Browse Source

Merge pull request #51 from emi80/master

Add preliminary support for FASTA format
remotes/pjotrp/issue393
George 3 years ago
committed by GitHub
parent
commit
23be373986
No known key found for this signature in database GPG Key ID: 4AEE18F83AFDEB23
  1. 148
      bio/std/file/fai.d
  2. 306
      bio/std/file/fasta.d
  3. 4
      contrib/undead/doformat.d

148
bio/std/file/fai.d

@ -0,0 +1,148 @@
/*
This file is part of BioD.
Copyright (C) 2016 George Githinji <biorelated@gmail.com>
Copyright (C) 2018 Emilio Palumbo <emiliopalumbo@gmail.com>
Permission is hereby granted, free of charge, to any person obtaining a
copy of this software and associated documentation files (the "Software"),
to deal in the Software without restriction, including without limitation
the rights to use, copy, modify, merge, publish, distribute, sublicense,
and/or sell copies of the Software, and to permit persons to whom the
Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
DEALINGS IN THE SOFTWARE.
*/
module bio.std.file.fai;
import std.stdio;
import std.range;
import std.algorithm;
import std.string;
import std.conv;
import std.file;
import std.path;
struct FaiRecord {
string header, lineTerm;
ulong seqLen, lineLen, offset;
@property ulong lineOffset() {
return lineLen + lineTerm.length;
}
string toString() {
return format("%s\t%s\t%s\t%s\t%s", header, seqLen, offset, lineLen, lineOffset);
}
unittest {
auto rec = FaiRecord("chr2", "\n", 10, 50, 4);
assert(rec.toString() == "chr2\t10\t4\t50\t51");
rec.lineTerm = "\r\n";
assert(rec.toString() == "chr2\t10\t4\t50\t52");
}
this(string str) {
auto res = str.split("\t");
header ~= res[0];
seqLen = to!ulong(res[1]);
offset = to!ulong(res[2]);
lineLen = to!ulong(res[3]);
lineTerm = (to!ulong(res[4])-lineLen) == 1 ? "\n" : "\r\n";
}
unittest {
auto s = "chr2\t10\t4\t50\t51";
assert(FaiRecord(s).toString() == s);
}
this(string header, string lineTerm, ulong seqLen, ulong lineLen, ulong offset) {
this.header = header;
this.seqLen = seqLen;
this.offset = offset;
this.lineLen = lineLen;
this.lineTerm = lineTerm;
}
unittest {
assert(FaiRecord("chr2", "\n", 10, 50, 4).toString() == "chr2\t10\t4\t50\t51");
}
}
auto readFai(string filename) {
File f = File(filename, "r");
return f.byLineCopy()
.map!(x => FaiRecord(x));
}
unittest {
auto faiString = "chr2\t10\t4\t50\t51";
auto testIndex = tempDir.buildPath("test.fa.fai");
scope(exit) testIndex.remove;
File(testIndex, "w").writeln(faiString);
auto recs = readFai(testIndex).array;
assert(recs.length == 1);
assert(is(typeof(recs[0])==FaiRecord));
assert(recs[0].toString() == faiString);
}
auto makeIndex(T)(T records) {
FaiRecord[string] index;
foreach (record; records) {
index[record.header] = record;
}
index.rehash;
return index;
}
unittest {
auto records = to!(FaiRecord[])(["chr2\t10\t4\t50\t51"]);
auto i = makeIndex(records);
assert( i.length == 1);
assert( "chr2" in i);
assert( i["chr2"] == FaiRecord("chr2\t10\t4\t50\t51"));
}
auto buildFai(string filename) {
File f = File(filename, "r");
FaiRecord[] records;
string lineTerm = f.byLine(KeepTerminator.yes).take(1).front.endsWith("\r\n") ? "\r\n" : "\n";
f.seek(0);
ulong offset;
foreach(line; f.byLine(KeepTerminator.no, lineTerm)) {
offset+= line.length + lineTerm.length;
if ( line.startsWith(">") ) {
records~=FaiRecord();
records[$-1].lineTerm = lineTerm;
records[$-1].header ~= line.split(" ").front[1..$];
records[$-1].offset = offset;
} else {
if ( records[$-1].lineLen == 0 ) {
records[$-1].lineLen = line.length;
}
records[$-1].seqLen += line.length;
}
}
return records;
}
unittest {
auto testFa = tempDir.buildPath("test.fa");
scope(exit) testFa.remove;
File(testFa, "w").writeln(q"(
>chr1
acgtgagtgc
>chr2
acgtgagtgcacgtgagtgcacgtgagtgc
acgtgagtgcacgtgagtgc
)".outdent().strip());
auto recs = buildFai(testFa).array;
assert(recs.length == 2);
assert(recs.all!(x => is(typeof(x)==FaiRecord)));
assert(recs[0].toString() == "chr1\t10\t6\t10\t11");
assert(recs[1].toString() == "chr2\t50\t23\t30\t31");
}

