIMARY  |            1 | id          | A         |     1025685 |     NULL | NULL   |      | BTREE      |         |               |
++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+
+This table is being used by both GN1 and GN2 from the trait pages!
+
+: grep -ir AccessLog *|grep -e "^gn1\|^gn2"|grep \.py|grep -v doc
+
+gn1/web/webqtl/showTrait/ShowTraitPage.py:              query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \
+gn1/web/webqtl/showTrait/ShowTraitPage.py:                      self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)" ,user_ip)
+gn1/web/webqtl/textUI/cmdClass.py:                      query = """SELECT count(id) FROM AccessLog WHERE ip_address = %s AND UNIX_TIMESTAMP()-UNIX_TIMESTAMP(accesstime)<86400"""
+gn1/web/webqtl/textUI/cmdClass.py:                      query = """INSERT INTO AccessLog(accesstime,ip_address) values(Now(),%s)""" 
+gn2/wqflask/wqflask/show_trait/show_trait_page.py:        query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \
+gn2/wqflask/wqflask/show_trait/show_trait_page.py:        self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)", user_ip)
+
+When looking at the code in GN1 and GN2 it restricts the daily use of
+the trait data page (set to 1,000 - whoever reaches that?). Unlike
+mentioned in the schema description, this table does *not* keep track
+of cookies. 
+
+From the code it looks like GN2 uses a mixture of Redis and sqlalchemy
+to keep track of logged in sessions (see
+gn2/wqflask/wqflask/user_manager.py) and cookies through a user_uuid in 
+model.py.
+
+In gn2/wqflask/wqflask/templates/collections/view_anonymous.html it
+show_trait_page appears to be loaded (need to check).
+
+** AvgMethod 
+
+Probesetfreeze refers to AvgMethod
+
+** BXDSnPosition
+
+Snp table (all snps)
+
+Mapping in GN1 shows snps when  you select a chromosome.
+
+** CaseAttribute(XRef)
+
+Metadata
+
+** CeleralINFO_mm6
+
+?
+
+** Chr_Length
+
+Default mm9, column for mm8
+
+** Dataset_mbat
+
+Menu for BXD (linkouts)
+
+** DatasetMapInvestigator
+
+Arthur?
+
+** DataSets
+
+Information/metadata
+
+** DatasetStatus
+
+Arthur private/public
+
+** DBList and DBType
+
+Hooked in API (URL encoding)
+
+** Docs
+
+GN2 only (see menu bar)
+
+** Ensembl* 
+
+Probe information
+
+(will be deprecated)
+
+** Genbank
+
+Linkout and not important
+
+** GeneCategory
+
+Not important. GeneWiki notes function classification.
+
+Deprecate.
+
+** GeneChip
+
+** GeneIDXRef
+
+Interspecies gene comparison
+
+** GeneList
+
+Track info
+
+** Genlist_rn3(3)
+
+Rat list
+
+** GeneMap_cuiyan
+
+Link outs
+
+** GeneRIF
+
+Wiki info (nightly updated from NCBI)
+
+XRef should be foreign keys
+
+** Geno
+
+SNP or marker info
+
+** GenoCode
+
+Belongs to someone else
+
+** GenoData
+
+Allele info
+
+** GenoFreeze
+
+Big menu (Freeze refers to menu)
+
+** GenoSE
+
+SE standard err, not used
+
+** GenoXREF
+
+Very important. Key links between Geno, GenoData
+
+** GORef
+
+GO terms
+
+** H2
+
+Heritability for probeset(?)
+
+** Homologene
+
+Homology, not used much
+
+** InbredSet
+
+Group in menu
+
+** Indelall, SnpAll, SnpPattern, SnpSource
+
+Indel Snp browser (variant browser Gn1)
+
+** Info*
+
+Infra system PhP 
+
+Data Info button 
+
+Infosystem users has separate entries
+
+Also Investigators, User, Organizations, 
+
+** LCorrRamin3 
+
+Lit. Correlations Prof. Ramin
+
+** Login
+
+GN2 login info
+
+** MachineAccessLog
+
+Old
+
+** MappingMethod
+
+GN1
+
+** News
+
+GN2
+
+** NStrain
+
+pheno           publishfreeze (menu)
+                       xref (keys)
+                          xref links to publish (pubmed), phenotype, pubishdata
+geno            genofreeze
+                       xref (keys)
+                          xref links to publish (pubmed), genotype, genodata
+probeset/expr.  probesetfreeze
+                       xref (keys)
+                          xref links to publish (pubmed), probeset, probesetdata
+probe/expr.  probefreeze
+                       xref (keys)
+                          xref links to publish (pubmed), probe, probedata
+
+Each dataset has 3 values (real value (1), number of samples (2), stderr (3))
+
+NStrain = number of phenotype samples
+
+ProbesetFreeze contains all data, incl. metabolomic.
+
+** Phenotype
+
+This table contains names, full descriptions, and short symbols for
+traits and phenotype used primarily in the Published Phenotypes
+databases.
+
+Contains 10k rows, March 2016, of which 5000 are for the BXDs). 
+
+| Id | Pre_publication_description | Post_publication_description                                                                                         | Original_description                                                                                                                                        | Units                | Pre_publication_abbreviation | Post_publication_abbreviation | Lab_code | Submitter   | Owner | Authorized_Users |
++----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+
+|  1 | NULL                        | Hippocampus weight                                                                                                   | Original post publication description: Hippocampus weight                                                                                                   | Unknown              | NULL                         | HPCWT                         | NULL     | robwilliams | NULL  | robwilliams      |
+|  2 | NULL                        | Cerebellum weight                                                                                                    | Original post publication description: Cerebellum weight                                                                                                    | mg                   | NULL                         | CBLWT                         | NULL     | robwilliams | NULL  | robwilliams      |
+|  3 | NULL                        | Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide  [units/100 ug protein] | Original post publication description: Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide  [units/100 ug protein] | units/100 ug protein | NULL                         | IL1Activity                   | NULL     | robwilliams | NULL  | robwilliams      |
+|  4 | NULL                        | Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg]                 | Original post publication description: Cerebellum weight [mg]                                                                                               | mg                   | NULL                         | CBLWT2                        | NULL     | robwilliams | NULL  | robwilliams      |
+|  5 | NULL                        | The coat color of 79 BXD RI strain                                                                                   | Original post publication description: The coat color of 79 BXD RI strain                                                                                   | Unknown              | NULL                         | CoatColor                     | NULL     | robwilliams | NULL  | robwilliams      |
++----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+
+5 rows in set (0.00 sec)
+
+** ProbeData
+
+Table with fine-grained probe level Affymetrix data only. Contains 1
+billion rows March 2016. This table may be deletable since it is only
+used by the Probe Table display in GN1. Not used in GN2
+(double-check).
+
+In comparison the "ProbeSetData" table contains more molecular assay
+data, including probe set data, RNA-seq data, proteomic data, and
+metabolomic data. 2.5 billion rows March 2016. In comparison,
+ProbeData contains data only for Affymetrix probe level data
+(e.g. Exon array probes and M430 probes).
+
+"ProbeData.StrainId" should be "CaseId" or "SampleId".
+
+"ProbeData" should probably be "AssayData" or something more neutral.
+
+select * from ProbeData limit 2;
++--------+----------+---------+
+| Id     | StrainId | value   |
++--------+----------+---------+
+| 503636 |       42 | 11.6906 |
+| 503636 |       43 | 11.4205 |
++--------+----------+---------+
+2 rows in set (0.00 sec)
+
+select count(*) from ProbeData limit 2;
++-----------+
+| count(*)  |
++-----------+
+| 976753435 |
++-----------+
+1 row in set (0.00 sec)
+
+** ProbeSet
+
+Comment: PLEASE CHANGE TABLE NAME and rework fields carefully. This is
+a terrible table but it works well (RWW March 2016). It is used in
+combination with the crucial TRAIT DATA and ANALYSIS pages in GN1 and
+GN2. It is also used by annotators using the UPDATE INFO AND DATA web
+form to correct and update annotation. It is used by Arthur to enter
+new annotation files and metadata for arrays, genes, proteins,
+metabolites. The main problem with this table is that it is doing too
+much work.
+
+Initially (2003) this table contained only Affymetrix ProbeSet data
+for mouse (U74aV2 initially). Many other array platforms for different
+species were added. At least four other major categories of molecular
+assays have been added since about 2010.
+
+1. RNA-seq annotation and sequence data for transcripts using ENSEMBL
+   identifiers or NCBI NM_XXXXX and NR_XXXXX type identifiers
+
+2. Protein and peptide annotation and sequence data (see BXD Liver
+   Proteome data, SRM and SWATH type data) with identifiers such as
+   "abcb10_q9ji39_t311" for SRM data and "LLGNMIVIVLGHHLGKDFTPAAQAA"
+   for SWATH data where the latter is just the peptide fragment that
+   has been quantified. Data first entered in 2015 for work by Rudi
+   Aebersold and colleagues.
+
+3. Metabolite annotation and metadata (see BXD Liver Metabolome data)
+   with identifiers that are usually Mass charge ratios such as
+   "149.0970810_MZ"
+
+4. Epigenomic and methylome data (e.g. Human CANDLE Methylation data
+   with identifiers such as "cg24523000")
+
+It would make good sense to break this table into four or more types
+of molecular assay metadata or annotation tables) (AssayRNA_Anno,
+AssayProtein_Anno, AssayMetabolite_Anno, AssayEpigenome_Anno,
+AssayMetagenome_Anno), since these assays will have many differences
+in annotation content compared to RNAs.
+
+Some complex logic is used to update contents of this table when
+annotators modify and correct the information (for example, updating
+gene symbols). These features requested by Rob so that annotating one
+gene symbol in one species would annotate all gene symbols in the same
+species based on common NCBI GeneID number. For example, changing the
+gene alias for one ProbeSet.Id will changing the list of aliases in
+all instances with the same gene symbol.
+
+If the ProbeSet.BlatSeq (or is this ProbSetTargetSeq) is identical
+between different ProbeSet.Ids then annotation is forced to be the
+same even if the symbol or geneID is different. This "feature" was
+implemented when we found many probe sets with identical sequence but
+different annotations and identifiers.
+
+
+select count(*) from ProbeSet limit 5;
++----------+
+| count(*) |
++----------+
+|  4351030 |
++----------+
+
+| Id   | ChipId | Name     | TargetId | Symbol | description                                  | Chr  | Mb        | alias    | GeneId | GenbankId | SNP  | BlatSeq                                                                                                                                                                      | TargetSeq                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             | UniGeneId | Strand_Probe | Strand_Gene | OMIM   | comments | Probe_set_target_region | Probe_set_specificity | Probe_set_BLAT_score | Probe_set_Blat_Mb_start | Probe_set_Blat_Mb_end | Probe_set_strand | Probe_set_Note_by_RW | flag | Symbol_H | description_H | chromosome_H | MB_H | alias_H | GeneId_H | chr_num | name_num | Probe_Target_Description | RefSeq_TranscriptId | Chr_mm8 | Mb_mm8    | Probe_set_Blat_Mb_start_mm8 | Probe_set_Blat_Mb_end_mm8 | HomoloGeneID | Biotype_ENS | ProteinID | ProteinName | Flybase_Id | HMDB_ID | Confidence | ChEBI_ID | ChEMBL_ID | CAS_number | PubChem_ID | ChemSpider_ID | UNII_ID | EC_number | KEGG_ID | Molecular_Weight | Nugowiki_ID | Type | Tissue | PrimaryName | SecondaryNames | PeptideSequence |
++------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+
+| 7282 |      1 | 93288_at | NULL     | Arpc2  | actin related protein 2/3 complex, subunit 2 | 1    | 74.310961 | AK008777 | 76709  | AI835883  |    0 | CCGACTTCCTTAAGGTGCTCAACCGGACTGCTTGCTACTGGATAATCGTGAGGGATTCTCCATTTGGGTTCCATTTTGTACGAGTTTGGCAAATAACCTGCAGAAACGAGCTGTGCTTGCAAGGACTTGATAGTTCCTAATCCTTTTCCAAGCTGTTTGCTTTGCAATATGT | ccgacttccttaaggtgctcaaccgtnnnnnnccnannnnccnagaaaaaagaaatgaaaannnnnnnnnnnnnnnnnnnttcatcccgctaactcttgggaactgaggaggaagcgctgtcgaccgaagnntggactgcttgctactggataatcgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgagggattctccatttgggttccattttgtacgagtttggcaaataacctgcagaaacgagctgtgcttgcaaggacttgatagttcctaagaattanaanaaaaaaaanaanttccacttgatcaanttaattcccttttatttttcctccctcantccccttccttttccaagctgtttgctttgcaatatgt                                                                                                                                                                                                                                     | Mm.337038 | +            |             | 604224 |          | NULL                    |                  8.45 |                  169 |               74.310961 |              74.31466 | NULL             | NULL                 | 3    | NULL     | NULL          | NULL         | NULL | NULL    | NULL     |       1 |    93288 | NULL                     | XM_129773           | 1       | 74.197594 |                   74.197594 |                 74.201293 | 4187         | NULL        | NULL      | NULL        | NULL       | NULL    |       NULL |     NULL | NULL      | NULL       |       NULL |          NULL | NULL    | NULL      | NULL    |             NULL |        NULL | NULL | NULL   | NULL        | NULL           | NULL            |
++------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+
+2 rows in set (0.00 sec)
+
+
+
+** ProbeSetData
+
+Probedata - main molecular data. Probesets, metabolome, 
+
+Almost all important molecular assay data is in this table including
+probe set data, RNA-seq data, proteomic data, and metabolomic
+data. 2.5 billion rows March 2016. In comparison, ProbeData contains
+data only for Affymetrix probe level data (e.g. Exon array probes and
+M430 probes).
