You can not select more than 25 topics
Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.
1129 lines
39 KiB
1129 lines
39 KiB
/*
|
|
This file is part of BioD.
|
|
Copyright (C) 2012 Artem Tarasov <lomereiter@gmail.com>
|
|
|
|
BioD is free software; you can redistribute it and/or modify
|
|
it under the terms of the GNU General Public License as published by
|
|
the Free Software Foundation; either version 2 of the License, or
|
|
(at your option) any later version.
|
|
|
|
BioD is distributed in the hope that it will be useful,
|
|
but WITHOUT ANY WARRANTY; without even the implied warranty of
|
|
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
|
|
GNU General Public License for more details.
|
|
|
|
You should have received a copy of the GNU General Public License
|
|
along with this program; if not, write to the Free Software
|
|
Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
|
|
|
|
*/
|
|
module bio.bam.read;
|
|
|
|
import bio.core.base;
|
|
|
|
import bio.bam.tagvalue;
|
|
import bio.bam.bai.bin;
|
|
|
|
import bio.bam.utils.array;
|
|
import bio.bam.utils.value;
|
|
import bio.core.utils.switchendianness;
|
|
|
|
import bio.bam.thirdparty.msgpack : Packer, unpack;
|
|
|
|
version(unittest) {
|
|
import bio.bam.utils.tagstoragebuilder;
|
|
import std.stdio;
|
|
}
|
|
|
|
import std.algorithm;
|
|
import std.range;
|
|
import std.conv;
|
|
import std.exception;
|
|
import std.stream;
|
|
import std.system;
|
|
import std.traits;
|
|
import std.array;
|
|
|
|
/**
|
|
Represents single CIGAR operation
|
|
*/
|
|
struct CigarOperation {
|
|
static assert(CigarOperation.sizeof == uint.sizeof);
|
|
/*
|
|
WARNING!
|
|
|
|
It is very essential that the size of
|
|
this struct is EXACTLY equal to uint.sizeof!
|
|
|
|
The reason is to avoid copying of arrays during alignment parsing.
|
|
|
|
Namely, when some_pointer points to raw cigar data,
|
|
we can just do a cast. This allows to access those data
|
|
directly, not doing any memory allocations.
|
|
*/
|
|
|
|
private uint raw; /// raw data from BAM
|
|
|
|
private static ubyte char2op(char c) {
|
|
switch(c) {
|
|
case 'M': return 0;
|
|
case 'I': return 1;
|
|
case 'D': return 2;
|
|
case 'N': return 3;
|
|
case 'S': return 4;
|
|
case 'H': return 5;
|
|
case 'P': return 6;
|
|
case '=': return 7;
|
|
case 'X': return 8;
|
|
default: return 8; // FIXME
|
|
}
|
|
}
|
|
|
|
this(uint length, char operation) {
|
|
enforce(length < (1<<28), "Too big length of CIGAR operation");
|
|
raw = (length << 4) | char2op(operation);
|
|
}
|
|
|
|
/// operation length
|
|
uint length() @property const nothrow {
|
|
return raw >> 4;
|
|
}
|
|
|
|
/// CIGAR operation as one of MIDNSHP=X
|
|
char operation() @property const nothrow {
|
|
if ((raw & 0xF) > 8) {
|
|
/* FIXME: what to do in this case? */
|
|
return '\0';
|
|
}
|
|
|
|
return "MIDNSHP=X"[raw & 0xF];
|
|
}
|
|
|
|
///
|
|
alias operation this;
|
|
|
|
// Each pair of bits has first bit set iff the operation is query consuming,
|
|
// and second bit set iff it is reference consuming.
|
|
// X = P H S N D I M
|
|
private static immutable uint CIGAR_TYPE = 0b11_11_00_00_01_10_10_01_11;
|
|
|
|
/// True iff operation is one of M, =, X, I, S
|
|
bool is_query_consuming() @property const {
|
|
return ((CIGAR_TYPE >> ((raw & 0xF) * 2)) & 1) != 0;
|
|
}
|
|
|
|
/// True iff operation is one of M, =, X, D, N
|
|
bool is_reference_consuming() @property const {
|
|
return ((CIGAR_TYPE >> ((raw & 0xF) * 2)) & 2) != 0;
|
|
}
|
|
}
|
|
|
|
/**
|
|
Represents single read
|
|
*/
|
|
struct BamRead {
|
|
|
|
mixin TagStorage;
|
|
|
|
// TODO: better names for properties
|
|
|
|
@property int ref_id() const nothrow { return _refID; }
|
|
|
|
/// 0-based leftmost coordinate of the first matching base
|
|
@property int position() const nothrow { return _pos; }
|
|
|
|
/// Indexing bin which this read belongs to.
|
|
@property Bin bin() const nothrow { return Bin(_bin); }
|
|
|
|
/// Mapping quality. Equals to 255 if not available, otherwise
|
|
/// equals to rounded -10 * log10(P {mapping position is wrong}).
|
|
@property ubyte mapping_quality() const nothrow { return _mapq; }
|
|
|
|
@property ushort flag() const nothrow { return _flag; }
|
|
@property int sequence_length() const nothrow { return _l_seq; }
|
|
@property int next_ref_id() const nothrow { return _next_refID; }
|
|
@property int next_pos() const nothrow { return _next_pos; }
|
|
@property int template_length() const nothrow { return _tlen; }
|
|
|
|
/// Set reference id.
|
|
@property void ref_id(int n) { _dup(); _refID = n; }
|
|
/// Sets 0-based leftmost coordinate. Bin is automatically recalculated.
|
|
@property void position(int n) { _dup(); _pos = n; _recalculate_bin(); }
|
|
/// Set mapping quality
|
|
@property void mapping_quality(ubyte n) { _dup(); _mapq = n; }
|
|
/// Set flag
|
|
@property void flag(ushort n) { _dup(); _flag = n; }
|
|
/// Set mate reference id.
