You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.

1584 lines
53 KiB

This file is part of BioD.
Copyright (C) 2012-2016 Artem Tarasov <>
Permission is hereby granted, free of charge, to any person obtaining a
copy of this software and associated documentation files (the "Software"),
to deal in the Software without restriction, including without limitation
the rights to use, copy, modify, merge, publish, distribute, sublicense,
and/or sell copies of the Software, and to permit persons to whom the
Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
/// $(P $(D BamRead) type provides convenient interface for working with SAM/BAM records.)
/// $(P All flags, tags, and fields can be accessed and modified.)
/// Examples:
/// ---------------------------
/// import std.conv;
/// ...
/// assert(!read.is_unmapped); // check flag
/// assert(read.ref_id != -1); // access field
/// int edit_distance = to!int(read["NM"]); // access tag
/// read["NM"] = 0; // modify tag
/// read["NM"] = null; // remove tag
/// read["NM"] = null; // no-op
/// foreach (tag, value; read) // iterate over tags
/// writeln(tag, " ", value); // and print their keys and values
/// read.sequence = "AGCAGACTACGTGTGCATAC"; // sets base qualities to 255
/// assert(read.base_qualities[0] == 255);
/// read.is_unmapped = true; // set flag
/// read.ref_id = -1; // set field
/// ---------------------------
import bio.core.base;
import bio.core.utils.format;
import bio.bam.abstractreader;
import bio.bam.cigar;
import bio.bam.writer;
import bio.bam.tagvalue;
import bio.bam.bai.bin;
import bio.bam.utils.array;
import bio.bam.utils.value;
import bio.core.utils.switchendianness;
import bio.bam.thirdparty.msgpack : Packer, unpack;
import std.algorithm;
import std.range;
import std.conv;
import std.format;
import std.exception;
import std.system;
import std.traits;
import std.array;
import std.bitmanip;
import core.stdc.stdlib;
BAM record representation.
struct BamRead {
mixin TagStorage;
/// Reference index in BAM file header
@property int ref_id() const nothrow { return _refID; }
/// ditto
@property void ref_id(int n) { _dup(); _refID = n; }
/// Reference sequence name ('*' for unmapped reads)
@property string ref_name() const nothrow { return _ref_id_to_string(ref_id); }
/// 0-based leftmost coordinate of the first matching base
@property int position() const nothrow { return _pos; }
/// ditto
@property void position(int n) { _dup(); _pos = n; _recalculate_bin(); }
/// Indexing bin which this read belongs to. Recalculated when position is changed.
@property bio.bam.bai.bin.Bin bin() const nothrow { return Bin(_bin); }
/// Mapping quality. Equals to 255 if not available, otherwise
/// equals to rounded -10 * log10(P {mapping position is wrong}).
@property ubyte mapping_quality() const nothrow { return _mapq; }
/// ditto
@property void mapping_quality(ubyte n) { _dup(); _mapq = n; }
/// Flag bits (should be used on very rare occasions, see flag getters/setters below)
@property ushort flag() const nothrow { return _flag; }
/// ditto
@property void flag(ushort n) { _dup(); _flag = n; }
/// Sequence length. In fact, sequence.length can be used instead, but that might be
/// slower if the compiler is not smart enough to optimize away unrelated stuff.
@property int sequence_length() const nothrow { return _l_seq; }
/// Mate reference ID
@property int mate_ref_id() const nothrow { return _next_refID; }
/// ditto
@property void mate_ref_id(int n) { _dup(); _next_refID = n; }
/// Mate reference sequence name ('*' for unmapped mates)
@property string mate_ref_name() const nothrow { return _ref_id_to_string(_next_refID); }
/// Mate position
@property int mate_position() const nothrow { return _next_pos; }
/// ditto
@property void mate_position(int n) { _dup(); _next_pos = n; }
/// Template length
@property int template_length() const nothrow { return _tlen; }
/// ditto
@property void template_length(int n) { _dup(); _tlen = n; }
// ------------------------ FLAG GETTERS/SETTERS -------------------------------------- //
/// Template having multiple segments in sequencing
@property bool is_paired() const nothrow { return cast(bool)(flag & 0x1); }
/// ditto
@property void is_paired(bool b) { _setFlag( 0, b); }
/// Each segment properly aligned according to the aligner
@property bool proper_pair() const nothrow { return cast(bool)(flag & 0x2); }
/// ditto
@property void proper_pair(bool b) { _setFlag( 1, b); }
/// Segment unmapped
@property bool is_unmapped() const nothrow { return cast(bool)(flag & 0x4); }
/// ditto
@property void is_unmapped(bool b) { _setFlag( 2, b); }
/// Next segment in the template unmapped
@property bool mate_is_unmapped() const nothrow { return cast(bool)(flag & 0x8); }
/// ditto
@property void mate_is_unmapped(bool b) { _setFlag( 3, b); }
/// Sequence being reverse complemented
@property bool is_reverse_strand() const nothrow { return cast(bool)(flag & 0x10); }
/// ditto
@property void is_reverse_strand(bool b) { _setFlag( 4, b); }
/// Sequence of the next segment in the template being reversed
@property bool mate_is_reverse_strand() const nothrow { return cast(bool)(flag & 0x20); }
/// ditto
@property void mate_is_reverse_strand(bool b) { _setFlag( 5, b); }
/// The first segment in the template
@property bool is_first_of_pair() const nothrow { return cast(bool)(flag & 0x40); }
/// ditto
@property void is_first_of_pair(bool b) { _setFlag( 6, b); }
/// The last segment in the template
@property bool is_second_of_pair() const nothrow { return cast(bool)(flag & 0x80); }
/// ditto
@property void is_second_of_pair(bool b) { _setFlag( 7, b); }
/// Secondary alignment
@property bool is_secondary_alignment() const nothrow { return cast(bool)(flag & 0x100); }
/// ditto
@property void is_secondary_alignment(bool b) { _setFlag( 8, b); }
/// Not passing quality controls
@property bool failed_quality_control() const nothrow { return cast(bool)(flag & 0x200); }
/// ditto
@property void failed_quality_control(bool b) { _setFlag( 9, b); }
/// PCR or optical duplicate
@property bool is_duplicate() const nothrow { return cast(bool)(flag & 0x400); }
/// ditto
@property void is_duplicate(bool b) { _setFlag(10, b); }
/// Supplementary alignment
@property bool is_supplementary() const nothrow { return cast(bool)(flag & 0x800); }
/// ditto
@property void is_supplementary(bool b) { _setFlag(11, b); }
/// Convenience function, returns '+' or '-' indicating the strand.