+
+select count(*) from ProbeSetData limit 5;
++---------------+
+| count(*)      |
++---------------+
+| 2,510,566,472 |
++---------------+
+
+
+select * from ProbeSetData limit 5;
++----+----------+-------+
+| Id | StrainId | value |
++----+----------+-------+
+|  1 |        1 | 5.742 |
+|  1 |        2 | 5.006 |
+|  1 |        3 | 6.079 |
+|  1 |        4 | 6.414 |
+|  1 |        5 | 4.885 |
++----+----------+-------+
+
+show indexes  from ProbeSetData;
++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| Table        | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| ProbeSetData |          0 | DataId   |            1 | Id          | A         |    34868978 |     NULL | NULL   |      | BTREE      |         |               |
+| ProbeSetData |          0 | DataId   |            2 | StrainId    | A         |  2510566472 |     NULL | NULL   |      | BTREE      |         |               |
++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+
+select * from Strain limit 5;
++----+----------+----------+-----------+--------+-------+
+| Id | Name     | Name2    | SpeciesId | Symbol | Alias |
++----+----------+----------+-----------+--------+-------+
+|  1 | B6D2F1   | B6D2F1   |         1 | NULL   | NULL  |
+|  2 | C57BL/6J | C57BL/6J |         1 | B6J    | NULL  |
+|  3 | DBA/2J   | DBA/2J   |         1 | D2J    | NULL  |
+|  4 | BXD1     | BXD1     |         1 | NULL   | NULL  |
+|  5 | BXD2     | BXD2     |         1 | NULL   | NULL  |
++----+----------+----------+-----------+--------+-------+
+
+show indexes from Strain;
++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| Table  | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+| Strain |          0 | PRIMARY  |            1 | Id          | A         |       14368 |     NULL | NULL   |      | BTREE      |         |               |
+| Strain |          0 | Name     |            1 | Name        | A         |       14368 |     NULL | NULL   | YES  | BTREE      |         |               |
+| Strain |          0 | Name     |            2 | SpeciesId   | A         |       14368 |     NULL | NULL   |      | BTREE      |         |               |
+| Strain |          1 | Symbol   |            1 | Symbol      | A         |       14368 |     NULL | NULL   | YES  | BTREE      |         |               |
++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
+
+A typical query may look like
+
+SELECT Strain.Name, ProbeSetData.value, ProbeSetSE.error, ProbeSetData.Id
+                    FROM (ProbeSetData, ProbeSetFreeze, Strain, ProbeSet, ProbeSetXRef)
+                    left join ProbeSetSE on
+                      (ProbeSetSE.DataId = ProbeSetData.Id AND ProbeSetSE.StrainId = ProbeSetData.StrainId)
+                    WHERE
+                      ProbeSetFreeze.name = 'B139_K_1206_M' AND
+                      ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
+                      ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND
+                      ProbeSetXRef.DataId = ProbeSetData.Id AND
+                      ProbeSetData.StrainId = Strain.Id
+                    Order BY Strain.Name
+
++-------+-------+-------+----------+
+| Name  | value | error | Id       |
++-------+-------+-------+----------+
+| SM001 |  38.3 |  NULL | 25309550 |
+| SM001 |   2.7 |  NULL | 25309520 |
+| SM001 |  20.3 |  NULL | 25309507 |
+| SM001 | 125.8 |  NULL | 25309511 |
+| SM001 |   8.2 |  NULL | 25309534 |
++-------+-------+-------+----------+
+5 rows in set (22.28 sec)
+
+select * from ProbeSetFreeze limit 5;
++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
+| Id | ProbeFreezeId | AvgID | Name        | Name2                           | FullName                                    | ShortName               | CreateTime | OrderList | public | confidentiality | AuthorisedUsers | DataScale |
++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
+|  1 |             3 |     1 | Br_U_0803_M | BXDMicroArray_ProbeSet_August03 | UTHSC Brain mRNA U74Av2 (Aug03) MAS5        | Brain U74Av2 08/03 MAS5 | 2003-08-01 |      NULL |      0 |               0 | NULL            | log2      |
+|  2 |            10 |     1 | Br_U_0603_M | BXDMicroArray_ProbeSet_June03   | UTHSC Brain mRNA U74Av2 (Jun03) MAS5        | Brain U74Av2 06/03 MAS5 | 2003-06-01 |      NULL |      0 |               0 | NULL            | log2      |
+|  3 |             8 |     1 | Br_U_0303_M | BXDMicroArray_ProbeSet_March03  | UTHSC Brain mRNA U74Av2 (Mar03) MAS5        | Brain U74Av2 03/03 MAS5 | 2003-03-01 |      NULL |      0 |               0 | NULL            | log2      |
+|  4 |             5 |     1 | Br_U_0503_M | BXDMicroArray_ProbeSet_May03    | UTHSC Brain mRNA U74Av2 (May03) MAS5        | Brain U74Av2 05/03 MAS5 | 2003-05-01 |      NULL |      0 |               0 | NULL            | log2      |
+|  5 |             4 |     1 | HC_U_0303_M | GNFMicroArray_ProbeSet_March03  | GNF Hematopoietic Cells U74Av2 (Mar03) MAS5 | GNF U74Av2 03/03 MAS5   | 2003-03-01 |      NULL |      0 |               0 | NULL            | log2      |
++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
+
+ select * from ProbeSetXRef limit 5;
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old  | LRS_old            | pValue_old | mean              | se                  | Locus           | LRS                | pValue | additive             | h2   |
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+|                1 |          1 |      1 | 10.095.400 |   13.3971627898894 |      0.163 |  5.48794285714286 | 0.08525787814808819 | rs13480619      | 12.590069931048001 |  0.269 |          -0.28515625 | NULL |
+|                1 |          2 |      2 | D15Mit189  | 10.042057464356201 |      0.431 |  9.90165714285714 |  0.0374686634976217 | CEL-17_50896182 |   10.5970737900941 |  0.304 | -0.11678333333333299 | NULL |
+|                1 |          3 |      3 | D5Mit139   |   5.43678531742749 |      0.993 |  7.83948571428571 |  0.0457583416912569 | rs13478499      |    6.0970532702754 |  0.988 |    0.112957489878542 | NULL |
+|                1 |          4 |      4 | D1Mit511   |   9.87815279480766 |      0.483 | 8.315628571428569 |  0.0470396593931327 | rs6154379       | 11.774867551173099 |  0.286 |   -0.157113725490196 | NULL |
+|                1 |          5 |      5 | D16H21S16  | 10.191723834264499 |      0.528 |  9.19345714285714 |  0.0354801718293322 | rs4199265       | 10.923263374016202 |  0.468 |  0.11476470588235299 | NULL |
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+
+
+Note that the following unlimited search is very slow:
+
+select max(value) from ProbeSetData; 
+
++------------+
+| max(value) |
++------------+
+|   26436006 |
++------------+
+1 row in set (2 min 16.31 sec)
+
+which is in some form is used in the search page, see [[https://github.com/genenetwork/genenetwork2_diet/blob/master/wqflask/wqflask/do_search.py#L811][the search code]].
+
+
+*** Improvements?
+
+Suggestions on the schema page:
+
+"StrainId" should be "CaseId" or "SampleId".
+
+"ProbeSetData" should probably be "AssayData" or something more neutral. 
+
+*** Comments
+
+I think the ProbeSetData table should be generalized to a 'phenotypes'
+table with an 'sample_id' column and a 'value' column. 
+
+A new table 'samples' will link each sample against an 'experiment',
+an 'individual' and which in turn can link to a 'strain'.
+
+Experiment is here in a wide sense, GTex can be one - I don't want to
+use dataset ;)
+
+This means a (slight) reordering:
+
+phenotypes:  (id), sample_id, value
+samples:     experiment_id, individual_id
+experiments: name, version
+individual:  strain_id
+strains:     species_id
+species:     ...
+
+ProbeData is also interesting, because it has the same structure as
+ProbeSetData, but only contains microarrays. This tables should be one
+(when we clear up the cross-referencing) as they both contain
+phenotype values. Both are large tables.
+
+PublishData is another phenotype table with values only which can be
+merged into that same table.
+
+So we have phenotype data in 3 tables with exactly the same
+layout. There is also TissueProbeSet*, but we'll ignore those for
+now. I think we should merge these into one and have the sample ref
+refer to the type of data (probeset, probe, metabolomics,
+whatever). These are all phenotype values and by having them split
+into different tables they won't play well when looking for
+correlations.
+
+ProbeSet contains the metadata on the probes and should (eventually)
+move into NoSQL. There is plenty redundancy in that table now.
+
+I know it is going to be a pain to reorganize the database, but if we
+want to use it in the long run we are going to have to simplify it.
+
+
+
+** Publication and publishdata (all pheno)
+
+Phenotype pubs
+
+** QuickSearch
+
+No longer used
+
+** role
+
+empty
+
+** Sample*
+
+No longer used
+
+** Species & Strain (should be sample)
+
+select * from Species;
++----+-----------+----------------------+----------------+----------------------+-------------------------+------------+---------+
+| Id | SpeciesId | SpeciesName          | Name           | MenuName             | FullName                | TaxonomyId | OrderId |
++----+-----------+----------------------+----------------+----------------------+-------------------------+------------+---------+
+|  1 |         1 | Mouse                | mouse          | Mouse                | Mus musculus            |      10090 |      30 |
+|  2 |         2 | Rat                  | rat            | Rat                  | Rattus norvegicus       |      10116 |      40 |
+|  3 |         3 | Arabidopsis thaliana | arabidopsis    | Arabidopsis thaliana | Arabidopsis thaliana    |       3702 |      60 |
+|  4 |         4 | Human                | human          | Human                | Homo sapiens            |       9606 |      10 |
+|  5 |         5 | Barley               | barley         | Barley               | Hordeum vulgare         |       4513 |      70 |
+|  6 |         6 | Drosophila           | drosophila     | Drosophila           | Drosophila melanogaster |       7227 |      50 |
+|  7 |         7 | Macaque monkey       | macaque monkey | Macaque monkey       | Macaca mulatta          |       9544 |      20 |
+|  8 |         8 | Soybean              | soybean        | Soybean              | Soybean                 |       3847 |      80 |
+|  9 |         9 | Tomato               | tomato         | Tomato               | Tomato                  |       4081 |      90 |
++----+-----------+----------------------+----------------+----------------------+-------------------------+------------+---------+
+
+
+** InbredSet 
+
+Menu
+
+** TableComments
+
+Metadata on DB
+
+** Temp*
+
+User upload data
+
+** Tissue
+
+Menu - 3rd level
+
+** TissueP*
+
+Correlation tables
+
+** User collection
+
+User selection - retained
+
+** UserPrivilege
+
+** Vlookup 
+
+* Fetching Data
+
+** Fetch phenotypes
+
+To get at phenotype data ProbeSetData is the main table (almost all
+important molecular assay data is in this table including probe set
+data, RNA-seq data, proteomic data, and metabolomic data. 2.5 billion
+rows March 2016)
+
+select count(*) from ProbeSetData limit 5;
++---------------+
+| count(*)      |
++---------------+
+| 2,510,566,472 |
++---------------+
+
+select * from ProbeSetData limit 5;
++----+----------+-------+
+| Id | StrainId | value |
++----+----------+-------+
+|  1 |        1 | 5.742 |
+|  1 |        2 | 5.006 |
+|  1 |        3 | 6.079 |
+|  1 |        4 | 6.414 |
+|  1 |        5 | 4.885 |
++----+----------+-------+
+
+This table is used in
+
+: wqflask/base/do_search.py
+: wqflask/base/data_set.py
+: wqflask/utility/AJAX_table.py
+: wqflask/wqflask/correlation/show_corr_results.py
+
+In there we find 'ProbeSetData.Id = ProbeSetXRef.dataId'.
