From 9d2fd59a7b4c7a6a269c33b16e956b4b5a975267 Mon Sep 17 00:00:00 2001 From: Munyoki Kilyungi Date: Thu, 7 Dec 2023 16:14:45 +0300 Subject: Update documentation. Signed-off-by: Munyoki Kilyungi --- rdf-documentation/dataset-metadata.md | 32 ++++++---- rdf-documentation/genbank-metadata.md | 6 +- rdf-documentation/generif-metadata.md | 12 ++-- rdf-documentation/genotype-metadata.md | 7 +- rdf-documentation/phenotype-metadata.md | 19 +++--- rdf-documentation/probeset-metadata.md | 102 ++++++++++++++++++------------ rdf-documentation/publication-metadata.md | 2 +- rdf-documentation/strains.md | 12 ++-- rdf-documentation/tissue-metadata.md | 2 +- 9 files changed, 113 insertions(+), 81 deletions(-) (limited to 'rdf-documentation') diff --git a/rdf-documentation/dataset-metadata.md b/rdf-documentation/dataset-metadata.md index 59246b2..d5f4f2b 100644 --- a/rdf-documentation/dataset-metadata.md +++ b/rdf-documentation/dataset-metadata.md @@ -6,7 +6,7 @@ The following SQL query was executed: ```sql -SELECT InfoFiles.InfoPageName, IF(GenoFreeze.Id IS NOT NULL, 'gnc:Genotype', IF(PublishFreeze.Id IS NOT NULL, 'gnc:Phenotype', IF(ProbeSetFreeze.Name IS NOT NULL, 'gnc:Probeset', ''))) AS DatasetType, InfoFiles.InfoPageName, IFNULL(GenoFreeze.FullName, IFNULL(PublishFreeze.FullName, '')) AS DatasetFullName, Datasets.DatasetName AS DatasetGroup, Datasets.PublicationTitle, InfoFiles.InfoFileTitle, IFNULL(GenoFreeze.CreateTime, IFNULL(PublishFreeze.CreateTime, IFNULL(ProbeSetFreeze.CreateTime, ''))) AS createTimeGenoFreeze, Investigators.FirstName, Investigators.LastName, Investigators.Email, Organizations.OrganizationName, InfoFiles.GN_AccesionId, DatasetStatus.DatasetStatusName, InbredSet.Name AS InbredSetName, Tissue.Short_Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS AvgMethodName, GeneChip.Name AS GeneChip, Datasets.Summary, IFNULL(Datasets.GeoSeries, '') AS GeoSeries, Datasets.AboutTissue, InfoFiles.Specifics, Datasets.AboutCases, Datasets.AboutPlatform, Datasets.AboutDataProcessing, Datasets.Notes, Datasets.ExperimentDesign, Datasets.Contributors, Datasets.Citation, Datasets.Acknowledgment FROM InfoFiles LEFT JOIN PublishFreeze ON InfoFiles.InfoPageName = PublishFreeze.Name LEFT JOIN GenoFreeze ON InfoFiles.InfoPageName = GenoFreeze.Name LEFT JOIN ProbeSetFreeze ON InfoFiles.InfoPageName = ProbeSetFreeze.Name LEFT JOIN InbredSet ON InfoFiles.InbredSetId = InbredSet.InbredSetId LEFT JOIN Species ON InfoFiles.SpeciesId = Species.SpeciesId LEFT JOIN Datasets USING (DatasetId) LEFT JOIN DatasetStatus USING (DatasetStatusId) LEFT JOIN Tissue USING (TissueId) LEFT JOIN Investigators USING (InvestigatorId) LEFT JOIN AvgMethod USING (AvgMethodId) LEFT JOIN Organizations USING (OrganizationId) LEFT JOIN GeneChip USING (GeneChipId) WHERE GN_AccesionId IS NOT NULL +SELECT InfoFiles.InfoPageName, IF(GenoFreeze.Id IS NOT NULL, 'gnc:Genotype', IF(PublishFreeze.Id IS NOT NULL, 'gnc:Phenotype', IF(ProbeSetFreeze.Name IS NOT NULL, 'gnc:Probeset', ''))) AS DatasetType, InfoFiles.InfoPageName, IFNULL(GenoFreeze.FullName, IFNULL(PublishFreeze.FullName, '')) AS DatasetFullName, Datasets.DatasetName AS DatasetGroup, Datasets.PublicationTitle, InfoFiles.InfoFileTitle, IFNULL(GenoFreeze.CreateTime, IFNULL(PublishFreeze.CreateTime, IFNULL(ProbeSetFreeze.CreateTime, ''))) AS createTimeGenoFreeze, Investigators.FirstName, Investigators.LastName, Investigators.Email, Organizations.OrganizationName, InfoFiles.GN_AccesionId, DatasetStatus.DatasetStatusName, IFNULL(InbredSet.Name, IFNULL(PublishInbredSet.Name, GenoInbredSet.Name)) AS InbredSetName, Tissue.Short_Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS AvgMethodName, GeneChip.Name AS GeneChip, Datasets.Summary, IFNULL(Datasets.GeoSeries, '') AS GeoSeries, Datasets.AboutTissue, InfoFiles.Specifics, Datasets.AboutCases, Datasets.AboutPlatform, Datasets.AboutDataProcessing, Datasets.Notes, Datasets.ExperimentDesign, Datasets.Contributors, Datasets.Citation, Datasets.Acknowledgment FROM InfoFiles LEFT JOIN PublishFreeze ON InfoFiles.InfoPageName = PublishFreeze.Name LEFT JOIN GenoFreeze ON InfoFiles.InfoPageName = GenoFreeze.Name LEFT JOIN ProbeSetFreeze ON InfoFiles.InfoPageName = ProbeSetFreeze.Name LEFT JOIN InbredSet ON InfoFiles.InbredSetId = InbredSet.InbredSetId LEFT JOIN Species ON InfoFiles.SpeciesId = Species.SpeciesId LEFT JOIN Datasets USING (DatasetId) LEFT JOIN DatasetStatus USING (DatasetStatusId) LEFT JOIN Tissue USING (TissueId) LEFT JOIN Investigators USING (InvestigatorId) LEFT JOIN AvgMethod USING (AvgMethodId) LEFT JOIN Organizations USING (OrganizationId) LEFT JOIN GeneChip USING (GeneChipId) LEFT JOIN InbredSet PublishInbredSet ON PublishFreeze.InbredSetId = PublishInbredSet.InbredSetId LEFT JOIN InbredSet GenoInbredSet ON GenoFreeze.InbredSetId = GenoInbredSet.InbredSetId WHERE GN_AccesionId IS NOT NULL ``` The above query results to triples that