@property char strand() const nothrow {
return is_reverse_strand ? '-' : '+';
/// ditto
@property void strand(char c) {
enforce(c == '-' || c == '+', "Strand must be '-' or '+'");
is_reverse_strand = c == '-';
/// Read name, length must be in 1..255 interval.
@property string name() const nothrow {
// notice -1: the string is zero-terminated, so we should strip that '\0'
return cast(string)(_chunk[_read_name_offset .. _read_name_offset + _l_read_name - 1]);
/// ditto
@property void name(string new_name) {
enforce(new_name.length >= 1 && new_name.length <= 255,
"name length must be in 1-255 range");
_chunk[_read_name_offset .. _read_name_offset + _l_read_name - 1],
_l_read_name = cast(ubyte)(new_name.length + 1);
/// List of CIGAR operations
@property const(CigarOperation)[] cigar() const nothrow {
return cast(const(CigarOperation)[])(_chunk[_cigar_offset .. _cigar_offset +
_n_cigar_op * CigarOperation.sizeof]);
/// ditto
@property void cigar(const(CigarOperation)[] c) {
enforce(c.length < 65536, "Too many CIGAR operations, must be <= 65535");
_chunk[_cigar_offset .. _cigar_offset + _n_cigar_op * CigarOperation.sizeof],
_n_cigar_op = cast(ushort)(c.length);
/// Extended CIGAR where M operators are replaced with =/X based
/// on information from MD tag. Throws if the read doesn't have MD
/// tag.
auto extended_cigar() @property const {
Value md = this["MD"];
return makeExtendedCigar(cigar, mdOperations(*cast(string*)(&md)));
/// The number of reference bases covered by this read.
/// $(BR)
/// Returns 0 if the read is unmapped.
int basesCovered() const {
if (this.is_unmapped) {
return 0; // actually, valid alignments should have empty cigar string
return reduce!"a + b.length"(0, filter!"a.is_reference_consuming"(cigar));
/// Human-readable representation of CIGAR string (same as in SAM format)
string cigarString() const {
char[] str;
// guess size of resulting string
str.reserve(_n_cigar_op * 3);
foreach (cigar_op; cigar) {
str ~= to!string(cigar_op.length);
str ~= cigar_op.type;
return cast(string)str;
private @property inout(ubyte)[] raw_sequence_data() inout nothrow {
return _chunk[_seq_offset .. _seq_offset + (_l_seq + 1) / 2];
/// Read-only random-access range for access to sequence data.
static struct SequenceResult {
private size_t _index;
private ubyte[] _data = void;
private size_t _len = void;
private bool _use_first_4_bits = void;
this(const(ubyte[]) data, size_t len, bool use_first_4_bits=true) {
_data = cast(ubyte[])data;
_len = len;
_use_first_4_bits = use_first_4_bits;
@property bool empty() const {
return _index >= _len;
@property bio.core.base.Base front() const {
return opIndex(0);
@property bio.core.base.Base back() const {
return opIndex(_len - 1);
I have no fucking idea why this tiny piece of code
does NOT get inlined by stupid DMD compiler.
Therefore I use string mixin instead.
(hell yeah! Back to the 90s! C macros rulez!)
private size_t _getActualPosition(size_t index) const
if (_use_first_4_bits) {
// [0 1] [2 3] [4 5] [6 7] ...
// |
// V
// 0 1 2 3
return index >> 1;
} else {
// [. 0] [1 2] [3 4] [5 6] ...