|
|
@property void next_ref_id(int n) { _dup(); _next_refID = n; }
|
|
/// Set mate position
|
|
@property void next_pos(int n) { _dup(); _next_pos = n; }
|
|
/// Set template length
|
|
@property void template_length(int n) { _dup(); _tlen = n; }
|
|
|
|
/// Template having multiple segments in sequencing
|
|
@property bool is_paired() const nothrow { return cast(bool)(flag & 0x1); }
|
|
/// ditto
|
|
@property void is_paired(bool b) { _setFlag( 0, b); }
|
|
|
|
/// Each segment properly aligned according to the aligner
|
|
@property bool proper_pair() const nothrow { return cast(bool)(flag & 0x2); }
|
|
/// ditto
|
|
@property void proper_pair(bool b) { _setFlag( 1, b); }
|
|
|
|
/// Segment unmapped
|
|
@property bool is_unmapped() const nothrow { return cast(bool)(flag & 0x4); }
|
|
/// ditto
|
|
@property void is_unmapped(bool b) { _setFlag( 2, b); }
|
|
|
|
/// Next segment in the template unmapped
|
|
@property bool mate_is_unmapped() const nothrow { return cast(bool)(flag & 0x8); }
|
|
/// ditto
|
|
@property void mate_is_unmapped(bool b) { _setFlag( 3, b); }
|
|
|
|
/// Sequence being reverse complemented
|
|
@property bool is_reverse_strand() const nothrow { return cast(bool)(flag & 0x10); }
|
|
/// ditto
|
|
@property void is_reverse_strand(bool b) { _setFlag( 4, b); }
|
|
|
|
/// Sequence of the next segment in the template being reversed
|
|
@property bool mate_is_reverse_strand() const nothrow { return cast(bool)(flag & 0x20); }
|
|
/// ditto
|
|
@property void mate_is_reverse_strand(bool b) { _setFlag( 5, b); }
|
|
|
|
/// The first segment in the template
|
|
@property bool is_first_of_pair() const nothrow { return cast(bool)(flag & 0x40); }
|
|
/// ditto
|
|
@property void is_first_of_pair(bool b) { _setFlag( 6, b); }
|
|
|
|
/// The last segment in the template
|
|
@property bool is_second_of_pair() const nothrow { return cast(bool)(flag & 0x80); }
|
|
/// ditto
|
|
@property void is_second_of_pair(bool b) { _setFlag( 7, b); }
|
|
|
|
/// Secondary alignment
|
|
@property bool is_secondary_alignment() const nothrow { return cast(bool)(flag & 0x100); }
|
|
/// ditto
|
|
@property void is_secondary_alignment(bool b) { _setFlag( 8, b); }
|
|
|
|
/// Not passing quality controls
|
|
@property bool failed_quality_control() const nothrow { return cast(bool)(flag & 0x200); }
|
|
/// ditto
|
|
@property void failed_quality_control(bool b) { _setFlag( 9, b); }
|
|
|
|
/// PCR or optical duplicate
|
|
@property bool is_duplicate() const nothrow { return cast(bool)(flag & 0x400); }
|
|
/// ditto
|
|
@property void is_duplicate(bool b) { _setFlag(10, b); }
|
|
|
|
/// Convenience function, returns '+' or '-' indicating the strand.
|
|
@property char strand() const nothrow {
|
|
return is_reverse_strand ? '-' : '+';
|
|
}
|
|
|
|
/// Read name
|
|
@property string read_name() const nothrow {
|
|
// notice -1: the string is zero-terminated, so we should strip that '\0'
|
|
return cast(string)(_chunk[_read_name_offset .. _read_name_offset + _l_read_name - 1]);
|
|
}
|
|
|
|
/// ditto
|
|
@property void read_name(string name) {
|
|
enforce(name.length >= 1 && name.length <= 255, "name length must be in 1-255 range");
|
|
_dup();
|
|
bio.bam.utils.array.replaceSlice(_chunk,
|
|
_chunk[_read_name_offset .. _read_name_offset + _l_read_name - 1],
|
|
cast(ubyte[])name);
|
|
_l_read_name = cast(ubyte)(name.length + 1);
|
|
}
|
|
|
|
/// List of CIGAR operations
|
|
@property const(CigarOperation)[] cigar() const nothrow {
|
|
return cast(const(CigarOperation)[])(_chunk[_cigar_offset .. _cigar_offset +
|
|
_n_cigar_op * CigarOperation.sizeof]);
|
|
}
|
|
|
|
/// ditto
|
|
@property void cigar(const(CigarOperation)[] c) {
|
|
_dup();
|
|
bio.bam.utils.array.replaceSlice(_chunk,
|
|
_chunk[_cigar_offset .. _cigar_offset + _n_cigar_op * CigarOperation.sizeof],
|
|
cast(ubyte[])c);
|
|
|
|
_n_cigar_op = cast(ushort)(c.length);
|
|
|
|
_recalculate_bin();
|
|
}
|
|
|
|
/// The number of reference bases covered
|
|
int basesCovered() const {
|
|
|
|
if (this.is_unmapped) {
|
|
return 0; // actually, valid alignments should have empty cigar string
|
|
}
|
|
|
|
return reduce!"a + b.length"(0, filter!"a.is_reference_consuming"(cigar));
|
|
}
|
|
|
|
/// Human-readable representation of CIGAR string
|
|
string cigarString() {
|
|
char[] str;
|
|
|
|
// guess size of resulting string
|
|
str.reserve(_n_cigar_op * 3);
|
|
|
|
foreach (cigar_op; cigar) {
|
|
str ~= to!string(cigar_op.length);
|
|
str ~= cigar_op.operation;
|
|
}
|
|
return cast(string)str;
|
|
}
|
|
|
|
/// Sequence data
|
|
@property const(ubyte)[] raw_sequence_data() const nothrow {
|
|
return _chunk[_seq_offset .. _seq_offset + (_l_seq + 1) / 2];
|
|
}
|
|
|
|
static struct SequenceResult {
|
|
|
|
private ubyte[] _data;
|
|
private size_t _len;
|
|
private size_t _index;
|
|
private bool _use_first_4_bits;
|
|
|
|
this(const(ubyte[]) data, size_t len, bool use_first_4_bits=true) {
|
|
_data = cast(ubyte[])data;
|
|
_len = len;
|
|
_use_first_4_bits = use_first_4_bits;
|
|
}
|
|
|
|
@property bool empty() const {
|
|
return _index >= _len;
|
|
}
|
|
|
|
@property Base front() const {
|
|
return opIndex(0);
|
|
}
|
|
|
|
@property Base back() const {
|
|
return opIndex(_len - 1);
|
|
}
|
|
|
|
private auto _getActualPosition(size_t index) const
|
|
{
|
|
if (_use_first_4_bits) {
|
|
// [0 1] [2 3] [4 5] [6 7] ...