306
bio/std/file/fasta.d

@ -1,52 +1,290 @@
/*
This file is part of BioD.
Copyright (C) 2012 Artem Tarasov <lomereiter@gmail.com>
Permission is hereby granted, free of charge, to any person obtaining a
copy of this software and associated documentation files (the "Software"),
to deal in the Software without restriction, including without limitation
the rights to use, copy, modify, merge, publish, distribute, sublicense,
and/or sell copies of the Software, and to permit persons to whom the
Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
DEALINGS IN THE SOFTWARE.
This file is part of BioD.
Copyright (C) 2016 George Githinji <biorelated@gmail.com>
Copyright (C) 2018 Emilio Palumbo <emiliopalumbo@gmail.com>
Permission is hereby granted, free of charge, to any person obtaining a
copy of this software and associated documentation files (the "Software"),
to deal in the Software without restriction, including without limitation
the rights to use, copy, modify, merge, publish, distribute, sublicense,
and/or sell copies of the Software, and to permit persons to whom the
Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
DEALINGS IN THE SOFTWARE.
*/
*/
module bio.std.file.fasta;
import std.file;
import std.exception;
import std.algorithm;
import std.array;
import std.string;
import std.algorithm;
import std.stdio;
import std.range;
import std.conv;
import std.math;
import std.typecons;
import std.exception;
import std.path;
import std.file;
import bio.std.file.fai;
/*
A text-based single-letter format for representing
nucleotide (nt) and amino-acid (aa) sequences.
The ">" symbol/character marks the start of a fasta entry.
Each fasta entry comprise of an alphanumeric definition line followed by a
newline character and a single or multiline sequence of IUPAC codes used to
represent nucleotide or amino-acid sequences.
An example of a nucleotide fasta file
>Entry1_ID header field1|field2|...
TTGACGGGTTTTTGTCCTGATT
>Entry2_ID header field1|field2|...
ATTTTGGGTTACTGTTGGTTTTTGGGC
TODO:
1. Allow reading gzipped fasta files.
*/
struct FastaRecord {
string header;
string sequence;
ulong lineLen;
string lineTerm = "\n";
// split the header to array of fields
@property string[] headerFields(){
return split(header, "|").map!strip.array;
}
// return the length of the sequence
@property ulong len() {
return sequence.length;
}
string toString() {
string seq;
ulong i = lineLen;
for (; i<sequence.length; i+=lineLen) {
seq~=sequence[i-lineLen..i]~"\n";
}
seq~=sequence[i-lineLen..$];
return format(">%s\n%s", header, seq);
}
unittest {
auto recString = q"(
>chr2
acgtgagtgcacgtgagtgcacgtgagtgc
acgtgagtgcacgtgagtgc
)".outdent().strip();
auto header = "chr2";
auto seq = "acgtgagtgcacgtgagtgcacgtgagtgcacgtgagtgcacgtgagtgc";
auto lineLen = 30;
auto rec = FastaRecord(header, seq, lineLen);
assert (rec.toString() == recString);
assert (rec.len == seq.length);
}
}
struct Region {
string reference;
ulong beg, end;
@property len() {
return end - beg;
}
string toString() {
if ( end == 0 ) {
if ( beg == 0 )
return reference;
else
return format("%s:%s", reference, beg+1);
}
return format("%s:%s-%s", reference, beg+1, end);
}
this(string q) {
auto res = q.split(":");
reference = res[0];
if ( res.length > 2) {
throw new Exception(format("Wrong format for region: %s", q));
} else if (res.length > 1) {
auto boundaries = res[1].replace(",","").split("-").map!(to!ulong);
beg = boundaries[0]-1;
if ( boundaries.length == 2 ) {
end = boundaries[1];
}
}
}
unittest {
assert ( Region("chr2:1-10").toString() == "chr2:1-10" );
assert ( Region("chr2:1-10").len == 10 );
assert ( Region("chr2").toString() == "chr2" );
assert ( Region("chr2:10").toString() == "chr2:10" );
assertThrown!Exception( Region("chr2:1:10") );
auto region1 = Region("chr1:1,000-2000");
assert(region1.reference == "chr1");
assert(region1.beg == 999);
assert(region1.end == 2000);
auto region2 = Region("chr2");
assert(region2.reference == "chr2");
assert(region2.beg == 0);
assert(region2.end == 0);
auto region3 = Region("chr3:1,000,000");
assert(region3.reference == "chr3");
assert(region3.beg == 999_999);
assert(region3.end == 0);
}
}
auto fastaRecords(string filename) {
static auto toFastaRecord(S)(S str) {
auto res = findSplit(str, "\n");
auto header = res[0];
auto seq = res[2];
return FastaRecord(header, removechars(seq, "\n"));