+
+select * from ProbeSetXRef limit 5;
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old  | LRS_old            | pValue_old | mean              | se                  | Locus           | LRS                | pValue | additive             | h2   |
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+|                1 |          1 |      1 | 10.095.400 |   13.3971627898894 |      0.163 |  5.48794285714286 | 0.08525787814808819 | rs13480619      | 12.590069931048001 |  0.269 |          -0.28515625 | NULL |
+|                1 |          2 |      2 | D15Mit189  | 10.042057464356201 |      0.431 |  9.90165714285714 |  0.0374686634976217 | CEL-17_50896182 |   10.5970737900941 |  0.304 | -0.11678333333333299 | NULL |
+|                1 |          3 |      3 | D5Mit139   |   5.43678531742749 |      0.993 |  7.83948571428571 |  0.0457583416912569 | rs13478499      |    6.0970532702754 |  0.988 |    0.112957489878542 | NULL |
+|                1 |          4 |      4 | D1Mit511   |   9.87815279480766 |      0.483 | 8.315628571428569 |  0.0470396593931327 | rs6154379       | 11.774867551173099 |  0.286 |   -0.157113725490196 | NULL |
+|                1 |          5 |      5 | D16H21S16  | 10.191723834264499 |      0.528 |  9.19345714285714 |  0.0354801718293322 | rs4199265       | 10.923263374016202 |  0.468 |  0.11476470588235299 | NULL |
++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
+
+i.e., for Strain Id 1 (DataId) 1, the locus '10.095.400' has a
+phenotype value of 5.742.
+
+GeneNetwork1 already has a limited REST interface, if you do
+
+: curl "http://robot.genenetwork.org/webqtl/main.py?cmd=get&probeset=1443823_s_at&db=HC_M2_0606_P"
+
+we get
+
+: ProbeSetID      B6D2F1  C57BL/6J        DBA/2J  BXD1    BXD2    BXD5    BXD6   BXD8     BXD9    BXD11   BXD12   BXD13   BXD15   BXD16   BXD19   BXD20   BXD21  BXD22    BXD23   BXD24   BXD27   BXD28   BXD29   BXD31   BXD32   BXD33   BXD34  BXD38    BXD39   BXD40   BXD42   BXD67   BXD68   BXD43   BXD44   BXD45   BXD48  BXD50    BXD51   BXD55   BXD60   BXD61   BXD62   BXD63   BXD64   BXD65   BXD66  BXD69    BXD70   BXD73   BXD74   BXD75   BXD76   BXD77   BXD79   BXD73a  BXD83  BXD84    BXD85   BXD86   BXD87   BXD89   BXD90   BXD65b  BXD93   BXD94   A/J    AKR/J    C3H/HeJ C57BL/6ByJ      CXB1    CXB2    CXB3    CXB4    CXB5    CXB6   CXB7     CXB8    CXB9    CXB10   CXB11   CXB12   CXB13   BXD48a  129S1/SvImJ    BALB/cJ  BALB/cByJ       LG/J    NOD/ShiLtJ      PWD/PhJ BXD65a  BXD98   BXD99  CAST/EiJ KK/HlJ  WSB/EiJ NZO/HlLtJ       PWK/PhJ D2B6F1
+: 1443823_s_at    15.251  15.626  14.716  15.198  14.918  15.057  15.232  14.968 14.87    15.084  15.192  14.924  15.343  15.226  15.364  15.36   14.792  14.908 15.344   14.948  15.08   15.021  15.176  15.14   14.796  15.443  14.636  14.921 15.22    15.62   14.816  15.39   15.428  14.982  15.05   15.13   14.722  14.636 15.242   15.527  14.825  14.416  15.125  15.362  15.226  15.176  15.328  14.895 15.141   15.634  14.922  14.764  15.122  15.448  15.398  15.089  14.765  15.234 15.302   14.774  14.979  15.212  15.29   15.012  15.041  15.448  14.34   14.338 14.809   15.046  14.816  15.232  14.933  15.255  15.21   14.766  14.8    15.506 15.749   15.274  15.599  15.673  14.651  14.692  14.552  14.563  14.164  14.546 15.044   14.695  15.162  14.772  14.645  15.493  14.75   14.786  15.003  15.148 15.221
+
+getTraitData is defined in the file [[https://github.com/genenetwork/genenetwork/blob/master/web/webqtl/textUI/cmdClass.py#L134][web/webqtl/textUI/cmdClass.py]].
+probe is None, so the code at line 199 is run
+
+query = "SELECT Strain.Name, %sData.value from %sData, Strain, %s,
+%sXRef WHERE %s.Name = '%s' and %sXRef.%sId = %s.Id and
+%sXRef.%sFreezeId = %d and %sXRef.DataId = %sData.Id and
+%sData.StrainId = Strain.Id order by Strain.Id" % (prefix, prefix,
+prefix, prefix, prefix, probeset,prefix, prefix, prefix, prefix,
+prefix, dbId, prefix, prefix, prefix)
+
+where prefix is ProbeSet (one presumes). So, let's see if we can do this by hand
+
+SELECT Strain.Name, ProbeSetData.value from ProbeSetData, Strain, ProbeSet,
+ProbeSetXRef WHERE ProbeSet.Name = '1443823_s_at' and ProbeSetXRef.ProbeSetId = ProbeSet.Id and
+ProbeSetXRef.ProbeSetFreezeId = $dbid and ProbeSetXRef.DataId = ProbeSetData.Id and
+ProbeSetData.StrainId = Strain.Id ORDER BY Strain.Id
+
+The $dbid is listed in the ProbeSetFreeze table,
+
+SELECT ProbeFreezeId,Name FROM ProbeSetFreeze WHERE Name='HC_M2_0606_P' limit 5;
+
++---------------+--------------+
+| ProbeFreezeId | Name         |
++---------------+--------------+
+|            30 | HC_M2_0606_P |
++---------------+--------------+
+
+select id,name from ProbeSet WHERE Name = '1443823_s_at' limit 5;
++--------+--------------+
+| id     | name         |
++--------+--------------+
+| 106556 | 1443823_s_at |
++--------+--------------+
+
+So
+
+query = "SELECT Strain.Name, %sData.value from %sData, Strain, %s,
+%sXRef WHERE %s.Name = '%s' and %sXRef.%sId = %s.Id and
+%sXRef.%sFreezeId = %d and %sXRef.DataId = %sData.Id and
+%sData.StrainId = Strain.Id order by Strain.Id" % (prefix, prefix,
+prefix, prefix, prefix, probeset,prefix, prefix, prefix, prefix,
+prefix, dbId, prefix, prefix, prefix)
+
+CORRECT NAME:
+
+SELECT Strain.Name, ProbeSetData.value from ProbeSetData, Strain,
+ProbeSet, ProbeSetXRef WHERE ProbeSet.Name = 'at_probe' and
+ProbeSetXRef.ProbeSetId = ProbeSet.Id and
+ProbeSetXRef.ProbeSetFreezeId = dbid and ProbeSetXRef.DataId =
+ProbeSetData.Id and ProbeSetData.StrainId = Strain.Id order by
+Strain.Id
+
+
+select * from ProbeSetXRef WHERE probesetfreezeid=30 limit 5;
++------------------+------------+--------+------------+--------------------+------------+--------------------+--------------------+-----------------+--------------------+--------+-------------------+------+
+| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old  | LRS_old            | pValue_old | mean               | se                 | Locus           | LRS                | pValue | additive          | h2   |
++------------------+------------+--------+------------+--------------------+------------+--------------------+--------------------+-----------------+--------------------+--------+-------------------+------+
+|               30 |          1 | 445962 | 01.059.350 | 7.1753152078069595 |      0.961 |            30.0646 |   1.79763935596594 | rs13475891      | 7.1753152078069204 |  0.973 |        4.71778125 | NULL |
+|               30 |          2 | 445963 | D4Mit156   |   7.58944292943285 |      0.724 | 232.38328571428602 |   9.00278909374791 | CEL-4_118751423 |   7.57513435426218 |  0.793 |  25.2660951417004 | NULL |
+|               30 |          3 | 445964 | D1Mit134   |  9.766065497826819 |      0.737 |             47.206 |   1.58413526287766 | mCV23431007     |   9.76606549782677 |  0.797 | -4.82405952380952 | NULL |
+|               30 |          4 | 445965 | D1Mit155   |   18.0045829157241 |      0.033 | 132.29248571428602 |   4.37799472291842 | rs3689947       |   17.9365068406286 |  0.049 |  -16.945619047619 | NULL |
+|               30 |          5 | 445966 | D5Mit197   |   9.51068902627823 |      0.476 |   271.309971428571 | 7.4294268316065395 | rs6239372       |   10.4214974316601 |   0.41 | -25.6148045454546 | NULL |
++------------------+------------+--------+------------+--------------------+------------+--------------------+--------------------+-----------------+--------------------+--------+-------------------+------+
+
+So, apparently ProbeSetFreezeID points to the database identifier in
+ProbeSetFreeze which has the name of the 'DB'. OK, that kinda makes
+sense now. Meanwhile Probeset.name points to the phenotype name.