// |
// V
// 0 1 2 3
return (index >> 1) + (index & 1);
private static string _getActualPosition(string index) {
return "((" ~ index ~") >> 1) + " ~
"(_use_first_4_bits ? 0 : ((" ~ index ~ ") & 1))";
private bool _useFirst4Bits(size_t index) const
auto res = index % 2 == 0;
if (!_use_first_4_bits) {
res = !res;
return res;
@property SequenceResult save() const {
return SequenceResult(_data[mixin(_getActualPosition("_index")) .. $],
_len - _index,
SequenceResult opSlice(size_t i, size_t j) const {
return SequenceResult(_data[mixin(_getActualPosition("_index + i")) .. $],
j - i,
_useFirst4Bits(_index + i));
@property bio.core.base.Base opIndex(size_t i) const {
auto pos = _index + i;
if (_use_first_4_bits)
if (pos & 1)
return Base.fromInternalCode(_data[pos >> 1] & 0xF);
return Base.fromInternalCode(_data[pos >> 1] >> 4);
if (pos & 1)
return Base.fromInternalCode(_data[(pos >> 1) + 1] >> 4);
return Base.fromInternalCode(_data[pos >> 1] & 0xF);
/// ditto
@property void opIndexAssign(bio.core.base.Base base, size_t i) {
auto pos = _index + i;
if (_use_first_4_bits)
if (pos & 1)
_data[pos >> 1] &= 0xF0, _data[pos >> 1] |= base.internal_code;
_data[pos >> 1] &= 0x0F, _data[pos >> 1] |= base.internal_code << 4;
if (pos & 1)
_data[(pos >> 1) + 1] &= 0x0F, _data[(pos >> 1) + 1] |= base.internal_code << 4;
_data[pos >> 1] &= 0xF0, _data[pos >> 1] |= base.internal_code;
void popFront() {
void popBack() {
@property size_t length() const {
return _len - _index;
alias length opDollar;
void toString(scope void delegate(const(char)[]) dg) const {
char[256] buf = void;
size_t total = this.length;
size_t written = 0;
while (written < total) {
size_t n = min(buf.length, total - written);
foreach (j; 0 .. n)
buf[j] = opIndex(written + j).asCharacter;
dg(buf[0 .. n]);
written += n;
/// Random-access range of characters
@property SequenceResult sequence() const {
return SequenceResult(raw_sequence_data, sequence_length);
static assert(isRandomAccessRange!(ReturnType!sequence));
/// Sets query sequence. Sets all base qualities to 255 (i.e. unknown).
@property void sequence(string seq)
auto raw_length = (seq.length + 1) / 2;
// set sequence
auto replacement = uninitializedArray!(ubyte[])(raw_length + seq.length);
replacement[raw_length .. $] = 0xFF;
for (size_t i = 0; i < raw_length; ++i) {
replacement[i] = cast(ubyte)(Base(seq[2 * i]).internal_code << 4);
if (seq.length > 2 * i + 1)
replacement[i] |= cast(ubyte)(Base(seq[2 * i + 1]).internal_code);
_chunk[_seq_offset .. _tags_offset],
_l_seq = cast(int)seq.length;
/// Quality data (phred-based scores)
@property inout(ubyte)[] base_qualities() inout nothrow {
return _chunk[_qual_offset .. _qual_offset + _l_seq * char.sizeof];
/// Set quality data - array length must be of the same length as the sequence.
@property void base_qualities(const(ubyte)[] quality) {
enforce(quality.length == _l_seq, "Quality data must be of the same length as sequence");
_chunk[_qual_offset .. _qual_offset + _l_seq] = quality;
Constructs the struct from memory chunk
this(ubyte[] chunk, bool fix_byte_order=true) {
// Switching endianness lazily is not a good idea:
// 1) switching byte order is pretty fast
// 2) lazy switching for arrays can kill the performance,
// it has to be done once
// 3) the code will be too complicated, whereas there're
// not so many users of big-endian systems
// In summa, BAM is little-endian format, so big-endian
// users will suffer anyway, it's unavoidable.
_chunk = chunk;
this._is_slice = true;
if (fix_byte_order && std.system.endian != Endian.littleEndian) {
// Dealing with tags is the responsibility of TagStorage.
// Doesn't touch tags, only fields.
private void switchChunkEndianness() {
// First 8 fields are 32-bit integers:
// 0) refID int
// 1) pos int
// 2) bin_mq_nl uint
// 3) flag_nc uint
// 4) l_seq int
// 5) next_refID int
// 6) next_pos int
// 7) tlen int
// ----------------------------------------------------
// (after them name follows which is string)
switchEndianness(_chunk.ptr, 8 * uint.sizeof);
// Then we need to switch endianness of CIGAR data:
switchEndianness(_chunk.ptr + _cigar_offset,
_n_cigar_op * uint.sizeof);
private size_t calculateChunkSize(string read_name,
string sequence,
in CigarOperation[] cigar)
return 8 * int.sizeof
+ (read_name.length + 1) // tailing '\0'
+ uint.sizeof * cigar.length
+ ubyte.sizeof * ((sequence.length + 1) / 2)
+ ubyte.sizeof * sequence.length;
/// Construct alignment from basic information about it.
/// Other fields can be set afterwards.
this(string read_name, // info for developers:
string sequence, // these 3 fields are needed
in CigarOperation[] cigar) // to calculate size of _chunk
enforce(read_name.length < 256, "Too long read name, length must be <= 255");
enforce(cigar.length < 65536, "Too many CIGAR operations, must be <= 65535");
if (this._chunk is null) {
this._chunk = new ubyte[calculateChunkSize(read_name, sequence, cigar)];
this._refID = -1; // set default values
this._pos = -1; // according to SAM/BAM
this._mapq = 255; // specification
this._next_refID = -1;
this._next_pos = -1;
this._tlen = 0;
this._l_read_name = cast(ubyte)(read_name.length + 1); // tailing '\0'
this._n_cigar_op = cast(ushort)(cigar.length);
this._l_seq = cast(int)(sequence.length);
// now all offsets can be calculated through corresponding properties
// set default quality
_chunk[_qual_offset .. _qual_offset + sequence.length] = 0xFF;
// set CIGAR data
auto _len = cigar.length * CigarOperation.sizeof;
_chunk[_cigar_offset .. _cigar_offset + _len] = cast(ubyte[])(cigar);
// set read_name
auto _offset = _read_name_offset;
_chunk[_offset .. _offset + read_name.length] = cast(ubyte[])read_name;
_chunk[_offset + read_name.length] = cast(ubyte)'\0';
this._is_slice = false;
this.sequence = sequence;
/// Deep copy of the record.
