You can not select more than 25 topics Topics must start with a letter or number, can include dashes ('-') and can be up to 35 characters long.

486 lines
19 KiB

This file is part of BioD.
Copyright (C) 2012-2013 Artem Tarasov <>
Permission is hereby granted, free of charge, to any person obtaining a
copy of this software and associated documentation files (the "Software"),
to deal in the Software without restriction, including without limitation
the rights to use, copy, modify, merge, publish, distribute, sublicense,
and/or sell copies of the Software, and to permit persons to whom the
Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
import bio.std.hts.bam.cigar;
import bio.std.hts.bam.reader;
import bio.std.hts.bam.writer;
import bio.std.hts.sam.reader;
import bio.std.hts.sam.header;
import bio.std.hts.bam.pileup;
import bio.std.hts.bam.baseinfo;
import bio.std.hts.bam.validation.samheader;
import bio.std.hts.bam.validation.alignment;
import bio.std.hts.utils.samheadermerger;
import bio.std.hts.sam.utils.recordparser;
import bio.core.bgzf.block;
import bio.core.bgzf.inputstream;
import bio.core.bgzf.outputstream;
import bio.core.utils.roundbuf;
import bio.core.utils.range;
import bio.core.utils.tmpfile;
import bio.core.sequence;
import bio.core.base;
import bio.core.tinymap;
import bio.core.utils.roundbuf;
import std.path;
import std.range;
import std.stdio;
// import;
import std.algorithm;
import std.array;
import std.conv;
import std.exception;
import std.math;
import std.typetuple;
import std.regex;
CigarOperation[] cigarFromString(string cigar) {
return match(cigar, regex(`(\d+)([A-Z=])`, "g")).map!(m => CigarOperation(m[1].to!uint, m[2].to!char)).array;
unittest {
stderr.writeln("Running unittests...");
// stderr.writeln("Testing extracting SAM header...");
auto fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
auto bf = new BamReader(fn);
assert(bf.header.format_version == "1.3");
assert(bf.header.sorting_order == SortingOrder.coordinate);
assert(bf.header.sequences.length == 2);
assert(bf.header.getSequenceIndex("chr1") == 0);
assert(bf.header.sequences["chr2"].length == 1584);
fn = buildPath(dirName(__FILE__), "data", "bins.bam");
bf = new BamReader(fn);
assert(bf.header.sorting_order == SortingOrder.unknown);
assert(bf.header.sequences.length == 3);
assert(bf.header.read_groups.length == 0);
assert(bf.header.getSequenceIndex("large") == 2);
assert(bf.header.sequences["small"].length == 65536);
// stderr.writeln("Testing alignment parsing...");
fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
bf = new BamReader(fn);
auto reads = bf.reads;
auto read = reads.front;
assert(equal(map!"cast(char)(a + 33)"(read.base_qualities),
assert(bf.reference(read.ref_id).name == "chr1");
assert( == "EAS56_57:6:190:289:82");
assert(read.flag == 69);
assert(read.position == 99);
assert(read.mapping_quality == 0);
assert(reads.front.cigarString() == "35M");
assert(!string() == "EAS51_64:3:190:727:308 99 chr1 103 99 35M = 263 195 GGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGG <<<<<<<<<<<<<<<<<<<<<<<<<<<::<<<844 MF:i:18 Aq:i:73 NM:i:0 UQ:i:0 H0:i:1 H1:i:0");
assert(bf.header.getSequenceIndex("chr1") == read.ref_id);
assert( == "EAS56_57:6:190:289:82");
// stderr.writeln("Testing tag parsing...");
fn = buildPath(dirName(__FILE__), "data", "tags.bam");
bf = new BamReader(fn);
foreach (alignment; bf.reads) {
auto name =;
assert(name[0..4] == "tag_");
char[] tag;
name = name[4..$];
while (name[0] != ':') {
tag ~= name[0];
name = name[1..$];
name = name[1..$];
auto value = alignment[tag.idup].toSam();
if (name != value) {
stderr.writeln("tag: ", tag, "\tname: ", name, "\tvalue: ", value);
stderr.writeln("value bam_typeid: ", alignment[tag.idup].bam_typeid);
assert(name == value);
// stderr.writeln("Testing exception handling...");
fn = buildPath(dirName(__FILE__), "data", "duplicated_block_size.bam");
assertThrown!BgzfException(new BamReader(fn));
fn = buildPath(dirName(__FILE__), "data", "no_block_size.bam");
assertThrown!BgzfException(new BamReader(fn));
fn = buildPath(dirName(__FILE__), "data", "wrong_extra_gzip_length.bam");