+
+ProbeSetXRef binds these tables together. Finally there is the data in
+
+select * from ProbeSetData limit 5;
++----+----------+-------+
+| Id | StrainId | value |
++----+----------+-------+
+|  1 |        1 | 5.742 |
+|  1 |        2 | 5.006 |
+|  1 |        3 | 6.079 |
+|  1 |        4 | 6.414 |
+|  1 |        5 | 4.885 |
++----+----------+-------+
+5 rows in set (0.00 sec)
+
+linked by ProbeSetXRef.dataid.
diff --git a/doc/database.svg b/doc/database.svg
new file mode 100644
index 00000000..9ddc2f47
--- /dev/null
+++ b/doc/database.svg
@@ -0,0 +1,882 @@
+<?xml version="1.0" encoding="UTF-8" standalone="no"?>
+<!-- Created with Inkscape (http://www.inkscape.org/) -->
+
+<svg
+   xmlns:dc="http://purl.org/dc/elements/1.1/"
+   xmlns:cc="http://creativecommons.org/ns#"
+   xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
+   xmlns:svg="http://www.w3.org/2000/svg"
+   xmlns="http://www.w3.org/2000/svg"
+   xmlns:sodipodi="http://sodipodi.sourceforge.net/DTD/sodipodi-0.dtd"
+   xmlns:inkscape="http://www.inkscape.org/namespaces/inkscape"
+   width="210mm"
+   height="297mm"
+   viewBox="0 0 744.09448819 1052.3622047"
+   id="svg2"
+   version="1.1"
+   inkscape:version="0.91 r13725"
+   sodipodi:docname="database.svg">
+  <defs
+     id="defs4">
+    <marker
+       inkscape:isstock="true"
+       style="overflow:visible;"
+       id="marker12489"
+       refX="0.0"
+       refY="0.0"
+       orient="auto"
+       inkscape:stockid="Arrow2Mend">
+      <path
+         transform="scale(0.6) rotate(180) translate(0,0)"
+         d="M 8.7185878,4.0337352 L -2.2072895,0.016013256 L 8.7185884,-4.0017078 C 6.9730900,-1.6296469 6.9831476,1.6157441 8.7185878,4.0337352 z "
+         style="fill-rule:evenodd;stroke-width:0.625;stroke-linejoin:round;stroke:#0000d7;stroke-opacity:1;fill:#0000d7;fill-opacity:1"
+         id="path12491" />
+    </marker>
+    <marker
+       inkscape:stockid="Arrow2Lend"
+       orient="auto"
+       refY="0.0"
+       refX="0.0"
+       id="Arrow2Lend"
+       style="overflow:visible;"
+       inkscape:isstock="true">
+      <path
+         id="path4445"
+         style="fill-rule:evenodd;stroke-width:0.62500000;stroke-linejoin:round;"
+         d="M 8.7185878,4.0337352 L -2.2072895,0.016013256 L 8.7185884,-4.0017078 C 6.9730900,-1.6296469 6.9831476,1.6157441 8.7185878,4.0337352 z "
+         transform="scale(1.1) rotate(180) translate(1,0)" />
+    </marker>
+    <marker
+       inkscape:isstock="true"
+       style="overflow:visible;"
+       id="marker11727"
+       refX="0.0"
+       refY="0.0"
+       orient="auto"
+       inkscape:stockid="Arrow2Mend">
+      <path
+         transform="scale(0.6) rotate(180) translate(0,0)"
+         d="M 8.7185878,4.0337352 L -2.2072895,0.016013256 L 8.7185884,-4.0017078 C 6.9730900,-1.6296469 6.9831476,1.6157441 8.7185878,4.0337352 z "
+         style="fill-rule:evenodd;stroke-width:0.625;stroke-linejoin:round;stroke:#0000da;stroke-opacity:1;fill:#0000da;fill-opacity:1"
+         id="path11729" />
+    </marker>
+    <marker
+       inkscape:isstock="true"
+       style="overflow:visible;"
+       id="marker11607"
+       refX="0.0"
+       refY="0.0"
+       orient="auto"
+       inkscape:stockid="Arrow2Lend">
+      <path
+         transform="scale(1.1) rotate(180) translate(1,0)"
+         d="M 8.7185878,4.0337352 L -2.2072895,0.016013256 L 8.7185884,-4.0017078 C 6.9730900,-1.6296469 6.9831476,1.6157441 8.7185878,4.0337352 z "
+         style="fill-rule:evenodd;stroke-width:0.625;stroke-linejoin:round;stroke:#0000da;stroke-opacity:1;fill:#0000da;fill-opacity:1"
+         id="path11609" />
+    </marker>
+    <marker
+       inkscape:stockid="Arrow1Lend"
+       orient="auto"
+       refY="0.0"
+       refX="0.0"
+       id="Arrow1Lend"
+       style="overflow:visible;"
+       inkscape:isstock="true">
+      <path
+         id="path4427"
+         d="M 0.0,0.0 L 5.0,-5.0 L -12.5,0.0 L 5.0,5.0 L 0.0,0.0 z "
+         style="fill-rule:evenodd;stroke:#0000a3;stroke-width:1pt;stroke-opacity:1;fill:#0000a3;fill-opacity:1"
+         transform="scale(0.8) rotate(180) translate(12.5,0)" />
+    </marker>
+    <marker
+       inkscape:stockid="Arrow2Mend"
+       orient="auto"
+       refY="0.0"
+       refX="0.0"
+       id="Arrow2Mend"
+       style="overflow:visible;"
+       inkscape:isstock="true"
+       inkscape:collect="always">
+      <path
+         id="path4451"
+         style="fill-rule:evenodd;stroke-width:0.625;stroke-linejoin:round;stroke:#0000d7;stroke-opacity:1;fill:#0000d7;fill-opacity:1"
+         d="M 8.7185878,4.0337352 L -2.2072895,0.016013256 L 8.7185884,-4.0017078 C 6.9730900,-1.6296469 6.9831476,1.6157441 8.7185878,4.0337352 z "
+         transform="scale(0.6) rotate(180) translate(0,0)" />
+    </marker>
+    <marker
+       inkscape:isstock="true"
+       style="overflow:visible;"
+       id="marker10561"
+       refX="0.0"
+       refY="0.0"
+       orient="auto"
+       inkscape:stockid="Arrow2Mend">
+      <path
+         transform="scale(0.6) rotate(180) translate(0,0)"
+         d="M 8.7185878,4.0337352 L -2.2072895,0.016013256 L 8.7185884,-4.0017078 C 6.9730900,-1.6296469 6.9831476,1.6157441 8.7185878,4.0337352 z "
+         style="fill-rule:evenodd;stroke-width:0.625;stroke-linejoin:round;stroke:#000000;stroke-opacity:1;fill:#000000;fill-opacity:1"
+         id="path10563" />
+    </marker>
+    <marker
+       inkscape:stockid="Arrow2Mstart"
+       orient="auto"
+       refY="0.0"
+       refX="0.0"
+       id="Arrow2Mstart"
+       style="overflow:visible"
+       inkscape:isstock="true">
+      <path
+         id="path4448"
+         style="fill-rule:evenodd;stroke-width:0.625;stroke-linejoin:round;stroke:#0000b1;stroke-opacity:1;fill:#0000b1;fill-opacity:1"
+         d="M 8.7185878,4.0337352 L -2.2072895,0.016013256 L 8.7185884,-4.0017078 C 6.9730900,-1.6296469 6.9831476,1.6157441 8.7185878,4.0337352 z "
+         transform="scale(0.6) translate(0,0)" />
+    </marker>
+    <marker
+       inkscape:stockid="TriangleOutM"
+       orient="auto"
+       refY="0.0"
+       refX="0.0"
+       id="TriangleOutM"
+       style="overflow:visible"
+       inkscape:isstock="true">
+      <path
+         id="path4569"
+         d="M 5.77,0.0 L -2.88,5.0 L -2.88,-5.0 L 5.77,0.0 z "
+         style="fill-rule:evenodd;stroke:#0000b1;stroke-width:1pt;stroke-opacity:1;fill:#0000b1;fill-opacity:1"
+         transform="scale(0.4)" />
+    </marker>
+    <marker
+       inkscape:stockid="Arrow1Lstart"
+       orient="auto"
+       refY="0.0"
+       refX="0.0"
+       id="Arrow1Lstart"
+       style="overflow:visible"
+       inkscape:isstock="true">
+      <path
+         id="path4424"
+         d="M 0.0,0.0 L 5.0,-5.0 L -12.5,0.0 L 5.0,5.0 L 0.0,0.0 z "
+         style="fill-rule:evenodd;stroke:#0000b1;stroke-width:1pt;stroke-opacity:1;fill:#0000b1;fill-opacity:1"
+         transform="scale(0.8) translate(12.5,0)" />
+    </marker>
+    <marker
+       inkscape:stockid="Arrow2Mstart"
+       orient="auto"
+       refY="0"
+       refX="0"
+       id="Arrow2Mstart-5"
+       style="overflow:visible"
+       inkscape:isstock="true">
+      <path
+         inkscape:connector-curvature="0"
+         id="path4448-2"
+         style="fill:#0000b1;fill-opacity:1;fill-rule:evenodd;stroke:#0000b1;stroke-width:0.625;stroke-linejoin:round;stroke-opacity:1"
+         d="M 8.7185878,4.0337352 -2.2072895,0.01601326 8.7185884,-4.0017078 c -1.7454984,2.3720609 -1.7354408,5.6174519 -6e-7,8.035443 z"
+         transform="scale(0.6,0.6)" />
+    </marker>
+    <marker
+       inkscape:stockid="Arrow2Mend"
+       orient="auto"
+       refY="0"
+       refX="0"
+       id="Arrow2Mend-8"
+       style="overflow:visible"
+       inkscape:isstock="true">
+      <path
+         inkscape:connector-curvature="0"
+         id="path4451-9"
+         style="fill:#0000b1;fill-opacity:1;fill-rule:evenodd;stroke:#0000b1;stroke-width:0.625;stroke-linejoin:round;stroke-opacity:1"
+         d="M 8.7185878,4.0337352 -2.2072895,0.01601326 8.7185884,-4.0017078 c -1.7454984,2.3720609 -1.7354408,5.6174519 -6e-7,8.035443 z"
+         transform="scale(-0.6,-0.6)" />
+    </marker>
+    <marker
+       inkscape:isstock="true"
+       style="overflow:visible"
+       id="marker12489-7"
+       refX="0"
+       refY="0"
+       orient="auto"
+       inkscape:stockid="Arrow2Mend">
+      <path
+         inkscape:connector-curvature="0"
+         transform="scale(-0.6,-0.6)"
+         d="M 8.7185878,4.0337352 -2.2072895,0.01601326 8.7185884,-4.0017078 c -1.7454984,2.3720609 -1.7354408,5.6174519 -6e-7,8.035443 z"
+         style="fill:#0000d7;fill-opacity:1;fill-rule:evenodd;stroke:#0000d7;stroke-width:0.625;stroke-linejoin:round;stroke-opacity:1"
+         id="path12491-4" />
+    </marker>
+    <marker
+       inkscape:isstock="true"
+       style="overflow:visible"
+       id="marker12489-7-2"
+       refX="0"
+       refY="0"
+       orient="auto"
+       inkscape:stockid="Arrow2Mend">
+      <path
+         inkscape:connector-curvature="0"
+         transform="scale(-0.6,-0.6)"
+         d="M 8.7185878,4.0337352 -2.2072895,0.01601326 8.7185884,-4.0017078 c -1.7454984,2.3720609 -1.7354408,5.6174519 -6e-7,8.035443 z"
+         style="fill:#0000d7;fill-opacity:1;fill-rule:evenodd;stroke:#0000d7;stroke-width:0.625;stroke-linejoin:round;stroke-opacity:1"
+         id="path12491-4-9" />
+    </marker>
+  </defs>
+  <sodipodi:namedview
+     id="base"
+     pagecolor="#ffffff"
+     bordercolor="#666666"
+     borderopacity="1.0"
+     inkscape:pageopacity="0.0"
+     inkscape:pageshadow="2"
+     inkscape:zoom="0.98994949"
+     inkscape:cx="361.50633"
+     inkscape:cy="527.18241"
+     inkscape:document-units="px"
+     inkscape:current-layer="layer1"
+     showgrid="false"
+     inkscape:window-width="1085"
+     inkscape:window-height="1276"
+     inkscape:window-x="28"
+     inkscape:window-y="142"
+     inkscape:window-maximized="0"
+     inkscape:snap-bbox="false"
+     inkscape:snap-nodes="true">
+    <inkscape:grid
+       type="xygrid"
+       id="grid3355" />
+  </sodipodi:namedview>
+  <metadata
+     id="metadata7">
+    <rdf:RDF>
+      <cc:Work
+         rdf:about="">
+        <dc:format>image/svg+xml</dc:format>
+        <dc:type
+           rdf:resource="http://purl.org/dc/dcmitype/StillImage" />
+        <dc:title />
+      </cc:Work>
+    </rdf:RDF>
+  </metadata>
+  <g
+     inkscape:label="Layer 1"
+     inkscape:groupmode="layer"
+     id="layer1">
+    <rect
+       style="fill:none;fill-rule:evenodd;stroke:#000000;stroke-width:0.46889797px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       id="rect3357"
+       width="174.81682"
+       height="25.531101"
+       x="39.020161"
+       y="85.668076" />
+    <rect
+       style="fill:none"
+       id="rect4159"
+       width="280"
+       height="20"
+       x="40"
+       y="72.362206" />
+    <rect
+       style="fill:none"
+       id="rect4164"
+       width="290"
+       height="20"
+       x="40"
+       y="72.362206" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:100%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1;-inkscape-font-specification:'sans-serif, Normal';font-stretch:normal;font-variant:normal;text-anchor:start;text-align:start;writing-mode:lr;"
+       x="40"
+       y="82.362206"
+       id="text4181"
+       sodipodi:linespacing="100%"><tspan
+         sodipodi:role="line"
+         id="tspan4183"
+         x="40"
+         y="82.362206">ProbesetData</tspan><tspan
+         sodipodi:role="line"
+         x="40"
+         y="107.36221"
+         id="tspan4185" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:20px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="100"
+       y="132.3622"
+       id="text4187"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4189"
+         x="100"
+         y="132.3622" /></text>
+    <rect