BamRead dup() @property const {
BamRead result;
result._chunk = this._chunk.dup;
result._is_slice = false;
result._modify_in_place = false;
result._reader = cast()_reader;
return result;
/// Compare two alignments, including tags
/// (the tags must follow in the same order for equality).
bool opEquals(BamRead other) const pure nothrow {
// don't forget about _is_slice trick
auto m = _cigar_offset;
return _chunk[0 .. m - 1] == other._chunk[0 .. m - 1] &&
_chunk[m .. $] == other._chunk[m .. $];
bool opEquals(const(BamRead) other) const pure nothrow {
return opEquals(cast()other);
/// Size of the alignment record when output to stream in BAM format.
/// Includes block_size as well (see SAM/BAM specification)
@property size_t size_in_bytes() const {
return int.sizeof + _chunk.length;
package void write(BamWriter writer) {
ubyte old_byte = _chunk[_cigar_offset - 1];
_chunk[_cigar_offset - 1] = 0;
if (std.system.endian != Endian.littleEndian) {
writer.writeByteArray(_chunk[0 .. _tags_offset]);
} else {
writer.writeByteArray(_chunk[0 .. _tags_offset]);
_chunk[_cigar_offset - 1] = old_byte;
/// Packs message in the following format:
/// $(BR)
/// MsgPack array with elements
/// $(OL
/// $(LI name - string)
/// $(LI flag - ushort)
/// $(LI reference sequence id - int)
/// $(LI leftmost mapping position (1-based) - int)
/// $(LI mapping quality - ubyte)
/// $(LI array of CIGAR operation lengths - int[])
/// $(LI array of CIGAR operation types - ubyte[])
/// $(LI mate reference sequence id - int)
/// $(LI mate position (1-based) - int)
/// $(LI template length - int)
/// $(LI segment sequence - string)
/// $(LI phred-base quality - ubyte[])
/// $(LI tags - map: string -> value))
void toMsgpack(Packer)(ref Packer packer) const {
packer.pack(position + 1);
foreach (key, value; this) {
/// String representation.
/// $(BR)
/// Possible formats are SAM ("%s") and JSON ("%j")
void toString(scope void delegate(const(char)[]) sink, FormatSpec!char fmt) const {
if (size_in_bytes < 10000 && fmt.spec == 's') {
auto p = cast(char*)alloca(size_in_bytes * 5);
char* end = p;
sink(p[0 .. end - p]);
} else if (size_in_bytes < 5000 && fmt.spec == 'j') {
auto p = cast(char*)alloca(size_in_bytes * 10 + 1000);
char* end = p;
sink(p[0 .. end - p]);
} else if (fmt.spec == 's') {
} else if (fmt.spec == 'j') {
} else {
throw new FormatException("unknown format specifier");
/// ditto
void toSam(Sink)(auto ref Sink sink) const
if (isSomeSink!Sink)
if (ref_id == -1 || _reader is null)
sink.write(position + 1);
if (cigar.length == 0)
foreach (op; cigar)
if (mate_ref_id == ref_id) {
if (mate_ref_id == -1)
} else {
if (mate_ref_id == -1 || _reader is null) {
} else {
auto mate_name = _reader.reference_sequences[mate_ref_id].name;
sink.write(mate_position + 1);
if (sequence_length == 0)
foreach (char c; sequence)
if (base_qualities.length == 0 || base_qualities[0] == 0xFF)
foreach (qual; base_qualities)
sink.write(cast(char)(qual + 33));
foreach (k, v; this) {
/// ditto
string toSam()() const {
return to!string(this);
/// JSON representation
void toJson(Sink)(auto ref Sink sink) const
if (isSomeSink!Sink)
sink.write(`{"qname":`); sink.writeJson(name);
sink.write(`,"flag":`); sink.write(flag);
if (ref_id == -1 || _reader is null)
sink.write(`,"pos":`); sink.write(position + 1);
sink.write(`,"mapq":`); sink.write(mapping_quality);
if (cigar.empty)
foreach (op; cigar)
if (mate_ref_id == ref_id) {
if (mate_ref_id == -1)
} else if (mate_ref_id == -1 || _reader is null) {
} else {
sink.write(`,"pnext":`); sink.write(mate_position + 1);
sink.write(`,"tlen":`); sink.write(template_length);
if (sequence_length == 0)
foreach (char c; sequence)
bool not_first = false;
foreach (k, v; this) {
if (not_first)
not_first = true;
/// ditto
string toJson()() const {
auto w = appender!(char[])();
toJson((const(char)[] s) { w.put(s); });
return cast(string);
/// Associates read with BAM reader. This is done automatically
/// if this read is obtained through BamReader/Reference methods.
void associateWithReader(bio.bam.abstractreader.IBamSamReader reader) {
_reader = reader;
/// Associated BAM/SAM reader.
inout(bio.bam.abstractreader.IBamSamReader) reader() @property inout {
return _reader;
bool is_slice_backed() @property const {
return _is_slice;
/// Raw representation of the read. Occasionally useful for dirty hacks!
inout(ubyte)[] raw_data() @property inout {
return _chunk;
/// ditto
void raw_data(ubyte[] data) @property {
_chunk = data;
package ubyte[] _chunk; // holds all the data,
// the access is organized via properties
// (see below)
// by specs, name ends with '\0'
// let's use this byte for something useful!
