From 6c512931b5b673e76bd57fe3f166e526b383088d Mon Sep 17 00:00:00 2001
From: Munyoki Kilyungi
Date: Tue, 18 Jul 2023 17:47:02 +0300
Subject: Update auto-generated docs
---
rdf-documentation/dump-probeset.md | 62 ++++++++++++++
rdf-documentation/dump-species-metadata.md | 130 +++++++++++++++--------------
rdf-documentation/dump-tissue.md | 20 +++--
3 files changed, 141 insertions(+), 71 deletions(-)
create mode 100644 rdf-documentation/dump-probeset.md
(limited to 'rdf-documentation')
diff --git a/rdf-documentation/dump-probeset.md b/rdf-documentation/dump-probeset.md
new file mode 100644
index 0000000..5b4de63
--- /dev/null
+++ b/rdf-documentation/dump-probeset.md
@@ -0,0 +1,62 @@
+# ProbeSet Metadata
+## 'dump-probeset'
+
+## Schema Triples:
+
+```text
+gn-term:name -> rdfs:range -> rdfs:Literal
+gn-term:probeset -> rdfs:range -> rdfs:Literal
+```
+## Generated Triples:
+
+The following SQL query was executed:
+
+```sql
+SELECT IFNULL(NULLIF(TRIM(ProbeSet.Name), ''), ProbeSet.Id) AS name, GeneChip.Name, ProbeSet.Name, ProbeSet.Symbol, ProbeSet.description, ProbeSet.Chr, IFNULL(ProbeSet.Mb, '') AS Mb, ProbeSet.BlatSeq, ProbeSet.TargetSeq, ProbeSet.UniProtID FROM ProbeSet LEFT JOIN GeneChip ON GeneChip.Id = ProbeSet.ChipId
+```
+
+The above query results to triples that have the form:
+
+```text
+probeset:name -> rdf:type -> gn-id:probeset
+probeset:name -> gn-term:chipOf -> gn-id:platform_genechip_name
+probeset:name -> gn-term:name -> ProbeSet(Name)
+probeset:name -> gn-term:symbol -> ProbeSet(Symbol)
+probeset:name -> gn-term:description -> ProbeSetdescription
+probeset:name -> gn-term:chr -> ProbeSet(Chr)
+probeset:name -> gn-term:mb -> "Mb"^^xsd:double
+probeset:name -> gn-term:blatSeq -> ProbeSetBlatSeq
+probeset:name -> gn-term:targetSeq -> ProbeSetTargetSeq
+probeset:name -> gn-term:uniProtReference -> uniprot:ProbeSet(UniProtID)
+```
+Here's an example query:
+
+```sparql
+@prefix probeset: .
+@prefix rdf: .
+@prefix rdfs: .
+
+SELECT ?s ?p ?o WHERE {
+ ?s rdf:type gn-id:probeset .
+ ?s gn-term:chipOf gn-id:platform_mg_u74av2 .
+ ?s gn-term:name "MG_U74AV2" .
+ ?s gn-term:symbol "Cd3g" .
+ ?s ?p ?o .
+}
+```
+
+Expected Result:
+
+```rdf
+probeset:100001_at rdf:type gn-id:probeset .
+probeset:100001_at gn-term:chipOf gn-id:platform_mg_u74av2 .
+probeset:100001_at gn-term:name "MG_U74AV2" .
+probeset:100001_at gn-term:symbol "Cd3g" .
+probeset:100001_at gn-term:description "CD3d antigen, gamma polypeptide" .
+probeset:100001_at gn-term:chr "9" .
+probeset:100001_at gn-term:mb "44.970689"^^xsd:double .
+probeset:100001_at gn-term:blatSeq "CTCTGTTGCAAAATGAACAGCTGTACAGCCCCTCAAGGACCGGGAATATGACCAGTACAGCCATCTCCAAGGAAACCAACTGAGGAAGAAGTGAACTCAGCAGGACTCAGGGTGTCCCCACAATGCATTTTGGAGAGAGCCCAGACTGCAAGCAGAGAGGAAGAACTGAGGAAAACAAGCACAGCGTGGTGTT" .
