You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.

352 lines
12 KiB

import bio.std.hts.bam.reader;
import bio.std.hts.bam.pileup;
import std.stdio;
void main() {
auto bam = new BamReader("test/data/ex1_header.bam");
auto reads = bam["chr2"][150 .. 160]; // region chr2:149-158
auto pileup = makePileup(reads,
false, // reads don't contain MD tags
155, 158); // specify [start, end) interval
foreach (column; pileup) {
writeln("Reference position: ", column.position);
writeln(" Coverage: ", column.coverage);
writeln(" Reads:");
foreach (read; column.reads) {
writefln("%30s\t%s\t%.2d\t%s\t%2s/%2s\t%2s/%2s\t%10s\t%s %s",,
read.cigar_operation_offset + 1, read.cigar_operation.length,
read.query_offset + 1, read.sequence.length,
read.cigar_before, read.cigar_after);
import bio.std.hts.bam.cigar;
import bio.std.hts.bam.reader;
import bio.std.hts.bam.writer;
import bio.std.hts.sam.reader;
import bio.std.hts.sam.header;
import bio.std.hts.bam.pileup;
import bio.std.hts.bam.baseinfo;
import bio.std.hts.bam.validation.samheader;
import bio.std.hts.bam.validation.alignment;
import bio.std.hts.utils.samheadermerger;
import bio.std.hts.sam.utils.recordparser;
import bio.core.bgzf.block;
import bio.core.bgzf.inputstream;
import bio.core.bgzf.outputstream;
import bio.core.utils.roundbuf;
import bio.core.utils.range;
import bio.core.utils.tmpfile;
import bio.core.sequence;
import bio.core.base;
import bio.core.tinymap;
import bio.core.utils.roundbuf;
import std.path;
import std.range;
import std.stdio;
// import;
import std.algorithm;
import std.array;
import std.conv;
import std.exception;
import std.math;
import std.typetuple;
import std.regex;
auto fn = buildPath(dirName(__FILE__), "data", "tags.bam");
auto bf = new BamReader(fn);
foreach (read; bf.reads) {
auto line =!string();
auto read2 = parseAlignmentLine(line, bf.header);
if (read != read2 && isValid(read)) {
assert(read == read2 || !isValid(read));
fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
bf = new BamReader(fn);
auto readx = bf.reads;
fn = buildPath(dirName(__FILE__), "data", "b.sam");
auto sam = new SamReader(fn);
auto writer = new BamWriter("/dev/null", 0);
foreach (r; sam.reads)
fn = buildPath(dirName(__FILE__), "data", "bins.bam");
bf = new BamReader(fn);
void compareWithNaiveApproach(int beg, int end) {
auto refseq = array(bf["large"][beg .. end]);
auto naive = array(filter!((BamRead a) {
return a.ref_id != -1 &&
bf.reference(a.ref_id).name == "large" &&
a.position < end &&
a.position + a.basesCovered() > beg; })
if (!equal(naive, refseq)) {
assert(equal(refseq, naive));
// Time to kick in GC
import core.memory;
stderr.writeln("**** Calling GC");
stderr.writeln("**** Past calling GC");
CigarOperation[] cigarFromString(string cigar) {
return match(cigar, regex(`(\d+)([A-Z=])`, "g")).map!(m => CigarOperation(m[1].to!uint, m[2].to!char)).array;
stderr.writeln("Running unittests...");
// stderr.writeln("Testing extracting SAM header...");
fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
bf = new BamReader(fn);
assert(bf.header.format_version == "1.3");
assert(bf.header.sorting_order == SortingOrder.coordinate);
assert(bf.header.sequences.length == 2);
assert(bf.header.getSequenceIndex("chr1") == 0);
assert(bf.header.sequences["chr2"].length == 1584);
fn = buildPath(dirName(__FILE__), "data", "bins.bam");
bf = new BamReader(fn);
assert(bf.header.sorting_order == SortingOrder.unknown);
assert(bf.header.sequences.length == 3);
assert(bf.header.read_groups.length == 0);
assert(bf.header.getSequenceIndex("large") == 2);
assert(bf.header.sequences["small"].length == 65536);
// Time to kick in GC
import core.memory;
stderr.writeln("**** Calling GC");
stderr.writeln("**** Past calling GC");
// stderr.writeln("Testing alignment parsing...");
fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
bf = new BamReader(fn);
auto reads2 = bf.reads;
auto read = reads2.front;
assert(equal(map!"cast(char)(a + 33)"(read.base_qualities),
assert(bf.reference(read.ref_id).name == "chr1");
assert( == "EAS56_57:6:190:289:82");
assert(read.flag == 69);
assert(read.position == 99);
assert(read.mapping_quality == 0);
assert(reads2.front.cigarString() == "35M");