|
|
// |
|
|
// V
|
|
// 0 1 2 3
|
|
return index >> 1;
|
|
} else {
|
|
// [. 0] [1 2] [3 4] [5 6] ...
|
|
// |
|
|
// V
|
|
// 0 1 2 3
|
|
return (index >> 1) + (index & 1);
|
|
}
|
|
}
|
|
|
|
private auto _useFirst4Bits(size_t index) const
|
|
{
|
|
auto res = index % 2 == 0;
|
|
if (!_use_first_4_bits) {
|
|
res = !res;
|
|
}
|
|
return res;
|
|
}
|
|
|
|
@property SequenceResult save() const {
|
|
return SequenceResult(_data[_getActualPosition(_index) .. $],
|
|
_len - _index,
|
|
_useFirst4Bits(_index));
|
|
}
|
|
|
|
SequenceResult opSlice(size_t i, size_t j) const {
|
|
return SequenceResult(_data[_getActualPosition(_index + i) .. $],
|
|
j - i,
|
|
_useFirst4Bits(_index + i));
|
|
}
|
|
|
|
@property Base opIndex(size_t i) const {
|
|
auto pos = _index + i;
|
|
ubyte raw = _data[_getActualPosition(pos)];
|
|
if (_use_first_4_bits) {
|
|
if (pos & 1) {
|
|
raw &= 0xF;
|
|
} else {
|
|
raw >>= 4;
|
|
}
|
|
} else {
|
|
if (pos & 1) {
|
|
raw >>= 4;
|
|
} else {
|
|
raw &= 0xF;
|
|
}
|
|
}
|
|
return Base.fromInternalCode(raw);
|
|
}
|
|
|
|
void popFront() {
|
|
++_index;
|
|
}
|
|
|
|
void popBack() {
|
|
--_len;
|
|
}
|
|
|
|
@property size_t length() const {
|
|
return _len - _index;
|
|
}
|
|
}
|
|
|
|
/// Random-access range of characters
|
|
@property auto sequence() const {
|
|
return SequenceResult(raw_sequence_data, sequence_length);
|
|
}
|
|
|
|
static assert(isRandomAccessRange!(ReturnType!sequence));
|
|
|
|
/// Set sequence. Must be of the same length as current sequence.
|
|
@property void sequence(string seq) {
|
|
|
|
enforce(seq.length == _l_seq, "Sequence must have the same length as current");
|
|
|
|
_dup();
|
|
|
|
auto _raw_length = (seq.length + 1) / 2;
|
|
// set sequence
|
|
ubyte[] _seq = _chunk[_seq_offset .. _seq_offset + _raw_length];
|
|
for (size_t i = 0; i < _raw_length; ++i) {
|
|
_seq[i] = cast(ubyte)(Base(seq[2 * i]).internal_code << 4);
|
|
|
|
if (seq.length > 2 * i + 1)
|
|
_seq[i] |= cast(ubyte)(Base(seq[2 * i + 1]).internal_code);
|
|
}
|
|
}
|
|
|
|
/// Quality data
|
|
@property const(ubyte)[] phred_base_quality() const nothrow {
|
|
return _chunk[_qual_offset .. _qual_offset + _l_seq * char.sizeof];
|
|
}
|
|
|
|
/// Set quality data - array length must be of the same length as the sequence.
|
|
@property void phred_base_quality(const(ubyte)[] quality) {
|
|
enforce(quality.length == _l_seq, "Quality data must be of the same length as sequence");
|
|
_dup();
|
|
_chunk[_qual_offset .. _qual_offset + _l_seq] = quality;
|
|
}
|
|
|
|
/**
|
|
Constructs the struct from memory chunk
|
|
*/
|
|
this(ubyte[] chunk) {
|
|
|
|
// Switching endianness lazily is not a good idea:
|
|
//
|
|
// 1) switching byte order is pretty fast
|
|
// 2) lazy switching for arrays can kill the performance,
|
|
// it has to be done once
|
|
// 3) the code will be too complicated, whereas there're
|
|
// not so many users of big-endian systems
|
|
//
|
|
// In summa, BAM is little-endian format, so big-endian
|
|
// users will suffer anyway, it's unavoidable.