+probeset:100001_at gn-term:targetSeq "ctctgttgcaaaatgaacagctgtaccagcccctcaaggaccgggaatatgaccagtacagccatctccaaggaaaccaactgaggaagaagtgaactcagcaggactcagggtgtccccccttntatccagcacccagaatcaaaacaatgcattttggagagagcccagtagagagattttcaaccctacaggtagactgcaagcagagaggaagaactgtcaaagaaattttggtcttttttttttttttnncaaaataaaataaaagcttggaggagccagtggtatgantnnnnnntgnancanttgtcaaccttgtttggggttnncagcaccccacccccagaccccccaaaaaaattcagtgaaggaaaacaagcacagcgtggtgtt" .
+```
+
diff --git a/rdf-documentation/dump-species-metadata.md b/rdf-documentation/dump-species-metadata.md
index 7c0f8be..ca09458 100644
--- a/rdf-documentation/dump-species-metadata.md
+++ b/rdf-documentation/dump-species-metadata.md
@@ -4,10 +4,10 @@
## Schema Triples:
```text
-gn:name -> rdfs:range -> rdfs:Literal
-gn:displayName -> rdfs:range -> rdfs:Literal
-gn:binomialName -> rdfs:range -> rdfs:Literal
-gn:family -> rdfs:range -> rdfs:Literal
+gn-term:name -> rdfs:range -> rdfs:Literal
+gn-term:displayName -> rdfs:range -> rdfs:Literal
+gn-term:binomialName -> rdfs:range -> rdfs:Literal
+gn-term:family -> rdfs:range -> rdfs:Literal
```
## Generated Triples:
@@ -20,25 +20,26 @@ SELECT Species.FullName, Species.SpeciesName, Species.MenuName, Species.FullName
The above query results to triples that have the form:
```text
-gn:species_species_fullname_ -> rdf:type -> gn:species
-gn:species_species_fullname_ -> gn:name -> Species(SpeciesName)
-gn:species_species_fullname_ -> gn:displayName -> Species(MenuName)
-gn:species_species_fullname_ -> gn:binomialName -> Species(FullName)
-gn:species_species_fullname_ -> gn:family -> Species(Family)
-gn:species_species_fullname_ -> gn:organism -> #{taxon:Species\x28;TaxonomyId\x29;}#
+gn-id:Species_fullname -> rdf:type -> gn-id:species
+gn-id:Species_fullname -> gn-term:name -> Species(SpeciesName)
+gn-id:Species_fullname -> gn-term:displayName -> Species(MenuName)
+gn-id:Species_fullname -> gn-term:binomialName -> Species(FullName)
+gn-id:Species_fullname -> gn-term:family -> Species(Family)
+gn-id:Species_fullname -> gn-term:organism -> taxon:Species(TaxonomyId)
```
Here's an example query:
```sparql
-PREFIX rdf:
-PREFIX rdfs:
-PREFIX gn:
-PREFIX taxon:
+@prefix gn-id: .
+@prefix gn-term: .
+@prefix rdf: .
+@prefix rdfs: .
+@prefix taxon: .
SELECT ?s ?p ?o WHERE {
- ?s rdf:type gn:species .
- ?s gn:name "Mouse" .
- ?s gn:displayName "Mouse (Mus musculus, mm10)" .
+ ?s rdf:type gn-id:species .
+ ?s gn-term:name "Mouse" .
+ ?s gn-term:displayName "Mouse (Mus musculus, mm10)" .
?s ?p ?o .
}
```
@@ -46,12 +47,12 @@ SELECT ?s ?p ?o WHERE {
Expected Result:
```rdf
-gn:species_mus_musculus rdf:type gn:species .
-gn:species_mus_musculus gn:name "Mouse" .
-gn:species_mus_musculus gn:displayName "Mouse (Mus musculus, mm10)" .
-gn:species_mus_musculus gn:binomialName "Mus musculus" .
-gn:species_mus_musculus gn:family "Vertebrates" .
-gn:species_mus_musculus gn:organism taxon:10090 .
+gn-id:Mus_musculus rdf:type gn-id:species .
+gn-id:Mus_musculus gn-term:name "Mouse" .
+gn-id:Mus_musculus gn-term:displayName "Mouse (Mus musculus, mm10)" .
+gn-id:Mus_musculus gn-term:binomialName "Mus musculus" .