// (Of course this places some restrictions on usage,
// but allows to reduce size of record.)
bool _is_slice() @property const {
return cast(bool)(_chunk[_cigar_offset - 1] & 1);
void _is_slice(bool is_slice) @property {
_chunk[_cigar_offset - 1] &= 0b11111110;
_chunk[_cigar_offset - 1] |= (is_slice ? 1 : 0);
// don't call _dup() if the record is modified
bool _modify_in_place() @property const {
return cast(bool)(_chunk[_cigar_offset - 1] & 2);
void _modify_in_place(bool in_place) @property {
_chunk[_cigar_offset - 1] &= 0b11111101;
_chunk[_cigar_offset - 1] |= (in_place ? 2 : 0);
IBamSamReader _reader;
string _ref_id_to_string(int ref_id) const nothrow {
if (_reader is null)
return "?";
if (ref_id < 0)
return "*";
return _reader.reference_sequences[ref_id].name;
// Official field names from SAM/BAM specification.
// For internal use only
@property int _refID() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 0));
@property int _pos() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 1));
@property uint _bin_mq_nl() const nothrow pure @system {
return *(cast(uint*)(_chunk.ptr + int.sizeof * 2));
@property uint _flag_nc() const nothrow {
return *(cast(uint*)(_chunk.ptr + int.sizeof * 3));
@property int _l_seq() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 4));
@property int _next_refID() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 5));
@property int _next_pos() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 6));
@property int _tlen() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 7));
// Setters, also only for internal use
@property void _refID(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 0)) = n; }
@property void _pos(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 1)) = n; }
@property void _bin_mq_nl(uint n) { *(cast(uint*)(_chunk.ptr + int.sizeof * 2)) = n; }
@property void _flag_nc(uint n) { *(cast(uint*)(_chunk.ptr + int.sizeof * 3)) = n; }
@property void _l_seq(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 4)) = n; }
@property void _next_refID(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 5)) = n; }
@property void _next_pos(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 6)) = n; }
@property void _tlen(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 7)) = n; }
// Additional useful properties, also from SAM/BAM specification
// The layout of bin_mq_nl and flag_nc is as follows
// (upper bits -------> lower bits):
// bin_mq_nl [ { bin (16b) } { mapping quality (8b) } { read name length (8b) } ]
// flag_nc [ { flag (16b) } { n_cigar_op (16b) } ]
@property ushort _bin() const nothrow {
return _bin_mq_nl >> 16;
@property ubyte _mapq() const nothrow {
return (_bin_mq_nl >> 8) & 0xFF;
@property ubyte _l_read_name() const nothrow pure {
return _bin_mq_nl & 0xFF;
@property ushort _flag() const nothrow {
return _flag_nc >> 16;
@property ushort _n_cigar_op() const nothrow {
return _flag_nc & 0xFFFF;
// Setters for those properties
@property void _bin(ushort n) { _bin_mq_nl = (_bin_mq_nl & 0xFFFF) | (n << 16); }
@property void _mapq(ubyte n) { _bin_mq_nl = (_bin_mq_nl & ~0xFF00) | (n << 8); }
@property void _l_read_name(ubyte n) { _bin_mq_nl = (_bin_mq_nl & ~0xFF ) | n; }
@property void _flag(ushort n) { _flag_nc = (_flag_nc & 0xFFFF) | (n << 16); }
@property void _n_cigar_op(ushort n) { _flag_nc = (_flag_nc & ~0xFFFF) | n; }
// Offsets of various arrays in bytes.
// Currently, are computed each time, so if speed will be an issue,
// they can be made fields instead of properties.
@property size_t _read_name_offset() const nothrow pure {
return 8 * int.sizeof;
@property size_t _cigar_offset() const nothrow pure {
return _read_name_offset + _l_read_name * char.sizeof;
@property size_t _seq_offset() const nothrow {
return _cigar_offset + _n_cigar_op * uint.sizeof;
@property size_t _qual_offset() const nothrow {
return _seq_offset + (_l_seq + 1) / 2;
// Offset of auxiliary data
@property size_t _tags_offset() const nothrow {
return _qual_offset + _l_seq;
// Sets n-th flag bit to boolean value b.
void _setFlag(int n, bool b) {
assert(n < 16);
ushort mask = cast(ushort)(1 << n);
_flag = (_flag & ~cast(int)(mask)) | ((-cast(int)b) & mask);
// If _chunk is still a slice, not an array, duplicate it.
// Used when some part of alignment record is modified by user.
// Basically, it's sort of copy-on-write: a lot of read-only alignments
// may point to the same location, but every modified one allocates its
// own chunk of memory.
void _dup() {
if (_is_slice && !_modify_in_place) {
_chunk = _chunk.dup;
_is_slice = false;
// Calculates bin number.
void _recalculate_bin() {
_bin = reg2bin(position, position + basesCovered());
/// Lazy tag storage.