+       style="fill:none"
+       id="rect4191"
+       width="80"
+       height="70.000008"
+       x="60"
+       y="92.362206" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1;"
+       x="60"
+       y="102.3622"
+       id="text4208"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4210"
+         x="60"
+         y="102.3622">id</tspan><tspan
+         sodipodi:role="line"
+         x="60"
+         y="127.3622"
+         id="tspan4212" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:100%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1;-inkscape-font-specification:'sans-serif, Normal';font-stretch:normal;font-variant:normal;text-anchor:start;text-align:start;writing-mode:lr;"
+       x="90"
+       y="102.3622"
+       id="text4214"
+       sodipodi:linespacing="100%"><tspan
+         sodipodi:role="line"
+         id="tspan4216"
+         x="90"
+         y="102.3622">strainid</tspan><tspan
+         sodipodi:role="line"
+         x="90"
+         y="127.3622"
+         id="tspan4218" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:20px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="210"
+       y="102.3622"
+       id="text4220"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         x="210"
+         y="102.3622"
+         id="tspan4224" /><tspan
+         sodipodi:role="line"
+         x="210"
+         y="127.3622"
+         id="tspan4228" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="160.71428"
+       y="102.3622"
+       id="text4230"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4232"
+         x="160.71428"
+         y="102.3622">value</tspan><tspan
+         sodipodi:role="line"
+         x="160.71428"
+         y="117.9872"
+         id="tspan4234" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="40"
+       y="162.3622"
+       id="text4236"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4238"
+         x="40"
+         y="162.3622">ProbeSetXRef</tspan><tspan
+         sodipodi:role="line"
+         x="40"
+         y="177.9872"
+         id="tspan4240" /></text>
+    <rect
+       style="fill:none;fill-rule:evenodd;stroke:#000000;stroke-width:0.69999564px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       id="rect3357-3"
+       width="393.15714"
+       height="25.300003"
+       x="39.849991"
+       y="171.49791" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="60"
+       y="182.3622"
+       id="text4257"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4259"
+         x="60"
+         y="182.3622">ProbeSetFreezeId</tspan><tspan
+         sodipodi:role="line"
+         x="60"
+         y="197.9872"
+         id="tspan4261" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="190"
+       y="182.3622"
+       id="text4263"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4265"
+         x="190"
+         y="182.3622">ProbeSetID</tspan><tspan
+         sodipodi:role="line"
+         x="190"
+         y="197.9872"
+         id="tspan4267" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="290"
+       y="182.3622"
+       id="text4269"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4271"
+         x="290"
+         y="182.3622">DataId</tspan><tspan
+         sodipodi:role="line"
+         x="290"
+         y="197.9872"
+         id="tspan4273" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="360"
+       y="182.3622"
+       id="text4275"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4277"
+         x="360"
+         y="182.3622">pValue</tspan><tspan
+         sodipodi:role="line"
+         x="360"
+         y="197.9872"
+         id="tspan4279" /></text>
+    <rect
+       style="fill:none;fill-rule:evenodd;stroke:#000000;stroke-width:0.50748467px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       id="rect3357-6"
+       width="205.08281"
+       height="25.492514"
+       x="249.75372"
+       y="87.830231" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="250"
+       y="82.362206"
+       id="text4296"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         x="250"
+         y="82.362206"
+         id="tspan12343">ProbesetFreeze</tspan><tspan
+         sodipodi:role="line"
+         x="250"
+         y="97.987206"
+         id="tspan4300" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="312.52795"
+       y="102.3622"
+       id="text4302"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         x="312.52795"
+         y="102.3622"
+         id="tspan5260">ProbeFreezeId </tspan><tspan
+         sodipodi:role="line"
+         x="312.52795"
+         y="117.9872"
+         id="tspan4308" /><tspan
+         sodipodi:role="line"
+         x="312.52795"
+         y="133.6122"
+         id="tspan4306" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="404.24365"
+       y="102.3622"
+       id="text4310"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4312"
+         x="404.24365"
+         y="102.3622">Name</tspan><tspan
+         sodipodi:role="line"
+         x="404.24365"
+         y="117.9872"
+         id="tspan4314" /></text>
+    <path
+       style="fill:none"
+       id="path4331"
+       sodipodi:type="arc"
+       sodipodi:cx="415"
+       sodipodi:cy="57.362206"
+       sodipodi:rx="15"
+       sodipodi:ry="15"
+       sodipodi:start="0"
+       sodipodi:end="0.30092023"
+       d="m 430,57.362206 a 15,15 0 0 1 -0.67404,4.445988 L 415,57.362206 Z" />
+    <path
+       style="fill:none"
+       id="path4333"
+       sodipodi:type="arc"
+       sodipodi:cx="415"
+       sodipodi:cy="57.362206"
+       sodipodi:rx="25"
+       sodipodi:ry="5"
+       sodipodi:start="0"
+       sodipodi:end="0.30092094"
+       d="m 440,57.362206 a 25,5 0 0 1 -1.1234,1.481999 L 415,57.362206 Z" />
+    <path
+       style="fill:none"
+       id="path4335"
+       sodipodi:type="arc"
+       sodipodi:cx="400"
+       sodipodi:cy="57.362206"
+       sodipodi:rx="10"
+       sodipodi:ry="15"
+       sodipodi:start="0"
+       sodipodi:end="0.30092094"
+       d="m 410,57.362206 a 10,15 0 0 1 -0.44936,4.445998 L 400,57.362206 Z" />
+    <path
+       style="fill:none"
+       id="path4337"
+       sodipodi:type="arc"
+       sodipodi:cx="336.88586"
+       sodipodi:cy="45.240116"
+       sodipodi:rx="30.304577"
+       sodipodi:ry="1.5152289"
+       sodipodi:start="0"
+       sodipodi:end="0.30092094"
+       d="m 367.19044,45.240116 a 30.304577,1.5152289 0 0 1 -1.36177,0.449114 l -28.94281,-0.449114 z" />
+    <path
+       style="fill:none"
+       id="path4341"
+       sodipodi:type="arc"
+       sodipodi:cx="279.81226"
+       sodipodi:cy="30.592905"
+       sodipodi:rx="10.101525"
+       sodipodi:ry="4.0406103"
+       sodipodi:start="0"
+       sodipodi:end="0.27257505"
+       d="m 289.91378,30.592905 a 10.101525,4.0406103 0 0 1 -0.37294,1.087782 l -9.72858,-1.087782 z" />
+    <path
+       style="fill:none"
+       id="path4343"
+       sodipodi:type="arc"
+       sodipodi:cx="294.96454"
+       sodipodi:cy="47.007885"
+       sodipodi:rx="5.0507627"
+       sodipodi:ry="12.374369"
+       sodipodi:start="0"
+       sodipodi:end="0.27257505"
+       d="m 300.0153,47.007885 a 5.0507627,12.374369 0 0 1 -0.18647,3.331332 l -4.86429,-3.331332 z" />
+    <path
+       style="fill:none"
+       id="path4345"
+       sodipodi:type="arc"
+       sodipodi:cx="314.15744"
+       sodipodi:cy="50.795956"
+       sodipodi:rx="17.172594"
+       sodipodi:ry="2.5253813"
+       sodipodi:start="0"
+       sodipodi:end="0.27257505"
+       d="m 331.33003,50.795956 a 17.172594,2.5253813 0 0 1 -0.63399,0.679863 l -16.5386,-0.679863 z" />
+    <path
+       style="fill:none"
+       id="path4347"
+       sodipodi:type="arc"
+       sodipodi:cx="372.49374"
+       sodipodi:cy="53.573875"
+       sodipodi:rx="36.112953"
+       sodipodi:ry="5.8083773"
+       sodipodi:start="0"
+       sodipodi:end="0.27257505"
+       d="m 408.6067,53.573875 a 36.112953,5.8083773 0 0 1 -1.33326,1.563687 l -34.7797,-1.563687 z" />
+    <path
+       style="opacity:0.92099998;fill:#1df5d5;fill-opacity:1;stroke:#000000;stroke-width:0.05549314;stroke-miterlimit:4;stroke-dasharray:none;stroke-opacity:0.96610173"
+       id="path4362"
+       sodipodi:type="arc"
+       sodipodi:cx="432.99887"
+       sodipodi:cy="78.632385"
+       sodipodi:rx="26.093044"
+       sodipodi:ry="18.630219"
+       sodipodi:start="0.86050045"
+       sodipodi:end="0.81667097"
+       d="m 450.01305,92.757239 a 26.093044,18.630219 0 0 1 -36.6095,-1.82283 26.093044,18.630219 0 0 1 2.15172,-26.157287 26.093044,18.630219 0 0 1 36.65666,1.249611 26.093044,18.630219 0 0 1 -1.34842,26.184672"
+       sodipodi:open="true" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="427.39667"
+       y="80.98439"
+       id="text4412"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan4414"
+         x="427.39667"
+         y="80.98439">DB</tspan><tspan
+         sodipodi:role="line"
+         x="427.39667"
+         y="96.60939"
+         id="tspan4416" /></text>
+    <rect
+       style="fill:none;fill-rule:evenodd;stroke:#000000;stroke-width:0.63383168px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       id="rect3357-6-4"
+       width="263.54529"
+       height="30.944864"
+       x="473.30872"
+       y="-76.369919"
+       transform="scale(1,-1)" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="475.78186"
+       y="35.138592"
+       id="text5279"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan5281"
+         x="475.78186"
+         y="35.138592">ProbeFreeze</tspan><tspan
+         sodipodi:role="line"
+         x="475.78186"
+         y="50.763592"
+         id="tspan5283" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="481.84277"
+       y="64.433014"
+       id="text5285"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan5287"
+         x="481.84277"
+         y="64.433014">id</tspan><tspan
+         sodipodi:role="line"
+         x="481.84277"
+         y="80.058014"
+         id="tspan5289" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="509.11688"
+       y="64.433014"
+       id="text5291"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan5293"
+         x="509.11688"
+         y="64.433014">ProbeFreezeId</tspan><tspan
+         sodipodi:role="line"
+         x="509.11688"
+         y="80.058006"
+         id="tspan5295" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="616.19305"
+       y="64.433014"
+       id="text5297"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan5299"
+         x="616.19305"
+         y="64.433014">TissueId</tspan></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="263.64981"
+       y="101.80865"
+       id="text5965"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan5967"
+         x="263.64981"
+         y="101.80865">id</tspan><tspan
+         sodipodi:role="line"
+         x="263.64981"
+         y="117.43365"
+         id="tspan5969" /></text>
+    <path
+       style="opacity:0.92099998;fill:#1df5d5;fill-opacity:1;stroke:#000000;stroke-width:0.04304412;stroke-miterlimit:4;stroke-dasharray:none;stroke-opacity:0.96610173"
+       id="path4362-2"
+       sodipodi:type="arc"
+       sodipodi:cx="506.08649"
+       sodipodi:cy="83.625862"
+       sodipodi:rx="20.03821"
+       sodipodi:ry="14.595966"
+       sodipodi:start="0.86050045"
+       sodipodi:end="0.81667097"
+       d="m 519.15256,94.692071 a 20.03821,14.595966 0 0 1 -28.11434,-1.428108 20.03821,14.595966 0 0 1 1.65242,-20.493098 20.03821,14.595966 0 0 1 28.15056,0.979016 20.03821,14.595966 0 0 1 -1.03552,20.514553"
+       sodipodi:open="true" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="501.03564"
+       y="86.656364"
+       id="text7497"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan7499"
+         x="501.03564"
+         y="86.656364">=</tspan></text>
+    <path