+gn-id:Mus_musculus gn-term:family "Vertebrates" .
+gn-id:Mus_musculus gn-term:organism taxon:10090 .
```
@@ -60,11 +61,11 @@ gn:species_mus_musculus gn:organism taxon:10090 .
## Schema Triples:
```text
-gn:strainOfSpecies -> rdfs:domain -> gn:strain
-gn:strainOfSpecies -> rdfs:range -> gn:species
-gn:name -> rdfs:range -> rdfs:Literal
-gn:alias -> rdfs:range -> rdfs:Literal
-gn:symbol -> rdfs:range -> rdfs:Literal
+gn-term:strainOfSpecies -> rdfs:domain -> gn-term:strain
+gn-term:strainOfSpecies -> rdfs:range -> gn-term:species
+gn-term:name -> rdfs:range -> rdfs:Literal
+gn-term:alias -> rdfs:range -> rdfs:Literal
+gn-term:symbol -> rdfs:range -> rdfs:Literal
```
## Generated Triples:
@@ -77,25 +78,26 @@ SELECT CAST(CONVERT(BINARY CONVERT(Strain.Name USING latin1) USING utf8) AS VARC
The above query results to triples that have the form:
```text
-gn:strain_strainname -> rdf:type -> gn:strain
-gn:strain_strainname -> gn:strainOfSpecies -> gn:species_species_fullname_
-gn:strain_strainname -> gn:name -> StrainName
-gn:strain_strainname -> gn:name -> StrainName2
-gn:strain_strainname -> gn:alias -> StrainAlias
-gn:strain_strainname -> gn:symbol -> Strain(Symbol)
+gn-id:Strainname -> rdf:type -> gn-id:strain
+gn-id:Strainname -> gn-term:strainOfSpecies -> gn-id:Species_fullname
+gn-id:Strainname -> gn-term:name -> StrainName
+gn-id:Strainname -> gn-term:name2 -> StrainName2
+gn-id:Strainname -> gn-term:alias -> StrainAlias
+gn-id:Strainname -> gn-term:symbol -> Strain(Symbol)
```
Here's an example query:
```sparql
-PREFIX rdf:
-PREFIX rdfs:
-PREFIX gn:
-PREFIX taxon:
+@prefix gn-id: .
+@prefix gn-term: .
+@prefix rdf: .
+@prefix rdfs: .
+@prefix taxon: .
SELECT ?s ?p ?o WHERE {
- ?s rdf:type gn:strain .
- ?s gn:strainOfSpecies gn:species_mus_musculus .
- ?s gn:name "B6D2F1" .
+ ?s rdf:type gn-id:strain .
+ ?s gn-term:strainOfSpecies gn-id:Mus_musculus .
+ ?s gn-term:name "B6D2F1" .
?s ?p ?o .
}
```
@@ -103,10 +105,10 @@ SELECT ?s ?p ?o WHERE {
Expected Result:
```rdf
-gn:strain_b6d2f1 rdf:type gn:strain .
-gn:strain_b6d2f1 gn:strainOfSpecies gn:species_mus_musculus .
-gn:strain_b6d2f1 gn:name "B6D2F1" .
-gn:strain_b6d2f1 gn:name "B6D2F1" .
+gn-id:B6d2f1 rdf:type gn-id:strain .
+gn-id:B6d2f1 gn-term:strainOfSpecies gn-id:Mus_musculus .
+gn-id:B6d2f1 gn-term:name "B6D2F1" .
+gn-id:B6d2f1 gn-term:name2 "B6D2F1" .
```
@@ -127,17 +129,19 @@ SELECT MappingMethod.Name FROM MappingMethod
The above query results to triples that have the form:
```text
-gn:mappingMethod_mappingmethod_name_ -> rdf:type -> gn:mappingMethod
+gn-id:mappingMethod_mappingmethod_name -> rdf:type -> gn-id:mappingMethod
```
Here's an example query:
```sparql
-PREFIX rdf:
-PREFIX rdfs:
-PREFIX gn:
-PREFIX taxon:
+@prefix gn-id: .
+@prefix gn-term: .
+@prefix rdf: .
+@prefix rdfs: .
+@prefix taxon: .
