You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.

100 lines
2.8 KiB

  1. /*
  2. This file is part of BioD.
  3. Copyright (C) 2012 Artem Tarasov <>
  4. Permission is hereby granted, free of charge, to any person obtaining a
  5. copy of this software and associated documentation files (the "Software"),
  6. to deal in the Software without restriction, including without limitation
  7. the rights to use, copy, modify, merge, publish, distribute, sublicense,
  8. and/or sell copies of the Software, and to permit persons to whom the
  9. Software is furnished to do so, subject to the following conditions:
  10. The above copyright notice and this permission notice shall be included in
  11. all copies or substantial portions of the Software.
  19. */
  20. module bio.bam.iontorrent.flowindex;
  21. import std.range;
  22. ///
  23. struct FlowIndex(S)
  24. {
  25. private {
  26. S _seq;
  27. string _fo;
  28. size_t _index;
  29. }
  30. this(S sequence, string flow_order) {
  31. _seq = sequence;
  32. _fo = flow_order;
  33. if (!_seq.empty) {
  34. while (_index < _fo.length) {
  35. if (_fo[_index] == _seq.front)
  36. break;
  37. ++_index;
  38. }
  39. }
  40. }
  41. ///
  42. bool empty() @property {
  43. return _seq.empty || (_index == _fo.length);
  44. }
  45. /// Current flow index
  46. size_t front() @property const {
  47. return _index;
  48. }
  49. /// Move to next read base
  50. void popFront() {
  51. auto prev_base = _seq.front;
  52. _seq.popFront();
  53. if (_seq.empty) return;
  54. if (_seq.front == prev_base) {
  55. return; // keep index as is
  56. }
  57. _index += 1;
  58. while (_index < _fo.length) {
  59. if (_fo[_index] == _seq.front)
  60. break;
  61. _index++;
  62. }
  63. }
  64. }
  65. /// Given a sequence of bases and flow order, recover flow index,
  66. /// i.e. sequence of 0-based flow positions for each base.
  67. auto flowIndex(S)(S sequence, string flow_order)
  68. {
  69. return FlowIndex!S(sequence, flow_order);
  70. }
  71. unittest {
  72. import bio.core.base;
  73. import std.conv;
  74. import std.algorithm;
  75. auto seq = map!(c => Base5(c))("AACGTAAACCTCACT");
  76. string flow_order = "ATGCATGCATGCATGCATGCATGCATGC";
  77. // 0123456789111111111122222222
  78. // 012345678901234567
  79. assert(equal(flowIndex(seq, flow_order), [0, 0, 3, 6, 9, 12, 12, 12, 15, 15, 17, 19, 20, 23, 25]));
  80. }