+       style="fill:none;fill-rule:evenodd;stroke:#0000a3;stroke-width:2.8;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1;stroke-miterlimit:4;stroke-dasharray:none;marker-end:url(#Arrow2Mend)"
+       d="m 385.87827,117.9711 c 0,0 59.599,62.62946 92.93404,22.22336 30.30457,-42.426411 30.30457,-42.426411 30.30457,-42.426411"
+       id="path11531"
+       inkscape:connector-curvature="0" />
+    <path
+       style="fill:none;fill-rule:evenodd;stroke:#0000da;stroke-width:4.50923538;stroke-linecap:butt;stroke-linejoin:miter;stroke-miterlimit:4;stroke-dasharray:none;stroke-opacity:1;marker-end:url(#marker11727)"
+       d="M 303.7558,169.72606 71.513981,116.30022"
+       id="path11707"
+       inkscape:connector-curvature="0" />
+    <path
+       style="fill:none;fill-rule:evenodd;stroke:#0000d7;stroke-width:2;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1;stroke-miterlimit:4;stroke-dasharray:none;marker-end:url(#marker12489)"
+       d="m 138.3909,171.50919 130.30968,-59.599"
+       id="path12481"
+       inkscape:connector-curvature="0" />
+    <rect
+       style="fill:none;fill-rule:evenodd;stroke:#000000;stroke-width:0.46889797px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       id="rect3357-8"
+       width="174.81682"
+       height="25.531101"
+       x="42.901268"
+       y="25.4035" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="43.436558"
+       y="17.966"
+       id="text12592"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan12594"
+         x="43.436558"
+         y="17.966">Strain</tspan><tspan
+         sodipodi:role="line"
+         x="43.436558"
+         y="33.591"
+         id="tspan12596" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="55.558392"
+       y="41.199509"
+       id="text12598"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         x="55.558392"
+         y="41.199509"
+         id="tspan12610">id</tspan><tspan
+         sodipodi:role="line"
+         x="55.558392"
+         y="56.824509"
+         id="tspan12602" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="101.01525"
+       y="40.189354"
+       id="text12604"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan12606"
+         x="101.01525"
+         y="40.189354">name</tspan><tspan
+         sodipodi:role="line"
+         x="101.01525"
+         y="55.814354"
+         id="tspan12608" /></text>
+    <path
+       style="fill:none;fill-rule:evenodd;stroke:#0000d7;stroke-width:0.96167564;stroke-linecap:butt;stroke-linejoin:miter;stroke-miterlimit:4;stroke-dasharray:none;stroke-opacity:1;marker-end:url(#marker12489-7)"
+       d="M 108.99621,89.933268 65.230166,45.329821"
+       id="path12481-0"
+       inkscape:connector-curvature="0" />
+    <rect
+       style="fill:none;fill-rule:evenodd;stroke:#000000;stroke-width:0.46889797px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       id="rect3357-8-7"
+       width="174.81682"
+       height="25.531101"
+       x="40.880962"
+       y="240.56599" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="43.436558"
+       y="231.10818"
+       id="text14098"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan14100"
+         x="43.436558"
+         y="231.10818">ProbeSet</tspan><tspan
+         sodipodi:role="line"
+         x="43.436558"
+         y="246.73318"
+         id="tspan14102" /></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="53.538086"
+       y="257.37213"
+       id="text14104"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         x="53.538086"
+         y="257.37213"
+         id="tspan14108">id</tspan></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="90.913734"
+       y="256.362"
+       id="text14112"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         x="90.913734"
+         y="256.362"
+         id="tspan14116">name</tspan></text>
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="144.45181"
+       y="255.35185"
+       id="text14120"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         x="144.45181"
+         y="255.35185"
+         id="tspan14124">many infos</tspan></text>
+    <path
+       style="fill:none;fill-rule:evenodd;stroke:#0000d7;stroke-width:1.89054883;stroke-linecap:butt;stroke-linejoin:miter;stroke-miterlimit:4;stroke-dasharray:none;stroke-opacity:1;marker-end:url(#marker12489-7-2)"
+       d="M 72.019909,251.65943 208.39464,196.3512"
+       id="path12481-0-6"
+       inkscape:connector-curvature="0"
+       inkscape:transform-center-x="-32.453094"
+       inkscape:transform-center-y="114.65633" />
+    <text
+       xml:space="preserve"
+       style="font-style:normal;font-weight:normal;font-size:12.5px;line-height:125%;font-family:sans-serif;letter-spacing:0px;word-spacing:0px;fill:#000000;fill-opacity:1;stroke:none;stroke-width:1px;stroke-linecap:butt;stroke-linejoin:miter;stroke-opacity:1"
+       x="150.51273"
+       y="40.18935"
+       id="text3465"
+       sodipodi:linespacing="125%"><tspan
+         sodipodi:role="line"
+         id="tspan3467"
+         x="150.51273"
+         y="40.18935">speciesid</tspan><tspan
+         sodipodi:role="line"
+         x="150.51273"
+         y="55.81435"
+         id="tspan3469" /></text>
+  </g>
+</svg>
diff --git a/doc/gn_installation_notes.txt b/doc/gn_installation_notes.txt
deleted file mode 100644
index 584080f7..00000000
--- a/doc/gn_installation_notes.txt
+++ /dev/null
@@ -1,346 +0,0 @@
-UFW - default firewall confirguation tool for Ubuntu; eases iptables firewall configuration
-
-Enable UFW:
-sudo ufw enable
-Check status of UFW:
-sudo ufw status verbose
-
-Limit ssh:
-sudo ufw limit ssh
-
-Enable http, https:
-sudo ufw allow http
-sudo ufw allow https
-
-===========================================
-
-http://evilrouters.net/2011/02/18/using-etckeeper-with-git-on-ubuntu/
-
-Install etckeeper:
-sudo apt-get install etckeeper
-
-Edit /etc/etckeeper/etckeeper.conf to comment out VCS="bzr" and comment in VCS="git"
-
-Initialize repository:
-sudo etckeeper init
-
-Do initial commit:
-sudo etckeeper commit "Initial commit."
-
-===========================================
-
-Get git:
-
-sudo apt-get install git
-
-===========================================
-
-Clone code from git repository:
-git clone http://github.com/zsloan/genenetwork.git gene 
-
-Pull from branch in git repository:
-git pull origin flask(or whatever the branch is)
-
-**"apt-cache search" searches for text in the description for various packages, while
-"apt-file search" searches for files within the packages**
-
-Search for package with a specified file that can be installed with apt-get
-apt-file search _______
-
-============================================
-
-Create trash directory:
-mkdir ~/.trash
-
-============================================
-
-Using dpkg
-
-Check which system packages are already installed:
-dpkg -l | less
-
-===========================================
-
-Installing virtualenv:
-sudo pip install virtualenv
-
-Tell virtualenv which directory to use:
-virtualenv ve27
-
-Start up virtual environment:
-source ~/ve27/bin/activate
-
-===========================================
-
-Install libmysqlclient-dev (Mysql-Python dependency)
-sudo apt-get install libmysqlclient-dev
-
-Install python-dev (numpy dependency)
-sudo apt-get install python-dev
-
-Install scipy dependencies:
-sudo apt-get install libatlas-base-dev gfortran g++
-
-===========================================
-
-Install pip:
-sudo apt-get install python-pip
-
-REMEMBER TO SOURCE VE BEFORE INSTALLING 
-
-Comment out in requirements.txt:
-Reaper
-numarray
-
-Before installing from requirements.txt, install numpy separately:
-pip install numpy==1.7.0 (or whatever version we're using)
-
-Install from requirements.txt (after activating virtualenv):
-pip install -r gene/misc/requirements.txt
-
-===========================================
-
-Installing QTL Reaper
-
-wget http://downloads.sourceforge.net/project/qtlreaper/qtlreaper/1.1.1/qtlreaper-1.1.1.tar.gz?r=http%3A%2F%2Fsourceforge.net%2Fprojects%2Fqtlreaper%2Ffiles%2Flatest%2Fdownload&ts=1358975786&use_mirror=iweb
-mv -v qtlreaper-1.1.1.tar.gz?r=http%3A%2F%2Fsourceforge.net%2Fprojects%2Fqtlreaper%2Ffiles%2Flatest%2Fdownload&ts=1358975786&use_mirror=iweb qtlreaper-1.1.1.tar.gz
-tar xvf qtlreaper-1.1.1.tar.gz (to unzip)
-mkdir /home/zas1024/ve27/include/python2.7/Reaper
-python setup.py install
-
-===========================================
-
-Installing numarray 1.5.2
-
-wget http://downloads.sourceforge.net/project/numpy/Old%20Numarray/1.5.2/numarray-1.5.2.tar.gz?r=http%3A%2F%2Fsourceforge.net%2Fprojects%2Fnumpy%2Ffiles%2FOld%2520Numarray%2F1.5.2%2Fnumarray-1.5.2.tar.gz%2Fdownload&ts=1358978306&use_mirror=superb-dca2
-mv -v numarray-1.5.2.tar.gz?r=http:%2F%2Fsourceforge.net%2Fprojects%2Fnumpy%2Ffiles%2FOld%20Numarray%2F1.5.2%2Fnumarray-1.5.2.tar.gz%2Fdownload numarray-1.5.2.tar.gz
-tar xvf numarray-1.5.2.tar.gz
-sudo python setup.py install
-
-===========================================
-
-Installing nginx
-
-sudo -s
-nginx=stable # use nginx=development for latest development version
-echo "deb http://ppa.launchpad.net/nginx/$nginx/ubuntu lucid main" > /etc/apt/sources.list.d/nginx-$nginx-lucid.list
-apt-key adv --keyserver keyserver.ubuntu.com --recv-keys C300EE8C
-apt-get update 
-apt-get install nginx
-
-Create configuration file in ~/gene/wqflask/other_config/nginx_conf/ (modeled off of the others)
-Create symbolic link to config file in /etc/nginx/sites-enabled/:
-ln -s dir_to_link_to linking_dir
-
-Run nginx:
-sudo /usr/sbin/nginx
-
-============================================
-
-Copy over zach_settings.py to /home/zas1024 directory (or whatever is home directory)
-
-export WQFLASK_SETTINGS=~/gene/wqflask/cfg/zach_settings.py (or wherever file is located)
-
-============================================
-
-Install MySQL Server
-
-sudo apt-get install mysql-server
-
-mkdir /mnt/big
-fdisk /dev/sdb
-m: for help
-n: new partion
-...
-w: write to table and exit
-
-Start MySQL server:
-service mysql start
-
-Stop MySQL server:
-service mysql stop
-
-Change root password:
-mysql> UPDATE mysql.user SET Password=PASSWORD('your password') WHERE User='root';
-
-Setup accounts in MySQL (first need to delete anonymous/non-root accounts):
-#; use mysql;
-#; select * from user;
-#; delete from user where Host!="localhost";
-#; delete from user where User!="root";
-#; update user set Password = Password('yourpassword') where User='root';
-#; GRANT ALL ON *.* TO 'yourusername'@'%' IDENTIFIED BY 'yourpassword';
-#; select * from user;
-
-Use Percona to optimise my.cfg file:
-https://tools.percona.com/wizard
-
-To check # CPUs:
-grep -c processor /proc/cpuinfo
-
-To check memory, can use htop
-
-============================================
-
-Check RSA key:
-ssh-keygen -l -f /etc/ssh/ssh_host_rsa_key
-
-03:2c:d7:01:01:f0:31:3a:c8:df:e4:98:62:2c:59:d2  root@penguin (RSA)
-
-============================================
-
-Installing redis server
-
-In the dls directory:
-$ wget http://redis.googlecode.com/files/redis-2.6.14.tar.gz
-$ tar xzf redis-2.6.14.tar.gz
-$ cd redis-2.6.14
-$ make
-
-Run redis (from inside redis-2.6.14 directory):
-src/redis-server
-
-For the rest of the installation instructions, refer to:
-http://redis.io/topics/quickstart
-
-To continue installation (from the README):
-
-In order to install Redis binaries into /usr/local/bin just use:
-
-    % make install
-
-Make install will just install binaries in your system, but will not configure
-init scripts and configuration files in the appropriate place. This is not
-needed if you want just to play a bit with Redis, but if you are installing
-it the proper way for a production system, we have a script doing this
-for Ubuntu and Debian systems:
-
-    % cd utils
-    % ./install_server
-
-The script will ask you a few questions and will setup everything you need
-to run Redis properly as a background daemon that will start again on
-system reboots.