|
|
|
|
this._is_slice = true;
|
|
|
|
_chunk = chunk;
|
|
if (std.system.endian != Endian.littleEndian) {
|
|
// First 8 fields are 32-bit integers:
|
|
//
|
|
// 0) refID int
|
|
// 1) pos int
|
|
// 2) bin_mq_nl uint
|
|
// 3) flag_nc uint
|
|
// 4) l_seq int
|
|
// 5) next_refID int
|
|
// 6) next_pos int
|
|
// 7) tlen int
|
|
// ----------------------------------------------------
|
|
// (after them read_name follows which is string)
|
|
//
|
|
switchEndianness(_chunk.ptr, 8 * uint.sizeof);
|
|
|
|
// Then we need to switch endianness of CIGAR data:
|
|
switchEndianness(_chunk.ptr + _cigar_offset,
|
|
_n_cigar_op * uint.sizeof);
|
|
|
|
// Dealing with tags is the responsibility of TagStorage.
|
|
}
|
|
|
|
// create from chunk of little-endian memory
|
|
if (std.system.endian != Endian.littleEndian) {
|
|
fixTagStorageByteOrder();
|
|
}
|
|
}
|
|
|
|
private size_t calculateChunkSize(string read_name,
|
|
string sequence,
|
|
in CigarOperation[] cigar)
|
|
{
|
|
return 8 * int.sizeof
|
|
+ (read_name.length + 1) // tailing '\0'
|
|
+ uint.sizeof * cigar.length
|
|
+ ubyte.sizeof * ((sequence.length + 1) / 2)
|
|
+ ubyte.sizeof * sequence.length;
|
|
}
|
|
|
|
/// Construct alignment from basic information about it.
|
|
///
|
|
/// Other fields can be set afterwards.
|
|
this(string read_name, // info for developers:
|
|
string sequence, // these 3 fields are needed
|
|
in CigarOperation[] cigar) // to calculate size of _chunk
|
|
{
|
|
enforce(read_name.length < 256, "Too long read name, length must be <= 255");
|
|
|
|
this._is_slice = false;
|
|
|
|
if (this._chunk is null) {
|
|
this._chunk = new ubyte[calculateChunkSize(read_name, sequence, cigar)];
|
|
}
|
|
|
|
this._refID = -1; // set default values
|
|
this._pos = -1; // according to SAM/BAM
|
|
this._mapq = 255; // specification
|
|
this._next_refID = -1;
|
|
this._next_pos = -1;
|
|
this._tlen = 0;
|
|
|
|
this._l_read_name = cast(ubyte)(read_name.length + 1); // tailing '\0'
|
|
this._n_cigar_op = cast(ushort)(cigar.length);
|
|
this._l_seq = cast(int)(sequence.length);
|
|
|
|
// now all offsets can be calculated through corresponding properties
|
|
|
|
// set default quality
|
|
_chunk[_qual_offset .. _qual_offset + sequence.length] = 0xFF;
|
|
|
|
// set CIGAR data
|
|
auto _len = cigar.length * CigarOperation.sizeof;
|
|
_chunk[_cigar_offset .. _cigar_offset + _len] = cast(ubyte[])(cigar);
|
|
|
|
// set read_name
|
|
auto _offset = _read_name_offset;
|
|
_chunk[_offset .. _offset + read_name.length] = cast(ubyte[])read_name;
|
|
_chunk[_offset + read_name.length] = cast(ubyte)'\0';
|
|
|
|
this.sequence = sequence;
|
|
}
|
|
|
|
/// Low-level constructor for setting tag data on construction.
|
|
/// This allows to use less reallocations when creating an alignment
|
|
/// from scratch, by reusing memory for collecting tags.
|
|
/// Typically, you would use this constructor in conjunction with
|
|
/// utils.tagstoragebuilder module.
|
|
this(string read_name,
|
|
string sequence,
|
|
in CigarOperation[] cigar,
|
|
in ubyte[] tag_data)
|
|
{
|
|
_chunk = new ubyte[calculateChunkSize(read_name, sequence, cigar)
|
|
+ tag_data.length];
|
|
this(read_name, sequence, cigar);
|
|
_chunk[_tags_offset .. $] = tag_data;
|
|
}
|
|
|
|
/// Deep copy of an alignment.
|
|
BamRead dup() @property const {
|
|
BamRead result;
|
|
result._chunk = this._chunk.dup;
|
|
result._is_slice = false;
|
|
return result;
|
|
}
|
|
|
|
/// Compare two alignments, including tags
|
|
/// (they must be in the same order for equality).
|
|
bool opEquals(const ref BamRead other) const pure nothrow {
|
|
// in D, array comparison compares elements, not pointers.
|
|
return this._chunk == other._chunk;
|
|
}
|
|
|
|
/// ditto
|
|
bool opEquals(BamRead other) const pure nothrow {
|
|
return this._chunk == other._chunk;
|
|
}
|
|
|
|
/// Size of alignment when output to stream in BAM format.
|
|
/// Includes block_size as well (see SAM/BAM specification)
|
|
@property auto size_in_bytes() const {
|
|
return int.sizeof + _chunk.length;
|
|
}
|
|
|
|
/// Write alignment to EndianStream, together with block_size
|
|
/// and auxiliary data.