have the form: @@ -23,7 +23,7 @@ gn:Infofiles_infopagename_ -> dcat:contactPoint -> gn:investigatorInvestigators_ gn:Infofiles_infopagename_ -> foaf:Organization -> Organizations(OrganizationName) gn:Infofiles_infopagename_ -> dct:identifier -> GNInfoFiles(GN_AccesionId) gn:Infofiles_infopagename_ -> dct:accessRights -> datasetstatus(datasetstatusname) -gn:Infofiles_infopagename_ -> xkos:classifiedUnder -> gn:setInbredset_inbredsetname +gn:Infofiles_infopagename_ -> gnt:belongsToGroup -> gn:setInbredsetname gn:Infofiles_infopagename_ -> gnt:hasTissue -> gn:tissueTissue_short_name gn:Infofiles_infopagename_ -> gnt:usesNormalization -> gn:avgMethodAvgmethod_avgmethodname gn:Infofiles_infopagename_ -> gnt:usesPlatform -> gn:platformGenechip_genechip @@ -79,7 +79,7 @@ gn:Br_u_0803_m dcat:contactPoint gn:investigatorRobert_williams_rwilliams_uthsc. gn:Br_u_0803_m foaf:Organization "University of Tennessee Health Science Center" . gn:Br_u_0803_m dct:identifier "GN1" . gn:Br_u_0803_m dct:accessRights "public" . -gn:Br_u_0803_m xkos:classifiedUnder gn:setBxd . +gn:Br_u_0803_m gnt:belongsToGroup gn:setBxd . gn:Br_u_0803_m gnt:hasTissue gn:tissueBrn . gn:Br_u_0803_m gnt:usesNormalization gn:avgMethodMas5 . gn:Br_u_0803_m gnt:usesPlatform gn:platformMg_u74av2 . @@ -106,12 +106,13 @@ SELECT PublishFreeze.Name, PublishFreeze.FullName, PublishFreeze.Name, PublishFr The above query results to triples that have the form: ```text +gn:Publishfreeze_name_ -> rdf:type -> dcat:Dataset gn:Publishfreeze_name_ -> xkos:classifiedUnder -> gnc:Phenotype gn:Publishfreeze_name_ -> dct:title -> PublishFreeze(FullName) gn:Publishfreeze_name_ -> rdfs:label -> PublishFreeze(Name) gn:Publishfreeze_name_ -> skos:altLabel -> PublishFreeze(ShortName) gn:Publishfreeze_name_ -> dct:created -> "PublishFreeze(CreateTime)"^^xsd:date -gn:Publishfreeze_name_ -> xkos:classifiedUnder -> gn:setInbredset_inbredsetname +gn:Publishfreeze_name_ -> gnt:belongsToGroup -> gn:setInbredset_inbredsetname ``` Here's an example query: @@ -133,9 +134,9 @@ PREFIX taxon: PREFIX dct: SELECT * WHERE { + ?s rdf:type dcat:Dataset . ?s xkos:classifiedUnder gnc:Phenotype . ?s dct:title "B6D2F2 PSU Phenotypes" . - ?s rdfs:label "B6D2F2-PSUPublish" . ?s ?p ?o . } ``` @@ -143,12 +144,13 @@ SELECT * WHERE { Expected Result: ```rdf +gn:B6d2f2_psupublish rdf:type dcat:Dataset . gn:B6d2f2_psupublish xkos:classifiedUnder gnc:Phenotype . gn:B6d2f2_psupublish dct:title "B6D2F2 PSU Phenotypes" . gn:B6d2f2_psupublish rdfs:label "B6D2F2-PSUPublish" . gn:B6d2f2_psupublish skos:altLabel "B6D2F2 PSU Publish" . gn:B6d2f2_psupublish dct:created "2015-03-18"^^xsd:date . -gn:B6d2f2_psupublish xkos:classifiedUnder gn:setB6d2f2-psu . +gn:B6d2f2_psupublish gnt:belongsToGroup gn:setB6d2f2-psu . ``` @@ -159,18 +161,19 @@ gn:B6d2f2_psupublish xkos:classifiedUnder gn:setB6d2f2-psu . The following SQL query was executed: ```sql -SELECT GenoFreeze.Name, GenoFreeze.Name, GenoFreeze.FullName, GenoFreeze.ShortName, GenoFreeze.CreateTime, InbredSet.Name FROM GenoFreeze LEFT JOIN InfoFiles ON InfoFiles.InfoPageName = GenoFreeze.Name LEFT JOIN InbredSet ON GenoFreeze.InbredSetId = InbredSet.InbredSetId WHERE GenoFreeze.public > 0 AND GenoFreeze.confidentiality < 1 AND InfoFiles.InfoPageName IS NULL +SELECT GenoFreeze.Name, GenoFreeze.Name, GenoFreeze.FullName, GenoFreeze.ShortName, GenoFreeze.CreateTime, InbredSet.Name AS InbredSetName FROM GenoFreeze LEFT JOIN InfoFiles ON InfoFiles.InfoPageName = GenoFreeze.Name LEFT JOIN InbredSet ON GenoFreeze.InbredSetId = InbredSet.InbredSetId WHERE GenoFreeze.public > 0 AND GenoFreeze.confidentiality < 1 AND InfoFiles.InfoPageName IS NULL ``` The above query results to triples that have the form: ```text +gn:Genofreeze_name_ -> rdf:type -> dcat:Dataset gn:Genofreeze_name_ -> xkos:classifiedUnder -> gnc:Genotype gn:Genofreeze_name_ -> rdfs:label -> GenoFreeze(Name) gn:Genofreeze_name_ -> dct:title -> GenoFreeze(FullName) gn:Genofreeze_name_ -> skos:altLabel -> GenoFreeze(ShortName) gn:Genofreeze_name_ -> dct:created -> "GenoFreeze(CreateTime)"^^xsd:date -gn:Genofreeze_name_ -> xkos:classifiedUnder -> gn:setInbredset_name +gn:Genofreeze_name_ -> gnt:belongsToGroup -> gn:setInbredset_inbredsetname ``` Here's an example query: @@ -192,9 +195,9 @@ PREFIX taxon: PREFIX dct: SELECT * WHERE { + ?s rdf:type dcat:Dataset . ?s xkos:classifiedUnder gnc:Genotype . ?s rdfs:label "B6D2RIGeno" . - ?s dct:title "B6D2RI Genotypes" . ?s ?p ?o . } ``` @@ -202,12 +205,13 @@ SELECT * WHERE { Expected Result: ```rdf +gn:B6d2rigeno rdf:type dcat:Dataset . gn:B6d2rigeno xkos:classifiedUnder gnc:Genotype . gn:B6d2rigeno rdfs:label "B6D2RIGeno" . gn:B6d2rigeno dct:title "B6D2RI Genotypes" . gn:B6d2rigeno skos:altLabel "B6D2RIGeno" . gn:B6d2rigeno dct:created "2022-10-24"^^xsd:date . -gn:B6d2rigeno xkos:classifiedUnder gn:setB6d2rigeno . +gn:B6d2rigeno gnt:belongsToGroup gn:setB6d2ri . ``` @@ -224,6 +228,7 @@ SELECT ProbeSetFreeze.Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS A The above query results to triples that have the form: ```text +gn:Probesetfreeze_name_ -> rdf:type -> dcat:Dataset gn:Probesetfreeze_name_ -> xkos:classifiedUnder -> gnc:Probeset gn:Probesetfreeze_name_ -> gnt:usesNormalization -> gn:avgMethodAvgmethod_avgmethodname gn:Probesetfreeze_name_ -> dct:title -> ProbeSetFreeze(FullName) @@ -233,7 +238,7 @@ gn:Probesetfreeze_name_ -> skos:altLabel -> ProbeSetFreeze(Name2) gn:Probesetfreeze_name_ -> dct:created -> "ProbeSetFreeze(CreateTime)"^^xsd:datetime gn:Probesetfreeze_name_ -> gnt:usesDataScale -> ProbeSetFreeze(DataScale) gn:Probesetfreeze_name_ -> gnt:hasTissue -> gn:tissueTissue_short_name -gn:Probesetfreeze_name_ -> xkos:classifiedUnder -> gn:setInbredset_inbredsetname +gn:Probesetfreeze_name_ -> gnt:belongsToGroup -> gn:setInbredset_inbredsetname ``` Here's an example query: @@ -255,10 +260,10 @@ PREFIX taxon: PREFIX dct: SELECT * WHERE { + ?s rdf:type dcat:Dataset . ?s xkos:classifiedUnder gnc:Probeset . ?s gnt:usesNormalization gn:avgMethodRankinv . ?s dct:title "UBC/CMMT BXD P0 Cerebellum ILM Mouse WG-6 v2.0 (May13) RankInv" . - ?s rdfs:label "UBC/CMMT BXD P0 Cerebellum ILM Mouse WG-6 v2.0 (May13) RankInv" . ?s ?p ?o . } ``` @@ -266,6 +271,7 @@ SELECT * WHERE { Expected Result: ```rdf +gn:Cmmtubcbxdp00cerilm0513 rdf:type dcat:Dataset . gn:Cmmtubcbxdp00cerilm0513 xkos:classifiedUnder gnc:Probeset . gn:Cmmtubcbxdp00cerilm0513 gnt:usesNormalization gn:avgMethodRankinv . gn:Cmmtubcbxdp00cerilm0513 dct:title "UBC/CMMT BXD P0 Cerebellum ILM Mouse WG-6 v2.0 (May13) RankInv" . @@ -275,7 +281,7 @@ gn:Cmmtubcbxdp00cerilm0513 skos:altLabel "CMMTUBCBXDP00CerILMMay13" . gn:Cmmtubcbxdp00cerilm0513 dct:created "2013-04-22"^^xsd:datetime . gn:Cmmtubcbxdp00cerilm0513 gnt:usesDataScale "log2" . gn:Cmmtubcbxdp00cerilm0513 gnt:hasTissue gn:tissueCb . -gn:Cmmtubcbxdp00cerilm0513 xkos:classifiedUnder gn:setBxd . +gn:Cmmtubcbxdp00cerilm0513 gnt:belongsToGroup gn:setBxd . ``` diff --git a/rdf-documentation/genbank-metadata.md b/rdf-documentation/genbank-metadata.md index 7e519fd..e91b459 100644 --- a/rdf-documentation/genbank-metadata.md +++ b/rdf-documentation/genbank-metadata.md @@ -13,7 +13,7 @@ The above query results to triples that have the form: ```text genbank:Genbank(Id) -> gnt:hasSequence -> Genbank(Sequence) -genbank:Genbank(Id) -> xkos:classifiedUnder -> gn:Species_fullname +genbank:Genbank(Id) -> gnt:belongsToSpecies -> gn:Species_fullname ``` Here's an example query: @@ -36,7 +36,7 @@ PREFIX owl: SELECT * WHERE { ?s gnt:hasSequence "GAAAAGGACGAGAGAAAATTATTTTTAAGATAATTAAACATAAAAACCCTGGTGCTTATTACATTATAAAGTACGTTTTTAAAAACCCACAAACTATTATACATACGTTTATGAATCAATTAAATACTCTGCACTTGTTAGGAACACGCATATCCCTTCTTTGTTGAGTTTAACGGAACGGGACAGCGGCGTGCGCCCGCGGCTGGGCTGCTCTGGCCGCGGGTCTCCCCAGGCG" . - ?s xkos:classifiedUnder gn:Mus_musculus . + ?s gnt:belongsToSpecies gn:Mus_musculus . ?s ?p ?o . } ``` @@ -45,6 +45,6 @@ Expected Result: ```rdf genbank:AA002843 gnt:hasSequence "GAAAAGGACGAGAGAAAATTATTTTTAAGATAATTAAACATAAAAACCCTGGTGCTTATTACATTATAAAGTACGTTTTTAAAAACCCACAAACTATTATACATACGTTTATGAATCAATTAAATACTCTGCACTTGTTAGGAACACGCATATCCCTTCTTTGTTGAGTTTAACGGAACGGGACAGCGGCGTGCGCCCGCGGCTGGGCTGCTCTGGCCGCGGGTCTCCCCAGGCG" . -genbank:AA002843 xkos:classifiedUnder gn:Mus_musculus . +genbank:AA002843 gnt:belongsToSpecies gn:Mus_musculus . ``` diff --git a/rdf-documentation/generif-metadata.md b/rdf-documentation/generif-metadata.md index 7e3c4d6..37424f8 100644 --- a/rdf-documentation/generif-metadata.md +++ b/rdf-documentation/generif-metadata.md @@ -56,7 +56,7 @@ SELECT GeneRIF.symbol, GeneRIF.comment, GeneRIF.createtime AS EntryCreateTime, G The above query results to triples that have the form: ```text -gn:symbolGeneRIF_symbol_ -> rdfs:comment -> [ rdf:type gnc:GNWikiEntry ; xkos:classifiedUnder gn:Species_fullname ; rdfs:comment "GeneRIFcomment"^^xsd:string ; dct:references pubmed:GeneRIF(PMID) ; dct:creator gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email ; gnt:belongsToCategory "GeneCategory" ; foaf:homepage "GeneRIF(weburl)" ; ] +gn:symbolGeneRIF_symbol_ -> rdfs:comment -> [ rdf:type gnc:GNWikiEntry ; gnt:belongsToSpecies gn:Species_fullname ; rdfs:comment "GeneRIFcomment"^^xsd:string ; dct:references pubmed:GeneRIF(PMID) ; dct:creator gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email ; gnt:belongsToCategory "GeneCategory" ; foaf:homepage "GeneRIF(weburl)" ; ] ``` Here's an example query: @@ -77,7 +77,7 @@ PREFIX xsd: PREFIX owl: SELECT * WHERE { - ?s rdfs:comment #{\x5b; rdf:type gnc:GNWikiEntry ; xkos:classifiedUnder gn:Mus_musculus ; rdfs:comment "Part 2 of the Slc9a1 wiki.\\r\\n\\r\\nThe human SLC9A1 gene was cloned and mapped to human chromosome 1p Lifton et al., 1990.