-
-In the redis config file (/etc/redis/6379.conf) uncomment the following line:
-bind 127.0.0.1
-
-This is so only the local computer has access
-
-============================================
-
-Check RSA key:
-ssh-keygen -l -f /etc/ssh/ssh_host_rsa_key
-
-03:2c:d7:01:01:f0:31:3a:c8:df:e4:98:62:2c:59:d2  root@penguin (RSA)
-
-============================================
-
-Using Yolk
-
-Install Yolk:
-pip install yolk
-
-Check packages installed in this virtual environment:
-yolk -l
-
-Checks packages that have updates available:
-yolk -U
-
-===========================================
-
-Installing yaml
-
-Install libyaml-dev:
-sudo apt-get install libyaml-dev
-
-Install yaml:
-pip install pyyaml
-
-===========================================
-
-Install MySQL Client
-
-To fix error "mysql_config not found" while installing packages with pip:
-sudo apt-get install libmysqlclient-dev
-
-===========================================
-
-Installing R
-
-sudo apt-get install r-base-dev
-
-===========================================
-
-Installing rpy2
-
-pip install rpy2
-
-===========================================
-
-Install Parallel Python (pp)
-
-wget http://www.parallelpython.com/downloads/pp/pp-1.6.3.tar.gz
-tar xvf pp-1.6.3.tar.gz
-python setup.py install
-
-==========================================
-
-Install requests
-
-pip install requests
-
-==========================================
-
-Install logging_tree
-
-pip install logging_tree
-
-==========================================
-
-Install colordiff (just to make it easier to view differences in files, not necessary for GN)
-
-sudo apt-get install colordiff
-
-==========================================
-
-Install NTP (network time protocol)
-
-sudo apt-get install ntp
-
-==========================================
-
-To get server running:
-
-!If having seemingly inexplicable problems with imports, make sure I've started the environment!
-
-Start up virtual environment:
-source ~/ve27/bin/activate==============
-
-Install requests
-
-pip install requests
-
-=======================
-
-To set WQFLASK_SETTINGS environment variable:
-export WQFLASK_SETTINGS=~/zach_settings.py (or wherever file is located)
-
-To change screen environment variable (if man not working or to get color, for example):
-export TERM=screen
-
-To search for commands in history if necessary:
-history | grep "(whatever is being searched for)"
-
-Run web server:
-/usr/local/nginx/sbin/nginx
-
-Run server:
-python runserver.py
-
-===========================================
-
-To do full upgrade (as opposed to apt-get upgrade)
-sudo aptitude full-upgrade
-
-===========================================
\ No newline at end of file
diff --git a/doc/joss/2016/paper.bib b/doc/joss/2016/paper.bib
new file mode 100644
index 00000000..34c0fd05
--- /dev/null
+++ b/doc/joss/2016/paper.bib
@@ -0,0 +1,50 @@
+@article{WGCNA:2008,
+  author       = {Langfelder, P. and Horvath, S.},
+  title        = {{WGCNA: an R package for weighted correlation network analysis}},
+  journal      = {BMC Bioinformatics},
+  year         = {2008},
+  volume       = {9},
+  pages        = {559},
+  doi          = {10.1186/1471-2105-9-559},
+  url          = {http://www.ncbi.nlm.nih.gov/pubmed/19114008},
+  abstract     = {BACKGROUND: Correlation networks are increasingly being used in bioinformatics applications. For example, weighted gene co-expression network analysis is a systems biology method for describing the correlation patterns among genes across microarray samples. Weighted correlation network analysis (WGCNA) can be used for finding clusters (modules) of highly correlated genes, for summarizing such clusters using the module eigengene or an intramodular hub gene, for relating modules to one another and to external sample traits (using eigengene network methodology), and for calculating module membership measures. Correlation networks facilitate network based gene screening methods that can be used to identify candidate biomarkers or therapeutic targets. These methods have been successfully applied in various biological contexts, e.g. cancer, mouse genetics, yeast genetics, and analysis of brain imaging data. While parts of the correlation network methodology have been described in separate publications, there is a need to provide a user-friendly, comprehensive, and consistent software implementation and an accompanying tutorial. RESULTS: The WGCNA R software package is a comprehensive collection of R functions for performing various aspects of weighted correlation network analysis. The package includes functions for network construction, module detection, gene selection, calculations of topological properties, data simulation, visualization, and interfacing with external software. Along with the R package we also present R software tutorials. While the methods development was motivated by gene expression data, the underlying data mining approach can be applied to a variety of different settings. CONCLUSION: The WGCNA package provides R functions for weighted correlation network analysis, e.g. co-expression network analysis of gene expression data. The R package along with its source code and additional material are freely available at http://www.genetics.ucla.edu/labs/horvath/CoexpressionNetwork/Rpackages/WGCNA.}
+}
+
+@article{Wang:2016,
+  author       = {Wang, X. and Pandey, A. K. and Mulligan, M. K. and Williams, E. G. and Mozhui, K. and Li, Z. and Jovaisaite, V. and Quarles, L. D. and Xiao, Z. and Huang, J. and Capra, J. A. and Chen, Z. and Taylor, W. L. and Bastarache, L. and Niu, X. and Pollard, K. S. and Ciobanu, D. C. and Reznik, A. O. and Tishkov, A. V. and Zhulin, I. B. and Peng, J. and Nelson, S. F. and Denny, J. C. and Auwerx, J. and Lu, L. and Williams, R. W.},
+  title        = {{Joint mouse-human phenome-wide association to test gene function and disease risk}},
+  journal      = {Nat Commun},
+  year         = {2016},
+  volume       = {7},
+  pages        = {10464},
+  doi          = {10.1038/ncomms10464},
+  url          = {http://www.ncbi.nlm.nih.gov/pubmed/26833085},
+  abstract     = {Phenome-wide association is a novel reverse genetic strategy to analyze genome-to-phenome relations in human clinical cohorts. Here we test this approach using a large murine population segregating for approximately 5 million sequence variants, and we compare our results to those extracted from a matched analysis of gene variants in a large human cohort. For the mouse cohort, we amassed a deep and broad open-access phenome consisting of approximately 4,500 metabolic, physiological, pharmacological and behavioural traits, and more than 90 independent expression quantitative trait locus (QTL), transcriptome, proteome, metagenome and metabolome data sets--by far the largest coherent phenome for any experimental cohort (www.genenetwork.org). We tested downstream effects of subsets of variants and discovered several novel associations, including a missense mutation in fumarate hydratase that controls variation in the mitochondrial unfolded protein response in both mouse and Caenorhabditis elegans, and missense mutations in Col6a5 that underlies variation in bone mineral density in both mouse and human.}
+}
+
+@article{Lippert:2011,
+  author       = {Lippert, C. and Listgarten, J. and Liu, Y. and Kadie, C. M. and Davidson, R. I. and Heckerman, D.},
+  title        = {{FaST linear mixed models for genome-wide association studies}},
+  journal      = {Nat Methods},
+  year         = {2011},
+  volume       = {8},
+  number       = {10},
+  pages        = {833-835},
+  doi          = {10.1038/nmeth.1681},
+  url          = {http://www.ncbi.nlm.nih.gov/pubmed/21892150},
+  abstract     = {We describe factored spectrally transformed linear mixed models (FaST-LMM), an algorithm for genome-wide association studies (GWAS) that scales linearly with cohort size in both run time and memory use. On Wellcome Trust data for 15,000 individuals, FaST-LMM ran an order of magnitude faster than current efficient algorithms. Our algorithm can analyze data for 120,000 individuals in just a few hours, whereas current algorithms fail on data for even 20,000 individuals (http://mscompbio.codeplex.com/).}
+}
+
+@article{Arends:2010,
+  author       = {Arends, D. and Prins, P. and Jansen, R. C. and Broman, K. W.},
+  title        = {{R/qtl: high-throughput multiple QTL mapping}},
+  journal      = {Bioinformatics},
+  year         = {2010},
+  volume       = {26},
+  number       = {23},
+  pages        = {2990-2992},
+  doi          = {10.1093/bioinformatics/btq565},
+  url          = {http://www.ncbi.nlm.nih.gov/pubmed/20966004},
+  abstract     = {MOTIVATION: R/qtl is free and powerful software for mapping and exploring quantitative trait loci (QTL). R/qtl provides a fully comprehensive range of methods for a wide range of experimental cross types. We recently added multiple QTL mapping (MQM) to R/qtl. MQM adds higher statistical power to detect and disentangle the effects of multiple linked and unlinked QTL compared with many other methods. MQM for R/qtl adds many new features including improved handling of missing data, analysis of 10,000 s of molecular traits, permutation for determining significance thresholds for QTL and QTL hot spots, and visualizations for cis-trans and QTL interaction effects. MQM for R/qtl is the first free and open source implementation of MQM that is multi-platform, scalable and suitable for automated procedures and large genetical genomics datasets. AVAILABILITY: R/qtl is free and open source multi-platform software for the statistical language R, and is made available under the GPLv3 license. R/qtl can be installed from http://www.rqtl.org/. R/qtl queries should be directed at the mailing list, see http://www.rqtl.org/list/. CONTACT: kbroman@biostat.wisc.edu.},
+
+}
diff --git a/doc/joss/2016/paper.md b/doc/joss/2016/paper.md
new file mode 100644
index 00000000..12b3b5d0
--- /dev/null
+++ b/doc/joss/2016/paper.md
@@ -0,0 +1,87 @@
+---
+title: 'GeneNetwork: framework for web-based genetics'
+tags:
+  - bioinformatics
+  - genetics
+  - genomics
+authors:
+  - name: Zachary Sloan
+    orcid: 0000-0002-8099-1363
+    affiliation: University of Tennessee Health Science Center, USA
+  - name: Danny Arends
+    orcid: 0000-0001-8738-0162
+    affiliation: Humboldt University, Berlin, Germany
+  - name: Karl W. Broman
+    orcid: 0000-0002-4914-6671
+    affiliation: University of Wisconsin, USA
+  - name: Arthur Centeno
+    orcid: 0000-0003-3142-2081
+    affiliation: University of Tennessee Health Science Center, USA
+  - name: Nicholas Furlotte
+    orcid: 0000-0002-9096-6276
+  - name: Harm Nijveen
+    orcid: 0000-0002-9167-4945
+    affiliation: Wageningen University, The Netherlands
+  - name: Lei Yan
+    orcid: 0000-0001-5259-3379
+    affiliation: University of Tennessee Health Science Center, USA
+  - name: Xiang Zhou
+    orcid: 0000-0002-4331-7599
+    affiliation: University of Michigan
+  - name: Robert W. Williams
+    orcid: 0000-0001-8924-4447
+    affiliation: University of Tennessee Health Science Center, USA
+  - name: Pjotr Prins
+    orcid: 0000-0002-8021-9162
+    affiliation: University Medical Center Utrecht, The Netherlands, University of Tennessee Health Science Center, USA
+date: 29 May 2016
+bibliography: paper.bib
+---
+
+# Summary
+
+GeneNetwork (GN) is a free and open source (FOSS) framework for
+web-based genetics that can be deployed anywhere. GN allows biologists
+to upload high-throughput experimental data, such as expression data
+from microarrays and RNA-seq, and also `classic' phenotypes, such as
+disease phenotypes.  These phenotypes can be mapped interactively
+against genotypes using embedded tools, such as R/QTL [@Arends:2010]
+mapping, interval mapping for model organisms and pylmm; an
+implementation of FaST-LMM [@Lippert:2011] which is more suitable for
+human populations and outbred crosses, such as the mouse diversity
+outcross. Interactive D3 graphics are included from R/qtlcharts and
+presentation-ready figures can be generated. Recently we have added
+functionality for phenotype correlation [@Wang:2016] and network
+analysis [@WGCNA:2008].
