renames: writeRead -> writeRecord; phred_base_quality -> base_qualities

bio/bam/read.d

@@ -215,6 +215,12 @@ struct BamRead {
         return is_reverse_strand ? '-' : '+';
     }
 
+    /// ditto
+    @property void strand(char c) {
+        enforce(c == '-' || c == '+', "Strand must be '-' or '+'");
+        is_reverse_strand = c == '-';
+    }
+
     /// Read name
     @property string name() const nothrow {
         // notice -1: the string is zero-terminated, so we should strip that '\0'
@@ -412,12 +418,12 @@ struct BamRead {
     }
 
     /// Quality data
-    @property const(ubyte)[] phred_base_quality() const nothrow {
+    @property const(ubyte)[] base_qualities() const nothrow {
         return _chunk[_qual_offset .. _qual_offset + _l_seq * char.sizeof];
     }
 
     /// Set quality data - array length must be of the same length as the sequence.
-    @property void phred_base_quality(const(ubyte)[] quality) {
+    @property void base_qualities(const(ubyte)[] quality) {
         enforce(quality.length == _l_seq, "Quality data must be of the same length as sequence");
         _dup();
         _chunk[_qual_offset .. _qual_offset + _l_seq] = quality;
@@ -616,7 +622,7 @@ struct BamRead {
         packer.pack(next_pos);
         packer.pack(template_length);
         packer.pack(to!string(sequence));
-        packer.pack(phred_base_quality);
+        packer.pack(base_qualities);
 
         packer.beginMap(tagCount());
         foreach (key, value; this) {
@@ -1052,9 +1058,9 @@ unittest {
     assert(read.name == "anothername");
     assert(read.cigarString() == "22M");
 
-    read.phred_base_quality = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 
-                    13, 14, 15, 16, 17, 18, 19, 20, 21, 22];
-    assert(reduce!"a+b"(0, read.phred_base_quality) == 253);
+    read.base_qualities = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 
+                           13, 14, 15, 16, 17, 18, 19, 20, 21, 22];
+    assert(reduce!"a+b"(0, read.base_qualities) == 253);
 
     read.cigar = [CigarOperation(20, 'M'), CigarOperation(2, 'X')];
     assert(read.cigarString() == "20M2X");

bio/bam/referenceinfo.d

@@ -24,19 +24,35 @@ import std.exception;
 import std.array;
 
 /**
-  Stores reference sequence name and length
+  Stores basic information about reference sequence.
  */
 struct ReferenceSequenceInfo {
-    string name;
-    int length;
+    private {
+        string _name;
+        int _length;
+    }
+
+    /// Reference sequence name
+    string name() @property const {
+        return _name;
+    }
+   
+    /// Reference sequence length
+    int length() @property const {
+        return _length;
+    }
+
+    ///
+    this(string name, int length) {
+        _name = name;
+        _length = length;
+    }
 
-    /**
-      Constructs the structure from input stream
-     */
+    /// Constructs the structure from input stream
     this(ref Stream stream) {
         int l_name; // length of the reference name plus one
         stream.read(l_name);
-        name = stream.readString(l_name)[0..$-1].idup; // strip '\0' at the end
-        stream.read(length);
+        _name = stream.readString(l_name)[0..$-1].idup; // strip '\0' at the end
+        stream.read(_length);
     }
 }

bio/bam/serialization/json.d

@@ -269,7 +269,7 @@ void jsonSerialize(S)(BamRead alignment, ReferenceSequenceInfo[] info, ref S str
 
     putcharacter(stream, '[');
     bool first = true;
-    foreach(ubyte c; alignment.phred_base_quality) {
+    foreach(ubyte c; alignment.base_qualities) {
         if (!first) {
             putcharacter(stream, ',');
         } else {

bio/bam/serialization/sam.d

@@ -213,12 +213,12 @@ void serialize(S, R)(auto ref R alignment, ReferenceSequenceInfo[] info, auto re
         }
         putcharacter(stream, '\t');
     }
-    if (alignment.phred_base_quality.length == 0 || 
-        alignment.phred_base_quality[0] == '\xFF')
+    if (alignment.base_qualities.length == 0 || 
+        alignment.base_qualities[0] == '\xFF')
     {
         putcharacter(stream, '*');
     } else {
-        foreach(char c; alignment.phred_base_quality) {
+        foreach(char c; alignment.base_qualities) {
             putcharacter(stream, cast(char)(c + 33));
         }
     }

bio/bam/writer.d

@@ -106,7 +106,7 @@ final class BamWriter {
     }
 
     /// Write BAM read. Throws exception if read reference ID is out of range.
-    void writeRead(R)(R read) {
+    void writeRecord(R)(R read) {
         enforce(read.ref_id < _reference_sequences.length,
                 "Read reference ID is out of range");
 

test/unittests.d

@@ -73,7 +73,7 @@ unittest {
     auto reads = bf.reads;
     auto read = reads.front;
     assert(equal(read.sequence, "CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA"));
-    assert(equal(map!"cast(char)(a + 33)"(read.phred_base_quality),
+    assert(equal(map!"cast(char)(a + 33)"(read.base_qualities),
                 "<<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<;"));
     assert(bf.reference(read.ref_id).name == "chr1");
     assert(read.name == "EAS56_57:6:190:289:82");
@@ -267,7 +267,7 @@ unittest {
     writer.writeReferenceSequenceInfo(bf.reference_sequences);
 
     foreach (read; bf.reads)
-        writer.writeRead(read);
+        writer.writeRecord(read);
     
     writer.flush();