|
|
void write(EndianStream stream) {
|
|
stream.write(cast(int)(_chunk.length));
|
|
stream.writeExact(_chunk.ptr, _tags_offset);
|
|
writeTags(stream);
|
|
}
|
|
|
|
////////////////////////////////////////////////////////////////////////////
|
|
///
|
|
/// Packs message in the following format:
|
|
/// MsgPack array with elements
|
|
/// 0) read name - string
|
|
/// 1) flag - ushort
|
|
/// 2) reference sequence id - int
|
|
/// 3) leftmost mapping position (1-based) - int
|
|
/// 4) mapping quality - ubyte
|
|
/// 5,6) CIGAR:
|
|
/// array of lengths (int[])
|
|
/// array of operations (ubyte[])
|
|
/// 7) mate reference sequence id - int
|
|
/// 8) mate position (1-based) - int
|
|
/// 9) template length - int
|
|
/// 10) segment sequence - string
|
|
/// 11) phred-base quality - array of ubyte
|
|
/// 12) tags - map: string -> value
|
|
///
|
|
////////////////////////////////////////////////////////////////////////////
|
|
void toMsgpack(Packer)(ref Packer packer) const {
|
|
packer.beginArray(13);
|
|
packer.pack(cast(ubyte[])read_name);
|
|
packer.pack(flag);
|
|
packer.pack(ref_id);
|
|
packer.pack(position + 1);
|
|
packer.pack(mapping_quality);
|
|
packer.pack(array(map!"a.length"(cigar)));
|
|
packer.pack(array(map!"a.operation"(cigar)));
|
|
packer.pack(next_ref_id);
|
|
packer.pack(next_pos);
|
|
packer.pack(template_length);
|
|
packer.pack(to!string(sequence));
|
|
packer.pack(phred_base_quality);
|
|
|
|
packer.beginMap(tagCount());
|
|
foreach (key, value; this) {
|
|
packer.pack(key);
|
|
packer.pack(value);
|
|
}
|
|
}
|
|
|
|
ubyte[] _chunk; /// holds all the data,
|
|
/// the access is organized via properties
|
|
/// (see below)
|
|
|
|
private:
|
|
|
|
bool _is_slice; /// indicates whether _chunk is a slice or an allocated array.
|
|
|
|
/// Official field names from SAM/BAM specification.
|
|
/// For internal use only
|
|
|
|
@property int _refID() const nothrow {
|
|
return *(cast( int*)(_chunk.ptr + int.sizeof * 0));
|
|
}
|
|
|
|
@property int _pos() const nothrow {
|
|
return *(cast( int*)(_chunk.ptr + int.sizeof * 1));
|
|
}
|
|
|
|
@property uint _bin_mq_nl() const nothrow {
|
|
return *(cast(uint*)(_chunk.ptr + int.sizeof * 2));
|
|
}
|
|
|
|
@property uint _flag_nc() const nothrow {
|
|
return *(cast(uint*)(_chunk.ptr + int.sizeof * 3));
|
|
}
|
|
|
|
@property int _l_seq() const nothrow {
|
|
return *(cast( int*)(_chunk.ptr + int.sizeof * 4));
|
|
}
|
|
|
|
@property int _next_refID() const nothrow {
|
|
return *(cast( int*)(_chunk.ptr + int.sizeof * 5));
|
|
}
|
|
|
|
@property int _next_pos() const nothrow {
|
|
return *(cast( int*)(_chunk.ptr + int.sizeof * 6));
|
|
}
|
|
|
|
@property int _tlen() const nothrow {
|
|
return *(cast( int*)(_chunk.ptr + int.sizeof * 7));
|
|
}
|
|
|
|
/// Setters, also only for internal use
|
|
@property void _refID(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 0)) = n; }
|
|
@property void _pos(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 1)) = n; }
|
|
@property void _bin_mq_nl(uint n) { *(cast(uint*)(_chunk.ptr + int.sizeof * 2)) = n; }
|
|
@property void _flag_nc(uint n) { *(cast(uint*)(_chunk.ptr + int.sizeof * 3)) = n; }
|
|
@property void _l_seq(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 4)) = n; }
|
|
@property void _next_refID(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 5)) = n; }
|
|
@property void _next_pos(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 6)) = n; }
|
|
@property void _tlen(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 7)) = n; }
|
|
|
|
/// Additional useful properties, also from SAM/BAM specification
|
|
///
|
|
/// The layout of bin_mq_nl and flag_nc is as follows
|
|
/// (upper bits -------> lower bits):
|
|
///
|
|
/// bin_mq_nl [ { bin (16b) } { mapping quality (8b) } { read name length (8b) } ]
|
|
///
|
|
/// flag_nc [ { flag (16b) } { n_cigar_op (16b) } ]
|
|
///
|
|
@property ushort _bin() const nothrow {
|
|
return _bin_mq_nl >> 16;
|
|
}
|
|
@property ubyte _mapq() const nothrow {
|
|
return (_bin_mq_nl >> 8) & 0xFF;
|
|
}
|
|
@property ubyte _l_read_name() const nothrow {
|
|
return _bin_mq_nl & 0xFF;
|
|
}
|
|
@property ushort _flag() const nothrow {
|
|
return _flag_nc >> 16;
|
|
}
|
|
@property ushort _n_cigar_op() const nothrow {
|
|
return _flag_nc & 0xFFFF;
|
|
}
|
|
|
|
/// Setters for those properties
|
|
@property void _bin(ushort n) { _bin_mq_nl = (_bin_mq_nl & 0xFFFF) | (n << 16); }
|
|
@property void _mapq(ubyte n) { _bin_mq_nl = (_bin_mq_nl & ~0xFF00) | (n << 8); }
|
|
@property void _l_read_name(ubyte n) { _bin_mq_nl = (_bin_mq_nl & ~0xFF ) | n; }
|
|
@property void _flag(ushort n) { _flag_nc = (_flag_nc & 0xFFFF) | (n << 16); }
|
|
@property void _n_cigar_op(ushort n) { _flag_nc = (_flag_nc & ~0xFFFF) | n; }
|
|
|
|
/// Offsets of various arrays in bytes.
|
|
/// Currently, are computed each time, so if speed will be an issue,
|
|
/// they can be made fields instead of properties.
|
|
@property size_t _read_name_offset() const nothrow {
|
|
return 8 * int.sizeof;
|
|
}
|
|
|
|
@property size_t _cigar_offset() const nothrow {
|
|
return _read_name_offset + _l_read_name * char.sizeof;
|
|
}
|
|
|
|
@property size_t _seq_offset() const nothrow {
|
|
return _cigar_offset + _n_cigar_op * uint.sizeof;
|
|
}
|
|
|
|
@property size_t _qual_offset() const nothrow {
|
|
return _seq_offset + (_l_seq + 1) / 2 * ubyte.sizeof;
|
|
}
|
|
/// Offset of auxiliary data
|
|
@property size_t _tags_offset() const nothrow {
|
|
return _qual_offset + _l_seq * char.sizeof;
|
|
}
|
|
|
|
/// Sets n-th flag bit to boolean value b.