/// Provides hash-like access and opportunity to iterate
/// storage like an associative array.
mixin template TagStorage() {
// Provides access to chunk of memory which contains tags.
// This way, every time _tags_offset gets updated
// (due to update of cigar string/read name/sequence and memory move),
// the change is reflected automatically in tag storage.
private @property const(ubyte)[] _tags_chunk() const {
return _chunk[_tags_offset .. $];
/// Hash-like access to tags. Time complexity is $(BIGOH number of tags).
/// $(BR)
/// If tag with such $(I key) is not found, returned value 'is nothing'.
/// $(BR)
/// If key length is different from 2, exception is thrown.
/// $(BR)
/// Special case when $(I value) represents nothing is used for removing tag
/// (assuming that no more than one with this key is presented in the record).
/// Examples:
/// ----------------------------
/// auto v = read["NM"];
/// assert(v.is_integer);
/// auto v = read["MN"];
/// assert(v.is_nothing); // no such tag
/// read["NM"] = 3; // converted to bio.bam.tagvalue.Value implicitly
/// read["NM"] = null; // removes tag
/// assert(read["NM"].is_nothing);
/// ----------------------------
bio.bam.tagvalue.Value opIndex(string key) const {
enforce(key.length == 2, "Key length must be 2");
auto __tags_chunk = _tags_chunk; // _tags_chunk is evaluated lazily
if (__tags_chunk.length < 4)
return Value(null);
size_t offset = 0;
while (offset + 1 < __tags_chunk.length) {
if (__tags_chunk[offset .. offset + 2] == key) {
offset += 2;
return readValue(offset, __tags_chunk);
} else {
offset += 2;
skipValue(offset, __tags_chunk);
return Value(null);
/// ditto
void opIndexAssign(T)(T value, string key)
if (is(T == Value) || __traits(compiles, GetTypeId!T))
static if(is(T == Value)) {
enforce(key.length == 2, "Key length must be 2");
auto __tags_chunk = _tags_chunk;
size_t offset = 0;
while (offset + 1 < __tags_chunk.length) {
if (__tags_chunk[offset .. offset + 2] == key) {
if (value.is_nothing) {
// special case - remove tag
} else {
replaceValueAt(offset + 2, value);
} else {
offset += 2;
skipValue(offset, __tags_chunk);
if (!value.is_nothing)
appendTag(key, value);
} else {
opIndexAssign(Value(value), key);
/// Append new tag to the end, skipping check if it already exists. $(BIGOH 1)
void appendTag(string key, Value value) {
auto oldlen = _chunk.length;
_chunk.length = _chunk.length + sizeInBytes(value) + 2 * char.sizeof;
_chunk[oldlen .. oldlen + 2] = cast(ubyte[])key;
emplaceValue(_chunk.ptr + oldlen + 2, value);
/// Remove all tags
void clearAllTags() {
_chunk.length = _tags_offset;
/// Number of tags. $(BIGOH number of tags)
size_t tagCount() {
size_t result = 0;
size_t offset = 0;
auto __tags_chunk = _tags_chunk;
while (offset + 1 < __tags_chunk.length) {
offset += 2;
skipValue(offset, __tags_chunk);
result += 1;
return result;
// replace existing tag
private void replaceValueAt(size_t offset, Value value) {
// offset points to the beginning of the value
auto begin = offset;
auto __tags_chunk = _tags_chunk;
skipValue(offset, __tags_chunk); // now offset is updated and points to the end
auto end = offset;
prepareSlice(_chunk, __tags_chunk[begin .. end], sizeInBytes(value));
emplaceValue(_chunk.ptr + _tags_offset + begin, value);
// remove existing tag
private void removeValueAt(size_t begin) {
// offset points to the beginning of the value
auto offset = begin + 2;
auto __tags_chunk = _tags_chunk;
skipValue(offset, __tags_chunk);
auto end = offset;
// this does the job (see prepareSlice code)
prepareSlice(_chunk, __tags_chunk[begin .. end], 0);
/// Provides opportunity to iterate over tags.
int opApply(scope int delegate(const ref string k, const ref Value v) dg) const {
size_t offset = 0;
auto __tags_chunk = _tags_chunk;
while (offset + 1 < __tags_chunk.length) {
auto key = cast(string)__tags_chunk[offset .. offset + 2];
offset += 2;
auto val = readValue(offset, __tags_chunk);
auto res = dg(key, val);
if (res != 0) {
return res;
return 0;
/// Returns the number of tags. Time complexity is $(BIGOH number of tags)
size_t tagCount() const {
size_t res = 0;
size_t offset = 0;
auto __tags_chunk = _tags_chunk;
while (offset + 1 < __tags_chunk.length) {
offset += 2;
skipValue(offset, __tags_chunk);
res += 1;
return res;
private void writeTags(BamWriter writer) {
if (std.system.endian == Endian.littleEndian) {
} else {
// Reads value which starts from (_tags_chunk.ptr + offset) address,
// and updates offset to the end of value. O(1)
private Value readValue(ref size_t offset, const(ubyte)[] tags_chunk) const {
char type = cast(char)tags_chunk[offset++];
return readValueFromArray(type, tags_chunk, offset);
// Increases offset so that it points to the next value. O(1).