\\r\\n\\r\\nThe mouse Slc9a1 gene maps to chromosome 4. Morahan et al., 1993. There are three common alleles of Slc9a1, originally detected by RFLP analyses. Each of these allelic SLC9A1 proteins have different levels of antiporter activity. Morahan et al. 1994 Remarkably, intracellular pH varies between strains based on their Slc9a1 alleles. McClive et al. 1996."^^xsd:string ; dct:created "2011-06-10T12:06:30"^^xsd:datetime ; dct:references pubmed:094369 ; dct:references pubmed:8016086 ; dct:references pubmed:8550102 ; dct:creator gn:investigatorGrant_morahan_gem_waimr.uwa.edu.au ; gnt:belongsToCategory "Biochemistry" ; gnt:belongsToCategory "Genetic variation and alleles" ; gnt:belongsToCategory "Physiology and function" ; \x5d; }# . + ?s rdfs:comment #{\x5b; rdf:type gnc:GNWikiEntry ; gnt:belongsToSpecies gn:Mus_musculus ; rdfs:comment "Part 2 of the Slc9a1 wiki.\\r\\n\\r\\nThe human SLC9A1 gene was cloned and mapped to human chromosome 1p Lifton et al., 1990.\\r\\n\\r\\nThe mouse Slc9a1 gene maps to chromosome 4. Morahan et al., 1993. There are three common alleles of Slc9a1, originally detected by RFLP analyses. Each of these allelic SLC9A1 proteins have different levels of antiporter activity. Morahan et al. 1994 Remarkably, intracellular pH varies between strains based on their Slc9a1 alleles. McClive et al. 1996."^^xsd:string ; dct:created "2011-06-10T12:06:30"^^xsd:datetime ; dct:references pubmed:094369 ; dct:references pubmed:8016086 ; dct:references pubmed:8550102 ; dct:creator gn:investigatorGrant_morahan_gem_waimr.uwa.edu.au ; gnt:belongsToCategory "Biochemistry" ; gnt:belongsToCategory "Genetic variation and alleles" ; gnt:belongsToCategory "Physiology and function" ; \x5d; }# . ?s ?p ?o . } ``` @@ -85,7 +85,7 @@ SELECT * WHERE { Expected Result: ```rdf -gn:symbolSlc9a1 rdfs:comment [ rdf:type gnc:GNWikiEntry ; xkos:classifiedUnder gn:Mus_musculus ; rdfs:comment "Part 2 of the Slc9a1 wiki.\\r\\n\\r\\nThe human SLC9A1 gene was cloned and mapped to human chromosome 1p Lifton et al., 1990.\\r\\n\\r\\nThe mouse Slc9a1 gene maps to chromosome 4. Morahan et al., 1993. There are three common alleles of Slc9a1, originally detected by RFLP analyses. Each of these allelic SLC9A1 proteins have different levels of antiporter activity. Morahan et al. 1994 Remarkably, intracellular pH varies between strains based on their Slc9a1 alleles. McClive et al. 1996."^^xsd:string ; dct:created "2011-06-10T12:06:30"^^xsd:datetime ; dct:references pubmed:094369 ; dct:references pubmed:8016086 ; dct:references pubmed:8550102 ; dct:creator gn:investigatorGrant_morahan_gem_waimr.uwa.edu.au ; gnt:belongsToCategory "Biochemistry" ; gnt:belongsToCategory "Genetic variation and alleles" ; gnt:belongsToCategory "Physiology and function" ; ] . +gn:symbolSlc9a1 rdfs:comment [ rdf:type gnc:GNWikiEntry ; gnt:belongsToSpecies gn:Mus_musculus ; rdfs:comment "Part 2 of the Slc9a1 wiki.\\r\\n\\r\\nThe human SLC9A1 gene was cloned and mapped to human chromosome 1p Lifton et al., 1990.\\r\\n\\r\\nThe mouse Slc9a1 gene maps to chromosome 4. Morahan et al., 1993. There are three common alleles of Slc9a1, originally detected by RFLP analyses. Each of these allelic SLC9A1 proteins have different levels of antiporter activity. Morahan et al. 1994 Remarkably, intracellular pH varies between strains based on their Slc9a1 alleles. McClive et al. 1996."^^xsd:string ; dct:created "2011-06-10T12:06:30"^^xsd:datetime ; dct:references pubmed:094369 ; dct:references pubmed:8016086 ; dct:references pubmed:8550102 ; dct:creator gn:investigatorGrant_morahan_gem_waimr.uwa.edu.au ; gnt:belongsToCategory "Biochemistry" ; gnt:belongsToCategory "Genetic variation and alleles" ; gnt:belongsToCategory "Physiology and function" ; ] . ``` @@ -102,7 +102,7 @@ SELECT GeneRIF_BASIC.symbol AS GeneRIFSymbol, GeneRIF_BASIC.comment, Species.Ful The above query results to triples that have the form: ```text -gn:symbolGeneRIF_BASIC_GeneRIFSymbol_ -> rdfs:comment -> [ rdf:type gnc:NCBIWikiEntry ; rdfs:comment "GeneRIF_BASICcomment"^^xsd:string ; xkos:classifiedUnder gn:Species_speciesfullname ; skos:notation taxon:GeneRIF_BASIC(TaxonomicId) ; gnt:hasGeneId generif:GeneRIF_BASIC(GeneId) ; gnt:hasVersionId 'GeneRIF_BASIC(VersionId)'^^xsd:integer ; dct:references pubmed:GeneRIF_BASIC(PMID) ; ] +gn:symbolGeneRIF_BASIC_GeneRIFSymbol_ -> rdfs:comment -> [ rdf:type gnc:NCBIWikiEntry ; rdfs:comment "GeneRIF_BASICcomment"^^xsd:string ; gnt:belongsToSpecies gn:Species_speciesfullname ; skos:notation taxon:GeneRIF_BASIC(TaxonomicId) ; gnt:hasGeneId generif:GeneRIF_BASIC(GeneId) ; gnt:hasVersionId 'GeneRIF_BASIC(VersionId)'^^xsd:integer ; dct:references pubmed:GeneRIF_BASIC(PMID) ; ] ``` Here's an example query: @@ -123,7 +123,7 @@ PREFIX xsd: PREFIX owl: SELECT * WHERE { - ?s rdfs:comment #{\x5b; rdf:type gnc:NCBIWikiEntry ; rdfs:comment "he results demonstrate that apoM-S1P inhibits ox-LDL-induced inflammation in HUVECs via the S1PR2-mediated PI3K/Akt signaling pathway."