|
|
void _setFlag(int n, bool b) {
|
|
assert(n < 16);
|
|
// http://graphics.stanford.edu/~seander/bithacks.html#ConditionalSetOrClearBitsWithoutBranching
|
|
ushort mask = cast(ushort)(1 << n);
|
|
_flag = (_flag & ~mask) | ((-cast(int)b) & mask);
|
|
}
|
|
|
|
/// If _chunk is still a slice, not an array, duplicate it.
|
|
/// Used when some part of alignment record is modified by user.
|
|
///
|
|
/// Basically, it's sort of copy-on-write: a lot of read-only alignments
|
|
/// may point to the same location, but every modified one allocates its
|
|
/// own chunk of memory.
|
|
void _dup() {
|
|
if (_is_slice) {
|
|
_is_slice = false;
|
|
_chunk = _chunk.dup;
|
|
}
|
|
}
|
|
|
|
/// Calculates bin number.
|
|
void _recalculate_bin() {
|
|
_bin = reg2bin(position, position + basesCovered());
|
|
}
|
|
}
|
|
|
|
|
|
///////////////////////////////////////////////////////////////////////////////
|
|
///
|
|
/// Lazy tag storage.
|
|
///
|
|
/// Provides hash-like access (currently read-only) and opportunity to iterate
|
|
/// storage like an associative array.
|
|
///
|
|
///////////////////////////////////////////////////////////////////////////////
|
|
mixin template TagStorage() {
|
|
|
|
////////////////////////////////////////////////////////////////////////////
|
|
///
|
|
/// Provides access to chunk of memory which contains tags
|
|
/// This way, every time _tags_offset gets updated
|
|
/// (due to update of cigar string of read name and memory move),
|
|
/// the change is reflected automatically in tag storage.
|
|
///
|
|
////////////////////////////////////////////////////////////////////////////
|
|
private @property const(ubyte)[] _tags_chunk() const {
|
|
return _chunk[_tags_offset .. $];
|
|
}
|
|
|
|
////////////////////////////////////////////////////////////////////////////
|
|
///
|
|
/// Hash-like access to tags. Time complexity is O(#tags).
|
|
///
|
|
////////////////////////////////////////////////////////////////////////////
|
|
Value opIndex(string key) const {
|
|
enforce(key.length == 2, "Key length must be 2");
|
|
auto __tags_chunk = _tags_chunk; // _tags_chunk is evaluated lazily
|
|
if (__tags_chunk.length < 4)
|
|
return Value(null);
|
|
|
|
size_t offset = 0;
|
|
while (offset + 1 < __tags_chunk.length) {
|
|
if (__tags_chunk[offset .. offset + 2] == key) {
|
|
offset += 2;
|
|
return readValue(offset, __tags_chunk);
|
|
} else {
|
|
offset += 2;
|
|
skipValue(offset, __tags_chunk);
|
|
}
|
|
}
|
|
return Value(null);
|
|
}
|
|
|
|
/// ditto
|
|
void opIndexAssign(T)(T value, string key)
|
|
if (is(T == Value) || __traits(compiles, GetTypeId!T))
|
|
{
|
|
static if(is(T == Value)) {
|
|
enforce(key.length == 2, "Key length must be 2");
|
|
auto __tags_chunk = _tags_chunk;
|
|
|
|
_dup();
|
|
|
|
size_t offset = 0;
|
|
while (offset + 1 < __tags_chunk.length) {
|
|
if (__tags_chunk[offset .. offset + 2] == key) {
|
|
replaceValueAt(offset + 2, value);
|
|
return;
|
|
} else {
|
|
offset += 2;
|
|
skipValue(offset, __tags_chunk);
|
|
}
|
|
}
|
|
|
|
appendTag(key, value);
|
|
} else {
|
|
opIndexAssign(Value(value), key);
|
|
}
|
|
}
|
|
|
|
/// Append new tag to the end, skipping check if it already exists. O(1)
|
|
void appendTag(string key, Value value) {
|
|
auto oldlen = _chunk.length;
|
|
_chunk.length = _chunk.length + sizeInBytes(value) + 2 * char.sizeof;
|
|
_chunk[oldlen .. oldlen + 2] = cast(ubyte[])key;
|
|
emplaceValue(_chunk.ptr + oldlen + 2, value);
|
|
}
|
|
|
|
/// Remove all tags
|
|
void clearAllTags() {
|
|
_chunk.length = _tags_offset;
|
|
}
|
|
|
|
/// Number of tags
|
|
size_t tagCount() {
|
|
size_t result = 0;
|
|
size_t offset = 0;
|
|
auto __tags_chunk = _tags_chunk;
|
|
while (offset + 1 < __tags_chunk.length) {
|
|
offset += 2;
|
|
skipValue(offset, __tags_chunk);
|
|
result += 1;
|
|
}
|
|
return result;
|
|
}
|
|
|
|
/// replace existing tag
|
|
private void replaceValueAt(size_t offset, Value value) {
|
|
// offset points to the beginning of the value
|
|
auto begin = offset;
|
|
auto __tags_chunk = _tags_chunk;
|
|
skipValue(offset, __tags_chunk); // now offset is updated and points to the end
|
|
auto end = offset;
|
|
|
|
prepareSlice(_chunk, __tags_chunk[begin .. end], sizeInBytes(value));
|
|
|
|
emplaceValue(_chunk.ptr + _tags_offset + begin, value);
|
|
}
|
|
|
|
/////////////////////////////////////////////////////////////////////////////
|
|
/// Provides opportunity to iterate over tags.