File f = File(filename);
FastaRecord[] records;
string lineTerm = f.byLine(KeepTerminator.yes).take(1).front.endsWith("\r\n") ? "\r\n" : "\n";
f.seek(0);
ulong offset;
foreach(line; f.byLine(KeepTerminator.no, lineTerm)) {
offset+= line.length + lineTerm.length;
if ( line.startsWith(">") ) {
records~=FastaRecord();
records[$-1].lineTerm = lineTerm;
records[$-1].header ~= line[1..$];
} else {
if ( records[$-1].lineLen == 0 ) {
records[$-1].lineLen = line.length;
}
records[$-1].sequence ~= line;
}
}
string text = cast(string)std.file.read(filename);
return records;
}
enforce(text.length > 0 && text[0] == '>');
text = text[1 .. $];
unittest {
auto testFa = tempDir.buildPath("test.fa");
scope(exit) testFa.remove;
File(testFa, "w").writeln(q"(
>chr1
acgtgagtgc
>chr2
acgtgagtgcacgtgagtgcacgtgagtgc
acgtgagtgcacgtgagtgc
>chr3 hrsv | Kilifi | partial sequence
CATGTTATTACAAGTAGTGATATTTGCCCTAATAATAATATTGTAGTGAAATCCAATTTCACAACAATGC
)".outdent().strip());
auto records = fastaRecords(testFa);
assert ( records.length == 3 );
assert ( records[0].header == "chr1" );
assert ( records[0].sequence == "acgtgagtgc" );
assert ( records[0].lineLen == 10 );
assert ( records[0].toString == q"(
>chr1
acgtgagtgc
)".outdent().strip());
assert ( records[1].header == "chr2" );
assert ( records[1].sequence == "acgtgagtgcacgtgagtgcacgtgagtgcacgtgagtgcacgtgagtgc" );
assert ( records[1].lineLen == 30 );
assert ( records[1].toString == q"(
>chr2
acgtgagtgcacgtgagtgcacgtgagtgc
acgtgagtgcacgtgagtgc
)".outdent().strip());
auto records = splitter(text, '>');
return map!toFastaRecord(records);
assert(records[2].header == "chr3 hrsv | Kilifi | partial sequence" );
assert(records[2].headerFields.length == 3);
assert(records[2].headerFields == ["chr3 hrsv","Kilifi","partial sequence"]);
}
auto fastaRegions(string filename, string[] queries) {
File f = File(filename);
FaiRecord[string] index = makeIndex(readFai(filename~=".fai"));
Region[] regions = to!(Region[])(queries);
return fetchFastaRegions(f, index, regions);
}
auto fetchFastaRegions(File fasta, FaiRecord[string] index, Region[] regions) {
FastaRecord[] records;
foreach (region; regions) {
string seq;
ulong len;
if ( region.reference in index ) {
auto reference = index[region.reference];
fasta.seek(reference.offset+region.beg+region.beg/reference.lineLen);
size_t bufLen;
if ( region.end == 0 )
bufLen = reference.seqLen + reference.seqLen/reference.lineLen;
else
bufLen = region.len + region.len/reference.lineLen;
seq = fasta.rawRead(new char[bufLen]).replace(reference.lineTerm,"").idup;
len = reference.lineLen;
}
records ~= FastaRecord(region.to!string, seq, len);
}
return records;
}
unittest {
auto testFa = tempDir.buildPath("test.fa");
scope(exit) testFa.remove;
File(testFa, "w").writeln(q"(
>chr1
acgtgagtgc
>chr2
acgtgagtgcacgtgagtgcacgtgagtgc
acgtgagtgcacgtgagtgc
)".outdent().strip());
auto faiString = "
chr1\t10\t6\t10\t11
chr2\t50\t23\t30\t31
".outdent().strip();
auto testIndex = tempDir.buildPath("test.fa.fai");
scope(exit) testIndex.remove;
File(testIndex, "w").writeln(faiString);
auto regions = fastaRegions(testFa, ["chr1:4-6", "chr2:36-45"]);
assert ( regions.length == 2 );
assert ( regions[0].header == "chr1:4-6" );
assert ( regions[0].len == 3 );
assert ( regions[0].sequence == "tga" );
assert ( regions[0].lineLen == 10 );
assert ( regions[1].header == "chr2:36-45" );
assert ( regions[1].len == 10 );
assert ( regions[1].sequence == "agtgcacgtg" );
assert ( regions[1].lineLen == 30 );
regions = fastaRegions(testFa, ["chr1"]);
assert ( regions.length == 1 );
assert ( regions[0].header == "chr1" );
assert ( regions[0].len == 10 );
assert ( regions[0].sequence == "acgtgagtgc" );
assert ( regions[0].lineLen == 10 );
regions = fastaRegions(testFa, ["chr2"]);
assert ( regions.length == 1 );
assert ( regions[0].header == "chr2" );
assert ( regions[0].len == 50 );
assert ( regions[0].sequence == "acgtgagtgcacgtgagtgcacgtgagtgcacgtgagtgcacgtgagtgc" );
assert ( regions[0].lineLen == 30 );
}

4
contrib/undead/doformat.d

@ -1306,7 +1306,7 @@ private bool needToSwapEndianess(Char)(ref FormatSpec!Char f)
}
unittest
{
{
string res;
void putc(dchar c)
{
@ -1315,7 +1315,7 @@ unittest
void myPrint(...)
{
contrib.undead.doformat.doFormat(&putc, _arguments, _argptr);
doFormat(&putc, _arguments, _argptr);
}
myPrint("The answer is %s:", 27, 6);

Loading…
Cancel
Save