^^xsd:string ; xkos:classifiedUnder gn:Homo_sapiens ; skos:notation taxon:9606 ; gnt:hasGeneId generif:55937 ; gnt:hasVersionId '1'^^xsd:integer ; dct:created "2019-08-03T07:43:00"^^xsd:datetime ; \x5d;}# . + ?s rdfs:comment #{\x5b; rdf:type gnc:NCBIWikiEntry ; rdfs:comment "he results demonstrate that apoM-S1P inhibits ox-LDL-induced inflammation in HUVECs via the S1PR2-mediated PI3K/Akt signaling pathway."^^xsd:string ; gnt:belongsToSpecies gn:Homo_sapiens ; skos:notation taxon:9606 ; gnt:hasGeneId generif:55937 ; gnt:hasVersionId '1'^^xsd:integer ; dct:created "2019-08-03T07:43:00"^^xsd:datetime ; \x5d;}# . ?s ?p ?o . } ``` @@ -131,6 +131,6 @@ SELECT * WHERE { Expected Result: ```rdf -gn:symbolAPOM rdfs:comment [ rdf:type gnc:NCBIWikiEntry ; rdfs:comment "he results demonstrate that apoM-S1P inhibits ox-LDL-induced inflammation in HUVECs via the S1PR2-mediated PI3K/Akt signaling pathway."^^xsd:string ; xkos:classifiedUnder gn:Homo_sapiens ; skos:notation taxon:9606 ; gnt:hasGeneId generif:55937 ; gnt:hasVersionId '1'^^xsd:integer ; dct:created "2019-08-03T07:43:00"^^xsd:datetime ; ] . +gn:symbolAPOM rdfs:comment [ rdf:type gnc:NCBIWikiEntry ; rdfs:comment "he results demonstrate that apoM-S1P inhibits ox-LDL-induced inflammation in HUVECs via the S1PR2-mediated PI3K/Akt signaling pathway."^^xsd:string ; gnt:belongsToSpecies gn:Homo_sapiens ; skos:notation taxon:9606 ; gnt:hasGeneId generif:55937 ; gnt:hasVersionId '1'^^xsd:integer ; dct:created "2019-08-03T07:43:00"^^xsd:datetime ; ] . ``` diff --git a/rdf-documentation/genotype-metadata.md b/rdf-documentation/genotype-metadata.md index 4ca1bd2..e64be09 100644 --- a/rdf-documentation/genotype-metadata.md +++ b/rdf-documentation/genotype-metadata.md @@ -13,7 +13,7 @@ The above query results to triples that have the form: ```text gn:Geno_name_ -> rdf:type -> gnc:Genotype -gn:Geno_name_ -> skos:prefLabel -> GenoName +gn:Geno_name_ -> rdfs:label -> GenoName gn:Geno_name_ -> gnt:chr -> Geno(Chr) gn:Geno_name_ -> gnt:mb -> "Mb"^^xsd:double gn:Geno_name_ -> gnt:mbMm8 -> "Mb_mm8"^^xsd:double @@ -36,11 +36,12 @@ PREFIX rdf: PREFIX rdfs: PREFIX owl: PREFIX skos: +PREFIX xkos: PREFIX xsd: SELECT * WHERE { ?s rdf:type gnc:Genotype . - ?s skos:prefLabel "D1Mit296" . + ?s rdfs:label "D1Mit296" . ?s gnt:chr "1" . ?s gnt:mb #{"9.749729"^^xsd:double}# . ?s ?p ?o . @@ -51,7 +52,7 @@ Expected Result: ```rdf gn:D1mit296 rdf:type gnc:Genotype . -gn:D1mit296 skos:prefLabel "D1Mit296" . +gn:D1mit296 rdfs:label "D1Mit296" . gn:D1mit296 gnt:chr "1" . gn:D1mit296 gnt:mb "9.749729"^^xsd:double . gn:D1mit296 gnt:mbMm8 "9.734943"^^xsd:double . diff --git a/rdf-documentation/phenotype-metadata.md b/rdf-documentation/phenotype-metadata.md index 8a7e421..d811d40 100644 --- a/rdf-documentation/phenotype-metadata.md +++ b/rdf-documentation/phenotype-metadata.md @@ -6,14 +6,14 @@ The following SQL query was executed: ```sql -SELECT CONCAT(IFNULL(InbredSet.Name, PublishXRef.InbredSetId), '_', PublishXRef.Id) AS Phenotype, InbredSet.Name AS InbredSetName, PublishXRef.Id, CONCAT(IFNULL(InbredSet.Name, PublishXRef.InbredSetId), '_', PublishXRef.Id) AS Phenotype, Phenotype.Post_publication_description, Phenotype.Post_publication_abbreviation, Phenotype.Lab_code, Phenotype.Submitter, Phenotype.Owner, IFNULL(PublishXRef.mean, '') AS mean, PublishXRef.Locus, IFNULL(PublishXRef.LRS, '') AS lrs, IFNULL(PublishXRef.additive, '') AS additive, PublishXRef.Sequence, IF(Publication.PubMed_ID IS NULL, '', CONVERT(Publication.PubMed_Id, INT)) AS pmid, Publication.Id FROM PublishXRef LEFT JOIN InbredSet ON InbredSet.InbredSetId = PublishXRef.InbredSetId LEFT JOIN Publication ON Publication.Id = PublishXRef.PublicationId LEFT JOIN Phenotype ON Phenotype.Id = PublishXRef.PhenotypeId WHERE PublishXRef.InbredSetId IN (SELECT PublishFreeze.InbredSetId FROM PublishFreeze) +SELECT CONCAT(IFNULL(InbredSet.InbredSetCode, PublishXRef.InbredSetId), '_', PublishXRef.Id) AS Phenotype, InbredSet.Name AS InbredSetName, PublishXRef.Id, CONCAT(IFNULL(InbredSet.InbredSetCode, PublishXRef.InbredSetId), '_', PublishXRef.Id) AS Phenotype, Phenotype.Post_publication_description, Phenotype.Post_publication_abbreviation, Phenotype.Lab_code, Phenotype.Submitter, Phenotype.Owner, IFNULL(PublishXRef.mean, '') AS mean, PublishXRef.Locus, IFNULL((PublishXRef.LRS/4.604), '') AS lrs, IFNULL(PublishXRef.additive, '') AS additive, PublishXRef.Sequence, IF(Publication.PubMed_ID IS NULL, '', CONVERT(Publication.PubMed_Id, INT)) AS pmid, Publication.Id AS PublicationId FROM PublishXRef LEFT JOIN InbredSet ON InbredSet.InbredSetId = PublishXRef.InbredSetId LEFT JOIN Publication ON Publication.Id = PublishXRef.PublicationId LEFT JOIN Phenotype ON Phenotype.Id = PublishXRef.PhenotypeId ``` The above query results to triples that have the form: ```text gn:traitPhenotype -> rdf:type -> gnc:Phenotype -gn:traitPhenotype -> xkos:classifiedUnder -> gn:setInbredset_inbredsetname +gn:traitPhenotype -> gnt:belongsToGroup -> gn:setInbredset_inbredsetname gn:traitPhenotype -> rdfs:label -> PublishXRef(Id) gn:traitPhenotype -> skos:altLabel -> Phenotype gn:traitPhenotype -> dct:description -> PhenotypePost_publication_description @@ -21,8 +21,8 @@ gn:traitPhenotype -> gnt:abbreviation -> Phenotype(Post_publication_abbreviation gn:traitPhenotype -> gnt:labCode -> Phenotype(Lab_code) gn:traitPhenotype -> gnt:submitter -> PhenotypeSubmitter gn:traitPhenotype -> gnt:mean -> "mean"^^xsd:double -gn:traitPhenotype -> gnt:locus -> PublishXRef(Locus) -gn:traitPhenotype -> gnt:LRS -> "lrs"^^xsd:double +gn:traitPhenotype -> gnt:locus -> gn:Publishxreflocus +gn:traitPhenotype -> gnt:lodScore -> "lrs"^^xsd:double gn:traitPhenotype -> gnt:additive -> "additive"^^xsd:double gn:traitPhenotype -> gnt:sequence -> "PublishXRef(Sequence)"^^xsd:integer gn:traitPhenotype -> dct:isReferencedBy -> pubmed:pmid @@ -35,18 +35,19 @@ PREFIX dct: PREFIX gn: PREFIX owl: PREFIX gnc: -PREFIX gnt: +PREFIX gnt: PREFIX sdmx-measure: PREFIX skos: PREFIX rdf: PREFIX rdfs: PREFIX xsd: PREFIX qb: +PREFIX xkos: PREFIX pubmed: SELECT * WHERE { ?s rdf:type gnc:Phenotype . - ?s xkos:classifiedUnder gn:setBxd . + ?s gnt:belongsToGroup gn:setBxd . ?s rdfs:label "10001" . ?s skos:altLabel "BXD_10001" . ?s ?p ?o . @@ -57,15 +58,15 @@ Expected Result: ```rdf gn:traitBxd_10001 rdf:type gnc:Phenotype . -gn:traitBxd_10001 xkos:classifiedUnder gn:setBxd . +gn:traitBxd_10001 gnt:belongsToGroup gn:setBxd . gn:traitBxd_10001 rdfs:label "10001" . gn:traitBxd_10001 skos:altLabel "BXD_10001" . gn:traitBxd_10001 dct:description "Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg]" . gn:traitBxd_10001 gnt:abbreviation "CBLWT2" . gn:traitBxd_10001 gnt:submitter "robwilliams" . gn:traitBxd_10001 gnt:mean "52.13529418496525"^^xsd:double . -gn:traitBxd_10001 gnt:locus "rs48756159" . -gn:traitBxd_10001 gnt:LRS "13.4974911471087"^^xsd:double . +gn:traitBxd_10001 gnt:locus gn:Rs48756159 . +gn:traitBxd_10001 gnt:lodScore "2.9316879120566246"^^xsd:double . gn:traitBxd_10001 gnt:additive "2.39444435069444"^^xsd:double . gn:traitBxd_10001 gnt:sequence "1"^^xsd:integer . gn:traitBxd_10001 dct:isReferencedBy pubmed:11438585 . diff --git a/rdf-documentation/probeset-metadata.md b/rdf-documentation/probeset-metadata.md index cde4e43..ce51854 100644 --- a/rdf-documentation/probeset-metadata.md +++ b/rdf-documentation/probeset-metadata.md @@ -6,7 +6,7 @@ The following SQL query was executed: ```sql -SELECT IF(NULLIF(TRIM(ProbeSet.Name), '') IS NULL, '', TRIM(ProbeSet.Name)) AS ProbeSetIdName, ProbeSet.Id, ProbeSet.Name, ProbeSet.alias, IFNULL(GeneChip.Name, '') AS GeneChipName, NULLIF(TRIM(ProbeSet.TargetId), '') AS TargetId, ProbeSet.Symbol, ProbeSet.description, NULLIF(TRIM(ProbeSet.Probe_set_target_region), '') AS Probe_set_target_region, ProbeSet.Chr, IFNULL(ProbeSet.Mb, '') AS Mb, IFNULL(ProbeSet.Mb_mm8, '') AS Mb_mm8, IFNULL(ProbeSet.Mb_2016, '') AS Mb_2016, IFNULL(ProbeSet.Probe_set_specificity, '') AS Probe_set_specificity, IFNULL(ProbeSet.Probe_set_BLAT_score, '') AS Probe_set_BLAT_score, IFNULL(ProbeSet.Probe_set_Blat_Mb_start, '') AS Probe_set_Blat_Mb_start, IFNULL(ProbeSet.Probe_set_Blat_Mb_start_2016, '') AS Probe_set_Blat_Mb_start_2016, IFNULL(ProbeSet.Probe_set_Blat_Mb_end, '') AS Probe_set_Blat_Mb_end, IFNULL(ProbeSet.Probe_set_Blat_Mb_start_2016, '') AS Probe_set_Blat_Mb_start_2016, ProbeSet.BlatSeq, ProbeSet.TargetSeq, IFNULL(ProbeSet.HomoloGeneID, '') AS HomoloGeneID, IFNULL(ProbeSet.UniProtID, '') AS UniProtID, IFNULL(ProbeSet.PubChem_ID, '') AS PubChem_ID, IFNULL(ProbeSet.KEGG_ID, '') AS KEGG_ID, IFNULL(ProbeSet.OMIM, '') AS OMIM, IFNULL(ProbeSet.ChEBI_ID, '') AS ChEBI_ID FROM ProbeSet LEFT JOIN GeneChip ON GeneChip.Id = ProbeSet.ChipId +SELECT IF(NULLIF(TRIM(ProbeSet.Name), '') IS NULL, '', TRIM(ProbeSet.Name)) AS ProbeSetIdName, ProbeSet.Id, ProbeSet.Name, ProbeSet.alias, IFNULL(GeneChip.Name, '') AS GeneChipName, NULLIF(TRIM(ProbeSet.TargetId), '') AS TargetId, ProbeSet.Symbol, ProbeSet.description, NULLIF(TRIM(ProbeSet.Probe_set_target_region), '') AS Probe_set_target_region, ProbeSet.Chr, IFNULL(ProbeSet.Mb, '') AS Mb, ProbeSet.Mb, ProbeSet.Chr, ProbeSet.Strand_Probe, ProbeSet.GeneId, ProbeSet.OMIM, ProbeSet.HomoloGeneID, ProbeSet.UniProtID, ProbeSet.Symbol, ProbeSet.Symbol, ProbeSet.Symbol, ProbeSet.Symbol, ProbeSet.Symbol, Species.Name, ProbeSet.RefSeq_TranscriptId, GeneList_rn33.kgId, (GeneList.txStart * 1000000) AS TranscriptStartMm10, (GeneList_rn33.txStart * 1000000) AS TranscriptStartRn7, GeneList.Chromosome, GeneList_rn33.Chromosome, (GeneList.txEnd * 1000000) AS TranscriptEndMm10, (GeneList_rn33.txEnd * 1000000) AS TranscriptEndRn7, ProbeSet.Symbol, ProbeSet.GeneId, Species.FullName, ProbeSet.Symbol, ProbeSet.GeneId, Species.name, ProbeSet.GeneId, ProbeSet.GeneId, Species.Name, ProbeSet.Strand_Probe, IFNULL(ProbeSet.Probe_set_specificity, '') AS