assert(!string() == "EAS51_64:3:190:727:308 99 chr1 103 99 35M = 263 195 GGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGG <<<<<<<<<<<<<<<<<<<<<<<<<<<::<<<844 MF:i:18 Aq:i:73 NM:i:0 UQ:i:0 H0:i:1 H1:i:0");
assert(bf.header.getSequenceIndex("chr1") == read.ref_id);
assert( == "EAS56_57:6:190:289:82");
stderr.writeln("**** Calling GCx");
stderr.writeln("**** Past calling GCx");
// stderr.writeln("Testing tag parsing...");
fn = buildPath(dirName(__FILE__), "data", "tags.bam");
bf = new BamReader(fn);
foreach (alignment; bf.reads) {
auto name =;
assert(name[0..4] == "tag_");
char[] tag;
name = name[4..$];
while (name[0] != ':') {
tag ~= name[0];
name = name[1..$];
name = name[1..$];
auto value = alignment[tag.idup].toSam();
if (name != value) {
stderr.writeln("tag: ", tag, "\tname: ", name, "\tvalue: ", value);
stderr.writeln("value bam_typeid: ", alignment[tag.idup].bam_typeid);
assert(name == value);
// stderr.writeln("Testing exception handling...");
fn = buildPath(dirName(__FILE__), "data", "duplicated_block_size.bam");
assertThrown!BgzfException(new BamReader(fn));
fn = buildPath(dirName(__FILE__), "data", "no_block_size.bam");
assertThrown!BgzfException(new BamReader(fn));
fn = buildPath(dirName(__FILE__), "data", "wrong_extra_gzip_length.bam");
assertThrown!BgzfException(new BamReader(fn));
fn = buildPath(dirName(__FILE__), "data", "wrong_bc_subfield_length.bam");
assertThrown!BgzfException(reduce!"a+b.sequence_length"(0, (new BamReader(fn)).reads!withoutOffsets));
fn = buildPath(dirName(__FILE__), "data", "corrupted_zlib_archive.bam");
import bio.core.utils.zlib;
assertThrown!ZlibException(walkLength((new BamReader(fn)).reads));
// stderr.writeln("Testing random access...");
fn = buildPath(dirName(__FILE__), "data", "bins.bam");
bf = new BamReader(fn);
// Time to kick in GC
import core.memory;
stderr.writeln("**** Calling GC");
stderr.writeln("**** Past calling GC");
auto fst_offset_tiny = bf["tiny"].startVirtualOffset();
auto fst_offset_small = bf["small"].startVirtualOffset();
auto fst_offset_large = bf["large"].startVirtualOffset();
auto fst_read_tiny = bf.getReadAt(fst_offset_tiny);
auto fst_read_small = bf.getReadAt(fst_offset_small);
auto fst_read_large = bf.getReadAt(fst_offset_large);
assert( == "tiny:r1:0..1:len1:bin4681:hexbin0x1249");
assert( == "small:r1:0..1:len1:bin4681:hexbin0x1249");
assert( == "large:r1:0..1:len1:bin4681:hexbin0x1249");
// stderr.writeln("Testing Value code...");
Value v = 5;
assert(v.toSam() == "i:5");
assert(v == 5);
assert(v == "5");
assert(v != [1,2,3]);
v = "abc";
assert(v.toSam() == "Z:abc");
assert(v == "abc");
v = [1, 2, 3];
assert(v.toSam() == "B:i,1,2,3");
assert(v == [1,2,3]);
assert(v == "[1, 2, 3]");
v = [1.5, 2.3, 17.0];
assert(v.toSam() == "B:f,1.5,2.3,17");
assert(approxEqual(to!(float[])(v), [1.5, 2.3, 17]));
v = 5.6;
assert(v.toSam() == "f:5.6");
assert(approxEqual(to!float(v), 5.6));
v = -17;
assert(v.toSam() == "i:-17");
assert(v == -17);
assert(v == "-17");
v = 297u;
assert(v.toSam() == "i:297");
assert(v == 297);
assert(v == "297");
short[] array_of_shorts = [4, 5, 6];
v = array_of_shorts;
assert(v.toSam() == "B:s,4,5,6");
assert(to!(short[])(v) == array_of_shorts);
assert(v == [4,5,6]);
assert(v == "[4, 5, 6]");
v = null;
v = "0eabcf123";
assert(v == "0eabcf123");
// stderr.writeln("Testing parseAlignmentLine/toSam functions...");
fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
bf = new BamReader(fn);
foreach (read; bf.reads) {
auto line =!string();
auto read2 = parseAlignmentLine(line, bf.header);
if (read != read2) {
assert(read == read2);
fn = buildPath(dirName(__FILE__), "data", "tags.bam");
bf = new BamReader(fn);
foreach (read; bf.reads) {
auto line =!string();
auto read2 = parseAlignmentLine(line, bf.header);
if (read != read2 && isValid(read)) {
assert(read == read2 || !isValid(read));
// stderr.writeln("Testing BAM writing...");
fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
bf = new BamReader(fn);
string tmp = tmpFile("12035913820619231129310.bam");
auto stream = new, "wb+");
auto writer = new BamWriter(stream);
foreach (read; bf.reads)
assert(walkLength((new BamReader(stream)).reads) == 3270);
// stderr.writeln("Testing SAM reading...");
auto sf = new SamReader(buildPath(dirName(__FILE__), "data", "ex1_header.sam"));
assert(sf.reads.front.ref_id == 0);
assert(equal(sf.reads, bf.reads!withoutOffsets));