assertThrown!BgzfException(new BamReader(fn));
fn = buildPath(dirName(__FILE__), "data", "wrong_bc_subfield_length.bam");
assertThrown!BgzfException(reduce!"a+b.sequence_length"(0, (new BamReader(fn)).reads!withoutOffsets));
fn = buildPath(dirName(__FILE__), "data", "corrupted_zlib_archive.bam");
import bio.core.utils.zlib;
assertThrown!ZlibException(walkLength((new BamReader(fn)).reads));
// stderr.writeln("Testing random access...");
fn = buildPath(dirName(__FILE__), "data", "bins.bam");
bf = new BamReader(fn);
void compareWithNaiveApproach(int beg, int end) {
auto refseq = array(bf["large"][beg .. end]);
auto naive = array(filter!((BamRead a) {
return a.ref_id != -1 &&
bf.reference(a.ref_id).name == "large" &&
a.position < end &&
a.position + a.basesCovered() > beg; })
if (!equal(naive, refseq)) {
assert(equal(refseq, naive));
compareWithNaiveApproach(1400, 1500);
compareWithNaiveApproach( 10, 123);
compareWithNaiveApproach( 135, 1236);
compareWithNaiveApproach(1350, 3612);
compareWithNaiveApproach( 643, 1732);
compareWithNaiveApproach( 267, 1463);
compareWithNaiveApproach( 0, 30);
compareWithNaiveApproach(1363, 1612);
compareWithNaiveApproach( 361, 1231);
compareWithNaiveApproach( 322, 612);
compareWithNaiveApproach( 912, 938);
compareWithNaiveApproach( 0, 3000);
compareWithNaiveApproach( 0, 100);
compareWithNaiveApproach( 0, 1000);
compareWithNaiveApproach( 0, 1900);
compareWithNaiveApproach( 1, 279);
for (auto i = 50_000; i < 1_000_000; i += 50_000) {
compareWithNaiveApproach(i, i + 100);
auto fst_offset_tiny = bf["tiny"].startVirtualOffset();
auto fst_offset_small = bf["small"].startVirtualOffset();
auto fst_offset_large = bf["large"].startVirtualOffset();
auto fst_read_tiny = bf.getReadAt(fst_offset_tiny);
auto fst_read_small = bf.getReadAt(fst_offset_small);
auto fst_read_large = bf.getReadAt(fst_offset_large);
assert( == "tiny:r1:0..1:len1:bin4681:hexbin0x1249");
assert( == "small:r1:0..1:len1:bin4681:hexbin0x1249");
assert( == "large:r1:0..1:len1:bin4681:hexbin0x1249");
// stderr.writeln("Testing Value code...");
Value v = 5;
assert(v.toSam() == "i:5");
assert(v == 5);
assert(v == "5");
assert(v != [1,2,3]);
v = "abc";
assert(v.toSam() == "Z:abc");
assert(v == "abc");
v = [1, 2, 3];
assert(v.toSam() == "B:i,1,2,3");
assert(v == [1,2,3]);
assert(v == "[1, 2, 3]");
v = [1.5, 2.3, 17.0];
assert(v.toSam() == "B:f,1.5,2.3,17");
assert(approxEqual(to!(float[])(v), [1.5, 2.3, 17]));
v = 5.6;
assert(v.toSam() == "f:5.6");
assert(approxEqual(to!float(v), 5.6));
v = -17;
assert(v.toSam() == "i:-17");
assert(v == -17);
assert(v == "-17");
v = 297u;
assert(v.toSam() == "i:297");
assert(v == 297);
assert(v == "297");
short[] array_of_shorts = [4, 5, 6];
v = array_of_shorts;
assert(v.toSam() == "B:s,4,5,6");
assert(to!(short[])(v) == array_of_shorts);
assert(v == [4,5,6]);
assert(v == "[4, 5, 6]");
v = null;
v = "0eabcf123";
assert(v == "0eabcf123");
// stderr.writeln("Testing parseAlignmentLine/toSam functions...");
fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
bf = new BamReader(fn);
foreach (read; bf.reads) {
auto line =!string();
auto read2 = parseAlignmentLine(line, bf.header);
if (read != read2) {
assert(read == read2);
fn = buildPath(dirName(__FILE__), "data", "tags.bam");
bf = new BamReader(fn);
foreach (read; bf.reads) {
auto line =!string();
auto read2 = parseAlignmentLine(line, bf.header);
if (read != read2 && isValid(read)) {
assert(read == read2 || !isValid(read));
// stderr.writeln("Testing BAM writing...");
fn = buildPath(dirName(__FILE__), "data", "ex1_header.bam");
bf = new BamReader(fn);
string tmp = tmpFile("12035913820619231129310.bam");
auto stream = new, "wb+");
auto writer = new BamWriter(stream);
foreach (read; bf.reads)
assert(walkLength((new BamReader(stream)).reads) == 3270);
// stderr.writeln("Testing SAM reading...");
auto sf = new SamReader(buildPath(dirName(__FILE__), "data", "ex1_header.sam"));
assert(sf.reads.front.ref_id == 0);
assert(equal(sf.reads, bf.reads!withoutOffsets));
// stderr.writeln("Testing pileup (high-level aspects)...");
// All of pileup functions should automatically filter out unmapped reads.