Probe_set_specificity, IFNULL(ProbeSet.Probe_set_BLAT_score, '') AS Probe_set_BLAT_score, IFNULL(ProbeSet.Probe_set_Blat_Mb_start, '') AS Probe_set_Blat_Mb_start, IFNULL(ProbeSet.Probe_set_Blat_Mb_end, '') AS Probe_set_Blat_Mb_end, ProbeSet.BlatSeq, ProbeSet.TargetSeq FROM ProbeSet LEFT JOIN GeneChip ON GeneChip.Id = ProbeSet.ChipId LEFT JOIN GeneList ON GeneList.GeneID = ProbeSet.GeneId LEFT JOIN GeneList_rn33 ON GeneList.geneSymbol = ProbeSet.Symbol LEFT JOIN Species ON GeneChip.SpeciesId = Species.Id ``` The above query results to triples that have the form: @@ -22,22 +22,38 @@ gn:probesetProbesetidname -> dct:description -> ProbeSetdescription gn:probesetProbesetidname -> gnt:targetsRegion -> Probe_set_target_region gn:probesetProbesetidname -> gnt:chr -> ProbeSet(Chr) gn:probesetProbesetidname -> gnt:mb -> "Mb"^^xsd:double -gn:probesetProbesetidname -> gnt:mbMm8 -> "Mb_mm8"^^xsd:double -gn:probesetProbesetidname -> gnt:mb2016 -> "Mb_2016"^^xsd:double +gn:probesetProbesetidname -> gnt:location -> Chr ProbeSet(Chr) @ ProbeSet(Mb) +gn:probesetProbesetidname -> dct:references -> . + a gnc:NCBIGeneLink +gn:probesetProbesetidname -> dct:references -> . + a gnc:omimLink +gn:probesetProbesetidname -> dct:references -> . + a gnc:homologeneLink +gn:probesetProbesetidname -> dct:references -> . + a gnc:uniprotLink +gn:probesetProbesetidname -> dct:references -> . + a gnc:stringLink +gn:probesetProbesetidname -> dct:references -> . + a gnc:gtexLink +gn:probesetProbesetidname -> dct:references -> . + a gnc:ebiGwasLink +gn:probesetProbesetidname -> dct:references -> . + a gnc:proteinAtlasLink +gn:probesetProbesetidname -> dct:references -> +gn:probesetProbesetidname -> dct:references -> . + a gnc:PantherLink +gn:probesetProbesetidname -> dct:references -> +gn:probesetProbesetidname -> dct:references -> +gn:probesetProbesetidname -> dct:references -> . + a gnc:gemmaLink +gn:probesetProbesetidname -> dct:references -> +gn:probesetProbesetidname -> gnt:strandProbe -> ProbeSet(Strand_Probe) gn:probesetProbesetidname -> gnt:hasSpecificity -> Probe_set_specificity gn:probesetProbesetidname -> gnt:hasBlatScore -> Probe_set_BLAT_score gn:probesetProbesetidname -> gnt:hasBlatMbStart -> "Probe_set_Blat_Mb_start"^^xsd:double -gn:probesetProbesetidname -> gnt:hasBlatMbStart2016 -> "Probe_set_Blat_Mb_start_2016"^^xsd:double gn:probesetProbesetidname -> gnt:hasBlatMbEnd -> "Probe_set_Blat_Mb_end"^^xsd:double -gn:probesetProbesetidname -> gnt:hasBlatMbEnd2016 -> "Probe_set_Blat_Mb_start_2016"^^xsd:double gn:probesetProbesetidname -> gnt:hasBlatSeq -> ProbeSetBlatSeq gn:probesetProbesetidname -> gnt:hasTargetSeq -> ProbeSetTargetSeq -gn:probesetProbesetidname -> gnt:hasHomologeneId -> homologene:HomoloGeneID -gn:probesetProbesetidname -> gnt:hasUniprotId -> uniprot:UniProtID -gn:probesetProbesetidname -> gnt:hasPubChemId -> pubchem:PubChem_ID -gn:probesetProbesetidname -> gnt:hasKeggId -> kegg:KEGG_ID -gn:probesetProbesetidname -> gnt:hasOmimId -> -gn:probesetProbesetidname -> gnt:hasChebiId -> chebi:ChEBI_ID ``` Here's an example query: @@ -47,15 +63,9 @@ PREFIX probeset: PREFIX gnc: PREFIX gnt: PREFIX rdf: -PREFIX kegg: -PREFIX pubchem: -PREFIX omim: PREFIX rdfs: -PREFIX uniprot: -PREFIX chebi: PREFIX dct: PREFIX owl: -PREFIX homologene: PREFIX xsd: PREFIX qb: PREFIX sdmx-measure: @@ -63,8 +73,8 @@ PREFIX skos: SELECT * WHERE { ?s rdf:type gnc:Probeset . - ?s rdfs:label "100001_at" . - ?s skos:altLabel "T3g; Ctg3; Ctg-3" . + ?s rdfs:label "100322_at" . + ?s skos:altLabel "IGHG2A; AU044919; MGC102604; MGC102659; Ighg" . ?s gnt:hasChip gn:platformMg_u74av2 . ?s ?p ?o . } @@ -73,25 +83,39 @@ SELECT * WHERE { Expected Result: ```rdf -gn:probeset100001_at rdf:type gnc:Probeset . -gn:probeset100001_at rdfs:label "100001_at" . -gn:probeset100001_at skos:altLabel "T3g; Ctg3; Ctg-3" . -gn:probeset100001_at gnt:hasChip gn:platformMg_u74av2 . -gn:probeset100001_at gnt:symbol "Cd3g" . -gn:probeset100001_at dct:description "CD3d antigen, gamma polypeptide" . -gn:probeset100001_at gnt:chr "9" . -gn:probeset100001_at gnt:mb "44.970689"^^xsd:double . -gn:probeset100001_at gnt:mbMm8 "44.721684"^^xsd:double . -gn:probeset100001_at gnt:mb2016 "44.778772"^^xsd:double . -gn:probeset100001_at gnt:hasSpecificity "9.3" . -gn:probeset100001_at gnt:hasBlatScore "186" . -gn:probeset100001_at gnt:hasBlatMbStart "44.970689"^^xsd:double . -gn:probeset100001_at gnt:hasBlatMbStart2016 "44.778772"^^xsd:double . -gn:probeset100001_at gnt:hasBlatMbEnd "44.971291"^^xsd:double . -gn:probeset100001_at gnt:hasBlatMbEnd2016 "44.778772"^^xsd:double . -gn:probeset100001_at gnt:hasBlatSeq "CTCTGTTGCAAAATGAACAGCTGTACAGCCCCTCAAGGACCGGGAATATGACCAGTACAGCCATCTCCAAGGAAACCAACTGAGGAAGAAGTGAACTCAGCAGGACTCAGGGTGTCCCCACAATGCATTTTGGAGAGAGCCCAGACTGCAAGCAGAGAGGAAGAACTGAGGAAAACAAGCACAGCGTGGTGTT" . -gn:probeset100001_at