|
|
/////////////////////////////////////////////////////////////////////////////
|
|
int opApply(scope int delegate(const ref string k, const ref Value v) dg) const {
|
|
size_t offset = 0;
|
|
auto __tags_chunk = _tags_chunk;
|
|
while (offset + 1 < __tags_chunk.length) {
|
|
auto key = cast(string)__tags_chunk[offset .. offset + 2];
|
|
offset += 2;
|
|
auto val = readValue(offset, __tags_chunk);
|
|
auto res = dg(key, val);
|
|
if (res != 0) {
|
|
return res;
|
|
}
|
|
}
|
|
return 0;
|
|
}
|
|
|
|
////////////////////////////////////////////////////////////////////////////
|
|
/// Returns the number of tags. Time complexity is O(#tags)
|
|
////////////////////////////////////////////////////////////////////////////
|
|
size_t tagCount() const {
|
|
size_t res = 0;
|
|
size_t offset = 0;
|
|
auto __tags_chunk = _tags_chunk;
|
|
while (offset + 1 < __tags_chunk.length) {
|
|
offset += 2;
|
|
skipValue(offset, __tags_chunk);
|
|
res += 1;
|
|
}
|
|
return res;
|
|
}
|
|
|
|
/// Writes auxiliary data to output stream
|
|
private void writeTags(Stream stream) {
|
|
if (std.system.endian == Endian.littleEndian) {
|
|
stream.writeExact(_tags_chunk.ptr, _tags_chunk.length);
|
|
} else {
|
|
fixTagStorageByteOrder(); // FIXME: should modify on-the-fly
|
|
stream.writeExact(_tags_chunk.ptr, _tags_chunk.length); // during writing to the stream
|
|
fixTagStorageByteOrder();
|
|
}
|
|
}
|
|
|
|
////////////////////////////////////////////////////////////////////////////
|
|
/// Reads value which starts from (_tags_chunk.ptr + offset) address,
|
|
/// and updates offset to the end of value. O(1)
|
|
////////////////////////////////////////////////////////////////////////////
|
|
private Value readValue(ref size_t offset, const(ubyte)[] tags_chunk) const {
|
|
|
|
string readValueArrayTypeHelper() {
|
|
char[] cases;
|
|
foreach (c2t; ArrayElementTagValueTypes) {
|
|
cases ~=
|
|
"case '"~c2t.ch~"':".dup~
|
|
" auto begin = offset;"~
|
|
" auto end = offset + length * "~c2t.ValueType.stringof~".sizeof;"~
|
|
" offset = end;"~
|
|
" return Value(cast("~c2t.ValueType.stringof~"[])(tags_chunk[begin .. end]));";
|
|
}
|
|
return to!string("switch (elem_type) {" ~ cases ~
|
|
" default: throw new UnknownTagTypeException(to!string(elem_type));"~
|
|
"}");
|
|
}
|
|
|
|
string readValuePrimitiveTypeHelper() {
|
|
char[] cases;
|
|
foreach (c2t; PrimitiveTagValueTypes) {
|
|
cases ~= "case '"~c2t.ch~"':"~
|
|
" auto p = tags_chunk.ptr + offset;"~
|
|
" auto value = *(cast("~c2t.ValueType.stringof~"*)p);"~
|
|
" offset += value.sizeof;"~
|
|
" return Value(value);".dup;
|
|
}
|
|
return to!string("switch (type) {" ~ cases ~
|
|
" default: throw new UnknownTagTypeException(to!string(type));"~
|
|
"}");
|
|
}
|
|
|
|
char type = cast(char)tags_chunk[offset++];
|
|
if (type == 'Z' || type == 'H') {
|
|
auto begin = offset;
|
|
while (tags_chunk[offset++] != 0) {}
|
|
// return string with stripped '\0'
|
|
auto v = Value(cast(string)tags_chunk[begin .. offset - 1]);
|
|
if (type == 'H') {
|
|
v.setHexadecimalFlag();
|
|
}
|
|
return v;
|
|
} else if (type == 'B') {
|
|
char elem_type = cast(char)tags_chunk[offset++];
|
|
uint length = *(cast(uint*)(tags_chunk.ptr + offset));
|
|
offset += uint.sizeof;
|
|
mixin(readValueArrayTypeHelper());
|
|
} else {
|
|
mixin(readValuePrimitiveTypeHelper());
|
|
}
|
|
}
|
|
|
|
/**
|
|
Increases offset so that it points to the next value. O(1).
|
|
*/
|
|
private void skipValue(ref size_t offset, const(ubyte)[] tags_chunk) const {
|
|
char type = cast(char)tags_chunk[offset++];
|
|
if (type == 'Z' || type == 'H') {
|
|
while (tags_chunk[offset++] != 0) {}
|
|
} else if (type == 'B') {
|
|
char elem_type = cast(char)tags_chunk[offset++];
|
|
auto length = *(cast(uint*)(tags_chunk.ptr + offset));
|
|
offset += uint.sizeof + charToSizeof(elem_type) * length;
|
|
} else {
|
|
offset += charToSizeof(type);
|
|
}
|
|
}
|
|
|
|
/**
|
|
Intended to be used in constructor for initial endianness fixing
|
|
in case the library is used on big-endian system.
|
|
|
|
NOT TESTED AT ALL!!!