SELECT ?s ?p ?o WHERE {
+ ?s rdf:type gn-id:mappingMethod .
?s ?p ?o .
}
```
@@ -145,7 +149,7 @@ SELECT ?s ?p ?o WHERE {
Expected Result:
```rdf
-gn:mappingMethod_qtlreaper rdf:type gn:mappingMethod .
+gn-id:mappingMethod_qtlreaper rdf:type gn-id:mappingMethod .
```
@@ -154,32 +158,34 @@ gn:mappingMethod_qtlreaper rdf:type gn:mappingMethod .
## Schema Triples:
```text
-gn:name -> rdfs:range -> rdfs:Literal
+gn-term:normalization -> rdfs:range -> rdfs:Literal
```
## Generated Triples:
The following SQL query was executed:
```sql
-SELECT AvgMethod.Name, AvgMethod.Name FROM AvgMethod
+SELECT AvgMethod.Name, AvgMethod.Normalization FROM AvgMethod
```
The above query results to triples that have the form:
```text
-gn:avgmethod_avgmethod_name_ -> rdf:type -> gn:avgMethod
-gn:avgmethod_avgmethod_name_ -> gn:name -> AvgMethod(Name)
+gn-id:avgmethod_avgmethod_name -> rdf:type -> gn-id:avgMethod
+gn-id:avgmethod_avgmethod_name -> gn-term:normalization -> AvgMethod(Normalization)
```
Here's an example query:
```sparql
-PREFIX rdf:
-PREFIX rdfs:
-PREFIX gn:
-PREFIX taxon:
+@prefix gn-id: .
+@prefix gn-term: .
+@prefix rdf: .
+@prefix rdfs: .
+@prefix taxon: .
SELECT ?s ?p ?o WHERE {
- ?s rdf:type gn:avgMethod .
+ ?s rdf:type gn-id:avgMethod .
+ ?s gn-term:normalization "MAS5" .
?s ?p ?o .
}
```
@@ -187,7 +193,7 @@ SELECT ?s ?p ?o WHERE {
Expected Result:
```rdf
-gn:avgmethod_mas5 rdf:type gn:avgMethod .
-gn:avgmethod_mas5 gn:name "MAS5" .
+gn-id:avgmethod_mas5 rdf:type gn-id:avgMethod .
+gn-id:avgmethod_mas5 gn-term:normalization "MAS5" .
```
diff --git a/rdf-documentation/dump-tissue.md b/rdf-documentation/dump-tissue.md
index bfa2a76..dd64f83 100644
--- a/rdf-documentation/dump-tissue.md
+++ b/rdf-documentation/dump-tissue.md
@@ -4,7 +4,7 @@
## Schema Triples:
```text
-gn:name -> rdfs:range -> rdfs:Literal
+gn-term:name -> rdfs:range -> rdfs:Literal
```
## Generated Triples:
@@ -17,18 +17,20 @@ SELECT Tissue.Short_Name, Tissue.Name FROM Tissue
The above query results to triples that have the form:
```text
-gn:tissue_tissue_short_name_ -> rdf:type -> gn:tissue
-gn:tissue_tissue_short_name_ -> gn:name -> Tissue(Name)
+gn-id:tissue_tissue_short_name -> rdf:type -> gn-id:tissue
+gn-id:tissue_tissue_short_name -> gn-term:name -> Tissue(Name)
```
Here's an example query:
```sparql
-PREFIX rdf:
-PREFIX rdfs:
-PREFIX gn:
+@prefix gn-id: .
+@prefix gn-term: .
+@prefix rdf: .
+@prefix rdfs: .
SELECT ?s ?p ?o WHERE {
- ?s rdf:type gn:tissue .
+ ?s rdf:type gn-id:tissue .
+ ?s gn-term:name "Brain mRNA" .
?s ?p ?o .
}
```
@@ -36,7 +38,7 @@ SELECT ?s ?p ?o WHERE {
Expected Result:
```rdf
-gn:tissue_brn rdf:type gn:tissue .
-gn:tissue_brn gn:name "Brain mRNA" .
+gn-id:tissue_brn rdf:type gn-id:tissue .
+gn-id:tissue_brn gn-term:name "Brain mRNA" .
```
--
cgit 1.4.1