gnt:hasTargetSeq "ctctgttgcaaaatgaacagctgtaccagcccctcaaggaccgggaatatgaccagtacagccatctccaaggaaaccaactgaggaagaagtgaactcagcaggactcagggtgtccccccttntatccagcacccagaatcaaaacaatgcattttggagagagcccagtagagagattttcaaccctacaggtagactgcaagcagagaggaagaactgtcaaagaaattttggtcttttttttttttttnncaaaataaaataaaagcttggaggagccagtggtatgantnnnnnntgnancanttgtcaaccttgtttggggttnncagcaccccacccccagaccccccaaaaaaattcagtgaaggaaaacaagcacagcgtggtgtt" . -gn:probeset100001_at gnt:hasHomologeneId homologene:55 . -gn:probeset100001_at gnt:hasOmimId omim:186740 . +gn:probeset100322_at rdf:type gnc:Probeset . +gn:probeset100322_at rdfs:label "100322_at" . +gn:probeset100322_at skos:altLabel "IGHG2A; AU044919; MGC102604; MGC102659; Ighg" . +gn:probeset100322_at gnt:hasChip gn:platformMg_u74av2 . +gn:probeset100322_at gnt:symbol "Ighg" . +gn:probeset100322_at dct:description "immunoglobulin heavy chain gamma polypeptide" . +gn:probeset100322_at gnt:chr "12" . +gn:probeset100322_at gnt:mb "114.322406"^^xsd:double . +gn:probeset100322_at gnt:location "Chr 12 @ 114.322406 on the minus strand" . +gn:probeset100322_at dct:references . + a gnc:NCBIGeneLink . +gn:probeset100322_at dct:references . + a gnc:stringLink . +gn:probeset100322_at dct:references . + a gnc:gtexLink . +gn:probeset100322_at dct:references . + a gnc:ebiGwasLink . +gn:probeset100322_at dct:references . + a gnc:proteinAtlasLink . +gn:probeset100322_at dct:references . + a gnc:PantherLink . +gn:probeset100322_at dct:references . + a gnc:genemaniaLink . +gn:probeset100322_at dct:references . + Ighg . +gn:probeset100322_at dct:references . + a gnc:gemmaLink . +gn:probeset100322_at gnt:strandProbe "-" . +gn:probeset100322_at gnt:hasSpecificity "3.1" . +gn:probeset100322_at gnt:hasBlatScore "62" . +gn:probeset100322_at gnt:hasBlatMbStart "114.322406"^^xsd:double . +gn:probeset100322_at gnt:hasBlatMbEnd "114.322571"^^xsd:double . +gn:probeset100322_at gnt:hasBlatSeq "TGGTCACAGCTTTCCGCTCACGTTCACTGAAACGGGCTGATGCTGCACCAACTGTATCTTCCCACCATCCAGTAAGCTTGGGCCCGGTGGTTACTGGAACTGGATCCGGAAATTCCCAGGGAATATTACCTGCAGTTGAATTCTGTGACTACT" . +gn:probeset100322_at gnt:hasTargetSeq "tggtcacagctttccgctcacgttcggtgctgggaccaagctggaactgaaacgggctgatgctgcaccaactgtatccatcttcccaccatccagtaagcttgggcccggtgggggcnnnnngnnnngnnnnnnntnnnnnnngnnngncnnnnngnnnnncnnntcngaggtgcagcttcaggagtcaggacctngcctngnnaaaccttctcagactctgtccctcacctgttctgtcactggcnactccatcaccagtgnttactggaactggatccggaaattcccagggaataaacttgantacatgggntacataanctacagtggtnncacttactacaatccatctctcaaaagtcgaatctccatnactnnagacacatccaagaaccantattacctgcagttgaattctgtgactact" . ``` diff --git a/rdf-documentation/publication-metadata.md b/rdf-documentation/publication-metadata.md index c4262dc..be809a2 100644 --- a/rdf-documentation/publication-metadata.md +++ b/rdf-documentation/publication-metadata.md @@ -26,7 +26,7 @@ pubmed:pmid -> dct:creator -> PublicationAuthors Here's an example query: ```sparql -PREFIX gnt: +PREFIX gnt: PREFIX fabio: PREFIX dct: PREFIX prism: diff --git a/rdf-documentation/strains.md b/rdf-documentation/strains.md index 4ecb12f..87a8ce9 100644 --- a/rdf-documentation/strains.md +++ b/rdf-documentation/strains.md @@ -13,7 +13,7 @@ The above query results to triples that have the form: ```text gn:Strain_name_ -> rdf:type -> gnc:strain -gn:Strain_name_ -> xkos:classifiedUnder -> gn:Species_fullname +gn:Strain_name_ -> gnt:belongsToSpecies -> gn:Species_fullname gn:Strain_name_ -> rdfs:label -> StrainName gn:Strain_name_ -> skos:altLabel -> Name2 gn:Strain_name_ -> gnt:alias -> Alias @@ -34,7 +34,7 @@ PREFIX taxon: SELECT * WHERE { ?s rdf:type gnc:strain . - ?s xkos:classifiedUnder gn:Mus_musculus . + ?s gnt:belongsToSpecies gn:Mus_musculus . ?s rdfs:label "B6D2F1" . ?s ?p ?o . } @@ -44,7 +44,7 @@ Expected Result: ```rdf gn:B6d2f1 rdf:type gnc:strain . -gn:B6d2f1 xkos:classifiedUnder gn:Mus_musculus . +gn:B6d2f1 gnt:belongsToSpecies gn:Mus_musculus . gn:B6d2f1 rdfs:label "B6D2F1" . ``` @@ -100,14 +100,14 @@ gn:mappingMethodQtlreaper rdfs:label "qtlreaper" . The following SQL query was executed: ```sql -SELECT AvgMethod.Name, AvgMethod.Normalization FROM AvgMethod +SELECT AvgMethod.Name AS AvgMethodName, AvgMethod.Normalization FROM AvgMethod ``` The above query results to triples that have the form: ```text -gn:avgMethodAvgmethod_name -> rdf:type -> gnc:avgMethod -gn:avgMethodAvgmethod_name -> rdfs:label -> AvgMethod(Normalization) +gn:avgMethodAvgmethod_avgmethodname -> rdf:type -> gnc:avgMethod +gn:avgMethodAvgmethod_avgmethodname -> rdfs:label -> AvgMethod(Normalization) ``` Here's an example query: diff --git a/rdf-documentation/tissue-metadata.md b/rdf-documentation/tissue-metadata.md index 37145c4..61ef899 100644 --- a/rdf-documentation/tissue-metadata.md +++ b/rdf-documentation/tissue-metadata.md @@ -19,7 +19,7 @@ Here's an example query: ```sparql PREFIX gn: -PREFIX gnt: +PREFIX gnt: PREFIX skos: PREFIX gnc: PREFIX rdf: -- cgit v1.2.3