+
+-![Mouse LMM mapping example](qtl2.png)
+
+GN is written in python and javascript and contains a rich set of
+tools and libraries that can be written in any computer language. A
+full list of included software can be found in the package named
+`genenetwork2' and defined in
+[guix-bioinformatics](https://github.com/genenetwork/guix-bioinformatics/blob/master/gn/packages/genenetwork.scm). To
+make it easy to install GN locally in a byte reproducible way,
+including all dependencies and a 2GB MySQL test database (the full
+database is 160GB and growing), GN is packaged with
+[GNU Guix](https://www.gnu.org/software/guix/), as described
+[here](https://github.com/genenetwork/genenetwork2/blob/master/doc/README.org).
+GNU Guix deployment makes it feasible to deploy and rebrand GN
+anywhere.
+
+# Future work
+
+More mapping tools will be added, including support for Genome-wide
+Efficient Mixed Model Association (GEMMA). The
+[Biodiallance genome browser](http://www.biodalliance.org/) is being
+added as a Google Summer of Code project with special tracks related
+to QTL mapping and network analysis. Faster LMM solutions are being
+worked on, including GPU support.
+
+A REST interface is being added so that data can be uploaded to a
+server, analysis run remotely on high performance hardware, and
+results downloaded and used for further analysis. This feature will
+allow biologist-programmers to use R and Python on their computer and
+execute computations on GN enabled servers.
+
+# References
diff --git a/doc/joss/2016/qtl.png b/doc/joss/2016/qtl.png
new file mode 100644
index 00000000..995a2739
--- /dev/null
+++ b/doc/joss/2016/qtl.png
diff --git a/doc/joss/2016/qtl2.png b/doc/joss/2016/qtl2.png
new file mode 100644
index 00000000..e0b684ef
--- /dev/null
+++ b/doc/joss/2016/qtl2.png
diff --git a/doc/new_variable_names.txt b/doc/new_variable_names.txt
deleted file mode 100644
index c11c160e..00000000
--- a/doc/new_variable_names.txt
+++ /dev/null
@@ -1,6 +0,0 @@
-RISet/riset -> group
-webqtlDataset.py -> data_set.py
-webqtlDataset (class object) -> DataSet
-database/db -> dataset/data_set
-DataEditingPage -> show_trait.py/show_trait.html
-webqtlTrait -> GeneralTrait
\ No newline at end of file
diff --git a/doc/notes.txt b/doc/notes.txt
deleted file mode 100644
index f8ce2759..00000000
--- a/doc/notes.txt
+++ /dev/null
@@ -1,311 +0,0 @@
-Clone code from git repository:
-git clone http://github.com/zsloan/genenetwork.git gene 
-
-Pull from branch in git repository:
-git pull origin flask(or whatever the branch is)
-
-Add all files in current directory branch to be staged to be committed
-git add -A
-
-Git push to my github repository
-git push https://github.com/zsloan/genenetwork.git master
-
-Get the default path being used when a command is typed:
-which _______
-
-Change default path python looks at when importing
-export PYTHONPATH="/home/zas1024/gene/wqflask"
-
-Get the paths checked when a user types a command:
-echo $PATH
-
-Get all environment variables:
-set
-
-
-**** apt-get is an Ubuntu system-wide package manager, while pip is a Python-only system
-for python packages ****
-
-Upgrade system packages for security updates, etc:
-apt-get update
-apt-get dist-upgrade (can probably be used in place of apt-get upgrade)
-apt-get upgrade
-
-**"apt-cache search" searches for text in the description for various packages, while
-"apt-file search" searches for files within the packages**
-
-Show information about given result item returned by apt-cache search:
-apt-cache show _______
-
-Search for package with a specified file that can be installed with apt-get
-apt-file search _______
-
-============================================
-
-Check which system packages are installed:
-dpkg -l | less
-
-============================================
-
-NEVER USE SUDO WITH PIP
-
-To fix error "mysql_config not found":
-sudo apt-get install libmysqlclient-dev
-
-Create requirements.txt file:
-pip freeze > requirements.txt (or whatever filename)
-
-Install from requirements.txt:
-pip install -r gene/wqflask/requirements.txt -t ve27
-
-============================================
-
-To get server running:
-
-!If having seemingly inexplicable problems with imports, make sure I've started the environment!
-
-Note: Virtual environment is not activated when running as root
-
-Start up virtual environment:
-source ~/ve27/bin/activate
-
-Deactivate virtual environment:
-deactivate (just type deactivate)
-
-To set WQFLASK_SETTINGS environment variable:
-export WQFLASK_SETTINGS=~/zach_settings.py (or wherever file is located)
-
-zach_settings.py is the local config file with the DB_URI
-default_settings.py is the config file with the configuration information that would apply
-to any running instance of GeneNetwork
-
-To change screen environment variable (if man not working or to get color, for example):
-export TERM=screen
-
-To search for commands in history if necessary:
-history | grep "(whatever is being searched for)"
-
-Reload web server:
-/usr/sbin/nginx -s reload
-
-Run server:
-python runserver.py
-
-Run sendmail.py
-python send_mail.py
-
-===========================================
-
-UFW - default firewall confirguation tool for Ubuntu; eases iptables firewall configuration
-
-Enable UFW:
-sudo ufw enable
-Check status of UFW:
-sudo ufw status verbose
-
-===========================================
-
-Update user password:
-use mysql;
-UPDATE user SET password=PASSWORD('whatever') WHERE user='webqtl';
-FLUSH PRIVILEGES;
-
-===========================================
-
-Redis things
-
-Restart redis server:
-sudo /etc/init.d/redis_6379 stop
-sudo /etc/init.d/redis_6379 start
-
-===========================================
-
-Run pylint:
-pylint file_name
-
-For options:
-pylint --help 
-
-===========================================
-
-Start screen session:
-
-If "no option -R" or running for first time:
-byobu-select-backend
-2. screen
-
-byobu -RD (to start)
-control-a then :multiuser on
-control-a then :acladd sam
-
-More info on sharing byobu screen with other users:
-http://wiki.networksecuritytoolkit.org/nstwiki/index.php/HowTo_Share_A_Terminal_Session_Using_Screen
-
-control-a c to create channel
-
-type: screen -list for sessions
-screen -r zas1024/25679.byobu
-
-or if only one:
-
-screen -r zas1024/
-
-===========================================
-
-Start up log:
-Go to /tmp and tail -f flask_gn_log
-
-===========================================
-
-Coffeescript Stuff:
-
-coffee -c (filename)
-coffee -c -w . (to watch for changes and recompile in current directory; the "." is for current directory)
-coffee --help (for information about setting options)
-
-===========================================
-
-Unset ASKPASS when trying to git push
-
-unset SSH_ASKPASS
-
-===========================================
-
-htop: Gives information on processes, cpu/memory load, etc
-dstat: Also gives various system information, resource usage, etc
-df: Reports file system disk space usage
-
-===========================================
-
-ll h*: Finds items in the directory starting with h
-
-===========================================
-
-du -hms * | sort -n : Gives size used by different directories
--h: human readable
--m: in megabytes (default)
--s: summarize
-
-===========================================
-
-rm -rfv
-
-===========================================
-
-cp -a (archive; copies recursively and doesn't follow symbol links)
-   -i (interactive, prompts before overwrite)
-   -v (verbose)
-   -b (backup)
-   
-mv (same as above, but with no -a)
-
-===========================================
-
-Add user:
-sudo adduser
-Edit /etc/sudoers to give user root privileges
-
-
-===========================================
-
-tidyp - Improves/beautifies html code
-tidyp -m -i -w 100 index_page.html
-
-===========================================
-
-ps ax - View processes
-ps ux (the "u" is for user)
-
-kill (process #)
-
-===========================================
-
-Installing QTL Reaper
-
-wget http://downloads.sourceforge.net/project/qtlreaper/qtlreaper/1.1.1/qtlreaper-1.1.1.tar.gz?r=http%3A%2F%2Fsourceforge.net%2Fprojects%2Fqtlreaper%2Ffiles%2Flatest%2Fdownload&ts=1358975786&use_mirror=iweb
-tar xvf qtlreaper-1.1.1.tar.gz (to unzip)
-python setup.py build
-python setup.py install
-
-===========================================
-
-Using Yolk
-
-Install Yolk:
-pip install yolk
-
-Check packages installed in this virtual environment:
-yolk -l
-
-Checks packages that have updates available:
-yolk -U
-
-===========================================
-
-Python stuff:
-
-Classes should always inherit "object"
-To iterate through dictionary items: for X, Y in MyDictionary.items():
-
-===========================================
-
-Change import path from command line
-export PYTHONPATH=~/gene/wqflask (or whatever)
-
-===========================================
-
-Create symbolic link:
-ln -s dir_to_link_to linking_dir
-
-===========================================
-
-Reboot server
-sudo reboot
-
-===========================================
-
-Using grep:
-
-grep -ir (search string) (directory)
-
--i ignores case
--r searches recursively through subdirectories of directory you specify
-
-===========================================
-
-Command line arguments:
-
-Use argparse to deal with command line arguments (instead of argv or optparse)
-
-===========================================
-
-Change owner/group:
-
-chown zas1024 somefile (change owner of somefile to zas1024)
-chown zas1024: somefile (change owner and group of somefile to zas1024)
-sudo chown root: somefile (change owner/group of somefile to root)
-
-Change permissions:
-
-chmod g-wr (remove write/read privileges for group)
-chmod g+w (add write privileges for group)
-chmod u+rwx (add read, write, and execute privileges for user)
-etc.
-
-===========================================
-
-MySQL Things -
-
-Create fulltext (MATCH AGAINST syntax) index:
-CREATE FULLTEXT INDEX __________ ON Table (Column);
-
-If <4 character searches not working:
-Add ft_min_word_len = 2 (to make te minimum characters 2) to config file
-Rebuild relevant tables with fulltext indexes with "REPAIR TABLE _______ QUICK"
-
-===========================================
-
-To delete all .pyc files (for example if there's some issue you're having trouble resolving):
-find . -name '*.pyc' -delete
-http://stackoverflow.com/questions/785519/how-do-i-remove-all-pyc-files-from-a-project
-
diff --git a/doc/notes_DA.txt b/doc/notes_DA.txt
deleted file mode 100644
index 410e0182..00000000
--- a/doc/notes_DA.txt
+++ /dev/null
@@ -1,10 +0,0 @@
-Danny's notes about the genenetwork source
-
-Location of static files:
-
-Location of HTML templates:       wqflask/wqflask/templates/
-
-Entry point of the wqflask app:   wqflask/wqflask/__init__.py
-
-Application routes:               wqflask/wqflask/views.py
-
diff --git a/doc/requirements.txt b/doc/requirements.txt
deleted file mode 100644
index 39ee5652..00000000
--- a/doc/requirements.txt
+++ /dev/null
@@ -1,36 +0,0 @@
-BeautifulSoup==3.2.1
-Flask==0.9
-Flask-Login==0.1.3
-Flask-Mail==0.7.6
-Flask-Principal==0.3.4
-Flask-SQLAlchemy==0.16
-Flask-Security==1.6.0
-Flask-WTF==0.8.3
-Jinja2==2.6
-MySQL-python==1.2.4
-PyYAML==3.10
-#Reaper==1.0
-Reindent==0.1.1
-SQLAlchemy==0.8.0
-WTForms==1.0.3
-Werkzeug==0.8.3
-apache-libcloud==0.12.3
-argparse==1.2.1
-blinker==1.2
-cairosvg==1.0.15
-itsdangerous==0.17
-logging-tree==1.2
-logilab-astng==0.24.3
-logilab-common==0.59.1
-#numarray==1.5.2
-numpy==1.7.0
-passlib==1.6.1
-pp==1.6.3
-pylint==0.27.0
-redis==2.7.2
-requests==1.1.0
-scipy==0.11.0
-simplejson==3.0.7
-wsgiref==0.1.2
-yolk==0.4.3
-XlsxWriter==0.7.2
diff --git a/doc/todo.txt b/doc/todo.txt
deleted file mode 100644
index 1d781b13..00000000
--- a/doc/todo.txt
+++ /dev/null
@@ -1,2 +0,0 @@
-- Ask Rob about potentially recoding qtlreaper
-- Ask Rob about Probe/cellid traits
\ No newline at end of file