|
|
*/
|
|
private void fixTagStorageByteOrder() {
|
|
/* TODO: TEST ON BIG-ENDIAN SYSTEM!!! */
|
|
const(ubyte)* p = _tags_chunk.ptr;
|
|
const(ubyte)* end = p + _chunk.length;
|
|
while (p < end) {
|
|
p += 2; // skip tag name
|
|
char type = *(cast(char*)p);
|
|
++p; // skip type
|
|
if (type == 'Z' || type == 'H') {
|
|
while (*p != 0) { // zero-terminated
|
|
++p; // string
|
|
}
|
|
++p; // skip '\0'
|
|
} else if (type == 'B') { // array
|
|
char elem_type = *(cast(char*)p);
|
|
uint size = charToSizeof(elem_type);
|
|
switchEndianness(p, uint.sizeof);
|
|
uint length = *(cast(uint*)p);
|
|
p += uint.sizeof; // skip length
|
|
if (size != 1) {
|
|
for (auto j = 0; j < length; j++) {
|
|
switchEndianness(p, size);
|
|
p += size;
|
|
}
|
|
} else {
|
|
// skip
|
|
p += length;
|
|
}
|
|
} else {
|
|
uint size = charToSizeof(type);
|
|
if (size != 1) {
|
|
switchEndianness(p, size);
|
|
p += size;
|
|
} else {
|
|
++p;
|
|
}
|
|
}
|
|
}
|
|
}
|
|
}
|
|
|
|
unittest {
|
|
import std.algorithm;
|
|
import std.stdio;
|
|
import std.math;
|
|
|
|
auto read = BamRead("readname",
|
|
"AGCTGACTACGTAATAGCCCTA",
|
|
[CigarOperation(22, 'M')]);
|
|
assert(read.sequence_length == 22);
|
|
assert(read.cigar.length == 1);
|
|
assert(read.cigarString() == "22M");
|
|
assert(read.read_name == "readname");
|
|
assert(equal(read.sequence(), "AGCTGACTACGTAATAGCCCTA"));
|
|
|
|
read.read_name = "anothername";
|
|
assert(read.read_name == "anothername");
|
|
assert(read.cigarString() == "22M");
|
|
|
|
read.phred_base_quality = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
|
|
13, 14, 15, 16, 17, 18, 19, 20, 21, 22];
|
|
assert(reduce!"a+b"(0, read.phred_base_quality) == 253);
|
|
|
|
read.cigar = [CigarOperation(20, 'M'), CigarOperation(2, 'X')];
|
|
assert(read.cigarString() == "20M2X");
|
|
|
|
read.sequence = "AGCTGGCTACGTAATAGCCCTA";
|
|
assert(equal(read.sequence(), "AGCTGGCTACGTAATAGCCCTA"));
|
|
assert(retro(read.sequence)[3] == 'C');
|
|
assert(retro(read.sequence)[1] == 'T');
|
|
assert(read.sequence[4] == 'G');
|
|
assert(read.sequence[0] == 'A');
|
|
assert(equal(read.sequence[0..8], "AGCTGGCT"));
|
|
assert(equal(read.sequence[3..5], "TG"));
|
|
assert(equal(read.sequence[3..9][1..4], "GGC"));
|
|
|
|
read["RG"] = 15;
|
|
assert(read["RG"] == 15);
|
|
|
|
read["X1"] = [1, 2, 3, 4, 5];
|
|
assert(read["X1"] == [1, 2, 3, 4, 5]);
|
|
|
|
read["RG"] = cast(float)5.6;
|
|
assert(approxEqual(to!float(read["RG"]), 5.6));
|
|
|
|
read["X1"] = 42;
|
|
assert(read["X1"] == 42);
|
|
|
|
assert(read.tagCount() == 2);
|
|
|
|
// Test tagstoragebuilder
|
|
|
|
auto builder = new TagStorageBuilder();
|
|
builder.put("X0", Value(24));
|
|
builder.put("X1", Value("abcd"));
|
|
builder.put("X2", Value([1,2,3]));
|
|
|
|
read = BamRead("readname",
|
|
"AGCTGACTACGTAATAGCCCTA",
|
|
[CigarOperation(22, 'M')],
|
|
builder.data);
|
|
assert(read["X0"] == 24);
|
|
assert(read["X1"] == "abcd");
|
|
assert(read["X2"] == [1,2,3]);
|
|
assert(read.tagCount() == 3);
|
|
|
|
// Test MsgPack serialization/deserialization
|
|
|
|
{
|
|
import std.typecons;
|
|
auto packer = bio.bam.thirdparty.msgpack.packer(Appender!(ubyte[])());
|
|
read.toMsgpack(packer);
|
|
auto data = packer.stream.data;
|
|
auto rec = unpack(data).via.array;
|
|
assert(rec[0] == "readname");
|
|
assert(rec[5].as!(int[]) == [22]);
|
|
assert(rec[6].as!(ubyte[]) == ['M']);
|
|
assert(rec[10].as!(ubyte[]) == to!string(read.sequence));
|
|
}
|
|
|
|
read.clearAllTags();
|
|
assert(read.tagCount() == 0);
|
|
}
|
|
|
|
/// BamRead wrapper which precomputes $(D end_position) = $(D position) + $(D basesCovered()).
|
|
///
|
|
/// Computation of basesCovered() takes quite a few cycles. Therefore in places where this
|
|
/// property is frequently accessed, it makes sense to precompute it for later use.
|
|
///
|
|
/// The idea is that this should be a drop-in replacement for BamRead in algorithms,
|
|
/// as the struct uses 'alias this' construction for the wrapped read.
|
|
struct EagerBamRead {
|
|
this(BamRead read) {
|
|
this.read = read;
|
|
this.end_position = read.position + read.basesCovered();
|
|
}
|
|
|
|
///
|
|
BamRead read;
|
|
///
|
|
alias read this;
|
|
|
|
/// End position on the reference, computed as position + basesCovered().
|
|
int end_position;
|
|
|
|
EagerBamRead dup() @property const {
|
|
return EagerBamRead(read.dup);
|
|
}
|
|
}
|
|
|