private void skipValue(ref size_t offset, const(ubyte)[] tags_chunk) const {
char type = cast(char)tags_chunk[offset++];
if (type == 'Z' || type == 'H') {
while (tags_chunk[offset++] != 0) {}
} else if (type == 'B') {
char elem_type = cast(char)tags_chunk[offset++];
auto length = *(cast(uint*)(tags_chunk.ptr + offset));
offset += uint.sizeof + charToSizeof(elem_type) * length;
} else {
offset += charToSizeof(type);
Intended to be used in constructor for initial endianness fixing
in case the library is used on big-endian system.
private void fixTagStorageByteOrder() {
const(ubyte)* p = _tags_chunk.ptr;
const(ubyte)* end = p + _chunk.length;
while (p < end) {
p += 2; // skip tag name
char type = *(cast(char*)p);
++p; // skip type
if (type == 'Z' || type == 'H') {
while (*p != 0) { // zero-terminated
++p; // string
++p; // skip '\0'
} else if (type == 'B') { // array
char elem_type = *(cast(char*)p);
uint size = charToSizeof(elem_type);
switchEndianness(p, uint.sizeof);
uint length = *(cast(uint*)p);
p += uint.sizeof; // skip length
if (size != 1) {
for (auto j = 0; j < length; j++) {
switchEndianness(p, size);
p += size;
} else {
// skip
p += length;
} else {
uint size = charToSizeof(type);
if (size != 1) {
switchEndianness(p, size);
p += size;
} else {
unittest {
import std.algorithm;
import std.stdio;
import std.math;
// stderr.writeln("Testing BamRead behaviour...");
auto read = BamRead("readname",
[CigarOperation(22, 'M')]);
assert(read.sequence_length == 22);
assert(read.cigar.length == 1);
assert(read.cigarString() == "22M");
assert( == "readname");
assert(equal(read.sequence(), "AGCTGACTACGTAATAGCCCTA")); = "anothername";
assert( == "anothername");
assert(read.cigarString() == "22M");
read.base_qualities = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22];
assert(reduce!"a+b"(0, read.base_qualities) == 253);
read["RG"] = 15;
assert(read["RG"] == 15);
read["X1"] = [1, 2, 3, 4, 5];
assert(read["X1"] == [1, 2, 3, 4, 5]);
read.cigar = [CigarOperation(20, 'M'), CigarOperation(2, 'X')];
assert(read.cigarString() == "20M2X");
read["RG"] = cast(float)5.6;
assert(approxEqual(to!float(read["RG"]), 5.6));
assert(read.sequence_length == 21);
assert(read.base_qualities.length == 21);
assert(read.base_qualities[20] == 255);
assert(equal(read.sequence(), "AGCTGGCTACGTAATAGCCCT"));
assert(retro(read.sequence)[2] == 'C');
assert(retro(read.sequence)[0] == 'T');
assert(read.sequence[4] == 'G');
assert(read.sequence[0] == 'A');
assert(equal(read.sequence[0..8], "AGCTGGCT"));
assert(equal(read.sequence[3..5], "TG"));
assert(equal(read.sequence[3..9][1..4], "GGC"));
read["X1"] = 42;
assert(read["X1"] == 42);
assert(read.tagCount() == 2);
read["X1"] = null;
assert(read.tagCount() == 1);
read.cigar = [CigarOperation(read.sequence_length, 'M')];
read["RG"] = null;
read["RG"] = "readgroup1";
assert(read.tagCount() == 1);
read["RG"] = null;
assert(read.tagCount() == 0);
read.sequence[5] = Base('N');
read.sequence[6] = Base('A');
read.sequence[7] = Base('C');
read.sequence[8] = Base('G');
read.base_qualities[5] = 42;
assert(read.sequence[5 .. 9].equal("NACG"));
assert(read.base_qualities[5] == 42);
// Test MsgPack serialization/deserialization
import std.typecons;
static import bio.bam.thirdparty.msgpack;
auto packer = bio.bam.thirdparty.msgpack.packer(Appender!(ubyte[])());
auto data =;
auto rec = unpack(data).via.array;
assert(rec[0].as!(ubyte[]) == "anothername");
assert(rec[5].as!(int[]) == [21]);
assert(rec[6].as!(ubyte[]) == ['M']);
assert(rec[10].as!(ubyte[]) == to!string(read.sequence));
assert(read.tagCount() == 0);
/// $(P BamRead wrapper which precomputes $(D end_position) = $(D position) + $(D basesCovered()).)
/// $(P Computation of basesCovered() takes quite a few cycles. Therefore in places where this
/// property is frequently accessed, it makes sense to precompute it for later use.)
/// $(P The idea is that this should be a drop-in replacement for BamRead in algorithms,
/// as the struct uses 'alias this' construction for the wrapped read.)
struct EagerBamRead(R=BamRead) {
this(R read) { = read;
this.end_position = read.position + read.basesCovered();
R read;
alias read this;
/// End position on the reference, computed as position + basesCovered().