// When reads in a range are aligned to different references,
// pileup objects should process only the first one.
bf = new BamReader(fn); // chr1, chr2
auto pileup = makePileup(bf.reads);
foreach (column; pileup) {
foreach (read; column.reads) {
assert(bf.reference_sequences[read.ref_id].name == "chr1");
assert(read.ref_id == column.ref_id);
// However, if pileupColumns is used, columns corresponding to chr1
// should come first, and after them -- those for chr2
auto columns = pileupColumns(bf.reads);
int current_ref_id = -1;
// [99 .. 1569] [1 .. 1567]
int[2] expected_columns = [1470, 1567];
foreach (column; columns) {
int ref_id = column.ref_id;
if (ref_id != current_ref_id) {
assert(ref_id > current_ref_id);
switch (ref_id) {
case 0:
assert( == "EAS56_57:6:190:289:82");
assert(column.position == 99);
case 1:
assert( == "B7_591:8:4:841:340");
assert(column.position == 0);
current_ref_id = ref_id;
if (!column.reads.empty) {
foreach (read; column.reads) {
assert(read.ref_id == ref_id);
assert(expected_columns == [0, 0]);
// stderr.writeln("Testing basesWith functionality...");
fn = buildPath(dirName(__FILE__), "data", "mg1655_chunk.bam");
bf = new BamReader(fn);
auto rg = bf.header.read_groups.values.front;
auto flow_order = rg.flow_order;
auto key_sequence = rg.key_sequence;
auto reads = array(bf.reads);
auto read = reads[1];
alias TypeTuple!("FZ", "MD",
Option.mdNextOp) Options;
auto bases = basesWith!Options(read,
typeof(bases.front) bfront;
assert(bfront.md_operation.match == 309);
assert(bfront.md_operation_offset == 0);
assert(equal(bfront.next_md_operation.deletion, "G"));
assert(equal(bfront.cigar_after, read.cigar[1 .. $]));
assert(equal(drop(map!"a.reference_base"(bases), 191),
assert(equal(bases, read.sequence));
assert(equal(take(map!"a.flow_call.intensity_value"(bases), 92),
[219, 219, 194, 194, 92, 107, 83, 198, 198, 78,
// A A C C T G A T T A
292, 292, 292, 81, 79, 78, 95, 99, 315, 315, 315,
// C C C A T C A G T T T
89, 79, 290, 290, 290, 100, 209, 209, 87, 80,
// G C G G G T G G C A
191, 191, 101, 179, 179, 210, 210, 99, 184, 184,
// C C A T T G G T A A
90, 91, 193, 193, 66, 100, 112, 79, 108, 106, 212, 212,
// C A C C A T G C A C A A
90, 96, 111, 94, 64, 94, 187, 187, 84, 110, 98, 102, 100,
// C T A C T C G G T G C T C
93, 89, 205, 205, 107, 98, 96, 91, 203, 203, 68, 180, 180,
// G C G G A C G A C C G T T
118, 246, 246, 91, 102, 94, 116, 90, 99, 101, 298, 298, 298
// C G G T G C T G C T G G G
// bases must be the same
foreach (r; reads) {
if (r.is_unmapped) continue;
if (r.cigar.length == 0) continue;
if (r.is_reverse_strand) {
bases = basesWith!Options(r, arg!"flowOrder"(flow_order),
// if reverse strand, bases are also reverse complemented
assert(equal(bases, map!"a.complement"(retro(r.sequence))));
} else {
bases = basesWith!Options(r, arg!"flowOrder"(flow_order),
assert(equal(bases, r.sequence));
// stderr.writeln("Testing extended CIGAR conversion...");
auto cigars = ["2M1D7M1D6M1D13M1D5M1D12M2D7M1D10M1D17M1D12M3D23M",
auto md_ops = ["2^G7^G6^T13^C5^G12^AC1T5^G10^T17^A12^TAA0T22",
auto expected = ["2=1D7=1D6=1D13=1D5=1D12=2D1=1X5=1D10=1D17=1D12=3D1X22=",
foreach (cigar, md, expected_cigar; zip(cigars, md_ops, expected))
assert(makeExtendedCigar(cigar, md).equal(expected_cigar));
/* */
fn = buildPath(dirName(__FILE__), "data", "b.sam");
auto sam = new SamReader(fn);
auto writer = new BamWriter("/dev/null", 0);
foreach (r; sam.reads)
void main() {}