int end_position;
EagerBamRead dup() @property const {
return EagerBamRead(read.dup);
static assert(is(EagerBamRead!BamRead : BamRead));
/// Checks if $(D T) behaves like $(D BamRead)
template isBamRead(T)
static if (is(Unqual!T : BamRead))
enum isBamRead = true;
enum isBamRead = __traits(compiles,
T t; bool p;
p = t.ref_id == 1; p = t.position == 2; p = == 3;
p = t.mapping_quality == 4; p = t.flag == 5; p = t.sequence_length == 6;
p = t.mate_ref_id == 7; p = t.mate_position == 8; p = t.template_length == 9;
p = t.is_paired; p = t.proper_pair; p = t.is_unmapped;
p = t.mate_is_unmapped; p = t.mate_is_reverse_strand; p = t.is_first_of_pair;
p = t.is_second_of_pair; p = t.is_secondary_alignment; p = t.failed_quality_control;
p = t.is_duplicate; p = t.strand == '+'; p = == "";
p = t.cigar[0].type == 'M'; p = t.basesCovered() > 42; p = t.cigarString() == "";
p = t.sequence[0] == 'A'; p = t.base_qualities[0] == 0;
/// $(P Comparison function for 'queryname' sorting order
/// (return whether first read is 'less' than second))
/// $(P This function can be called on:
/// $(UL
/// $(LI two reads)
/// $(LI read and string in any order)))
bool compareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
return <;
bool compareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isSomeString!R2)
return < a2;
bool compareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isSomeString!R1 && isBamRead!R2)
return a1 <;
int mixedStrCompare(string a, string b) {
import std.ascii : isDigit;
while (!a.empty && !b.empty) {
if (a.front.isDigit && b.front.isDigit) {
// skip zeros
int za, zb;
while (!a.empty && a.front == '0') { ++za; a.popFront(); }
while (!b.empty && b.front == '0') { ++zb; b.popFront(); }
// skip equal digits
while (!a.empty && !b.empty && a.front.isDigit && a.front == b.front) {
if (!a.empty && !b.empty && a.front.isDigit && b.front.isDigit) {
// the number of leading digits in each string is non-zero
size_t i = 0, maxi = min(a.length, b.length);
while (i < maxi && a[i].isDigit && b[i].isDigit) ++i;
if (i < a.length && a[i].isDigit) return 1; // a contains more digits
if (i < b.length && b[i].isDigit) return -1; // b contains more digits
// the counts are equal, compare first digits
return cast(byte)a.front - cast(byte)b.front;
} else if (!a.empty && a.front.isDigit) return 1;
else if (!b.empty && b.front.isDigit) return -1;
else if (za != zb) return za - zb; // order by the number of leading zeros
} else {
// lexicographical comparison for non-digits
if (a.front != b.front) return cast(byte)a.front - cast(byte)b.front;
a.popFront(); b.popFront();
return (!a.empty) ? 1 : (!b.empty) ? -1 : 0;
/// $(P Comparison function for 'queryname' sorting order as in Samtools
/// (returns whether first read is 'less' than second in a 'mixed' order,
/// i.e. numbers inside the strings are compared by their integer value))
/// $(P This function can be called on:
/// $(UL
/// $(LI two reads)
/// $(LI read and string in any order)))
bool mixedCompareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
return mixedStrCompare(, < 0;
bool mixedCompareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isSomeString!R2)
return mixedStrCompare(, a2) < 0;
bool mixedCompareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isSomeString!R1 && isBamRead!R2)
return mixedStrCompare(a1, < 0;
unittest {
assert(mixedStrCompare("BC0123", "BC01234") < 0);
assert(mixedStrCompare("BC0123", "BC0123Z") < 0);
assert(mixedStrCompare("BC01234", "BC01234") == 0);
assert(mixedStrCompare("BC0123DEF45", "BC01234DEF45") < 0);
assert(mixedStrCompare("BC01236DEF45", "BC01234DEF45") > 0);
assert(mixedStrCompare("BC012", "BC0012") < 0);
assert(mixedStrCompare("BC0012DE0034", "BC0012DE34") > 0);
assert(mixedStrCompare("BC12DE0034", "BC012DE34") < 0);
assert(mixedStrCompare("1235", "1234") > 0);
/// $(P Comparison function for 'coordinate' sorting order
/// (returns whether first read is 'less' than second))
/// $(P This function can be called on:
/// $(UL
/// $(LI two reads (in this case, reference IDs are also taken into account))
/// $(LI read and integer in any order)))
/// This function takes read direction into account (used for original samtools style sorting)
bool compareCoordinatesAndStrand(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
if (a1.ref_id == -1) return false; // unmapped reads should be last
if (a2.ref_id == -1) return true;
if (a1.ref_id < a2.ref_id) return true;
if (a1.ref_id > a2.ref_id) return false;
if (a1.position < a2.position) return true;
if (a1.position > a2.position) return false;
return !a1.is_reverse_strand && a2.is_reverse_strand;
bool compareCoordinates(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
if (a1.ref_id == -1) return false; // unmapped reads should be last
if (a2.ref_id == -1) return true;
if (a1.ref_id < a2.ref_id) return true;
if (a1.ref_id > a2.ref_id) return false;
return (a1.position < a2.position);
bool compareCoordinates(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isIntegral!R2)
return a1.position < a2;
bool compareCoordinates(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isIntegral!R1 && isBamRead!R2)
return a1 < a2.position;
static assert(isTwoWayCompatible!(compareReadNames, BamRead, string));
static assert(isTwoWayCompatible!(compareCoordinates, BamRead, int));
/// Allows modification of the read in-place even if it's slice-backed.
struct UniqueRead(R) {
R read;
alias read this;
this(R read) { = read; = true;
~this() { = false;
/// ditto
auto assumeUnique(R)(auto ref R read) if (isBamRead!R) {
return UniqueRead!R(read);