From 3298dde44681de68c48693cf117ffe1a8e3e1587 Mon Sep 17 00:00:00 2001 From: Munyoki Kilyungi Date: Thu, 28 Sep 2023 12:08:27 +0300 Subject: Update auto-generated docs. Signed-off-by: Munyoki Kilyungi --- rdf-documentation/classification.md | 194 +++++++++++++++++++++++++++++ rdf-documentation/dataset-metadata.md | 196 ++++++++++++++++-------------- rdf-documentation/genbank-metadata.md | 50 ++++++++ rdf-documentation/generif-metadata.md | 72 +++-------- rdf-documentation/genotype-metadata.md | 6 +- rdf-documentation/phenotype-metadata.md | 64 +++++----- rdf-documentation/probeset-metadata.md | 98 +++++++-------- rdf-documentation/publication-metadata.md | 2 +- rdf-documentation/strains.md | 138 +++++++++++++++++++++ rdf-documentation/tissue-metadata.md | 8 +- 10 files changed, 595 insertions(+), 233 deletions(-) create mode 100644 rdf-documentation/classification.md create mode 100644 rdf-documentation/genbank-metadata.md create mode 100644 rdf-documentation/strains.md (limited to 'rdf-documentation') diff --git a/rdf-documentation/classification.md b/rdf-documentation/classification.md new file mode 100644 index 0000000..4c1ae45 --- /dev/null +++ b/rdf-documentation/classification.md @@ -0,0 +1,194 @@ +# Species Metadata +## 'classification-scheme-species' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT Species.Fullname FROM Species +``` + +The above query results to triples that have the form: + +```text +gnc:Species -> skos:member -> gn:Species_fullname +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX gnc: +PREFIX owl: +PREFIX gnt: +PREFIX skos: +PREFIX xkos: +PREFIX rdf: +PREFIX rdfs: +PREFIX taxon: + +SELECT * WHERE { + ?s skos:member gn:Mus_musculus . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gnc:Species skos:member gn:Mus_musculus . +``` + + +## 'classification-scheme-set' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT InbredSet.Name AS InbredSetName FROM InbredSet +``` + +The above query results to triples that have the form: + +```text +gnc:Set -> skos:member -> gn:setInbredset_inbredsetname +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX gnc: +PREFIX owl: +PREFIX gnt: +PREFIX skos: +PREFIX xkos: +PREFIX rdf: +PREFIX rdfs: +PREFIX taxon: + +SELECT * WHERE { + ?s skos:member gn:setBxd . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gnc:Set skos:member gn:setBxd . +``` + + +## 'species' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT Species.Fullname, Species.Fullname, Species.MenuName, Species.SpeciesName, Species.Name, Species.Family, Species.TaxonomyId FROM Species +``` + +The above query results to triples that have the form: + +```text +gn:Species_fullname -> skos:inScheme -> gnc:ResourceClassificationScheme +gn:Species_fullname -> rdfs:label -> Species(Fullname) +gn:Species_fullname -> skos:prefLabel -> Species(MenuName) +gn:Species_fullname -> skos:altLabel -> Species(SpeciesName) +gn:Species_fullname -> gnt:shortName -> Species(Name) +gn:Species_fullname -> gnt:family -> Species(Family) +gn:Species_fullname -> skos:notation -> taxon:Species(TaxonomyId) +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX gnc: +PREFIX owl: +PREFIX gnt: +PREFIX skos: +PREFIX xkos: +PREFIX rdf: +PREFIX rdfs: +PREFIX taxon: + +SELECT * WHERE { + ?s skos:inScheme gnc:ResourceClassificationScheme . + ?s rdfs:label "Mus musculus" . + ?s skos:prefLabel "Mouse (Mus musculus, mm10)" . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gn:Mus_musculus skos:inScheme gnc:ResourceClassificationScheme . +gn:Mus_musculus rdfs:label "Mus musculus" . +gn:Mus_musculus skos:prefLabel "Mouse (Mus musculus, mm10)" . +gn:Mus_musculus skos:altLabel "Mouse" . +gn:Mus_musculus gnt:shortName "mouse" . +gn:Mus_musculus gnt:family "Vertebrates" . +gn:Mus_musculus skos:notation taxon:10090 . +``` + + +## 'inbred-set' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT InbredSet.Name AS InbredSetName, InbredSet.FullName, InbredSet.Name AS InbredSetName, InbredSet.GeneticType, InbredSet.Family, MappingMethod.Name, InbredSet.InbredSetCode, Species.Fullname FROM InbredSet LEFT JOIN Species ON InbredSet.SpeciesId=Species.Id LEFT JOIN MappingMethod ON InbredSet.MappingMethodId=MappingMethod.Id +``` + +The above query results to triples that have the form: + +```text +gn:setInbredset_inbredsetname -> skos:inScheme -> gnc:ResourceClassificationScheme +gn:setInbredset_inbredsetname -> rdfs:label -> InbredSet(FullName) +gn:setInbredset_inbredsetname -> skos:prefLabel -> InbredSet(InbredSetName) +gn:setInbredset_inbredsetname -> gnt:geneticType -> InbredSet(GeneticType) +gn:setInbredset_inbredsetname -> gnt:family -> InbredSet(Family) +gn:setInbredset_inbredsetname -> gnt:mappingMethod -> MappingMethod(Name) +gn:setInbredset_inbredsetname -> gnt:code -> InbredSet(InbredSetCode) +gn:setInbredset_inbredsetname -> xkos:generalizes -> gn:Species_fullname +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX gnc: +PREFIX owl: +PREFIX gnt: +PREFIX skos: +PREFIX xkos: +PREFIX rdf: +PREFIX rdfs: +PREFIX taxon: + +SELECT * WHERE { + ?s skos:inScheme gnc:ResourceClassificationScheme . + ?s rdfs:label "BXD Family" . + ?s skos:prefLabel "BXD" . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gn:setBxd skos:inScheme gnc:ResourceClassificationScheme . +gn:setBxd rdfs:label "BXD Family" . +gn:setBxd skos:prefLabel "BXD" . +gn:setBxd gnt:geneticType "riset" . +gn:setBxd gnt:family "Reference Populations (replicate average, SE, N)" . +gn:setBxd gnt:mappingMethod "qtlreaper" . +gn:setBxd gnt:code "BXD" . +gn:setBxd xkos:generalizes gn:Mus_musculus . +``` + diff --git a/rdf-documentation/dataset-metadata.md b/rdf-documentation/dataset-metadata.md index 20f3e29..59246b2 100644 --- a/rdf-documentation/dataset-metadata.md +++ b/rdf-documentation/dataset-metadata.md @@ -6,28 +6,28 @@ The following SQL query was executed: ```sql -SELECT InfoFiles.InfoPageName, IF(GenoFreeze.Id IS NOT NULL, 'gnc:genotypeDataset', IF(PublishFreeze.Id IS NOT NULL, 'gnc:phenotypeDataset', IF(ProbeSetFreeze.Name IS NOT NULL, 'gnc:probesetDataset', 'gnc:dataset'))) AS rdfType, InfoFiles.InfoPageName, IFNULL(GenoFreeze.FullName, IFNULL(PublishFreeze.FullName, '')) AS DatasetFullName, Datasets.DatasetName AS DatasetGroup, InfoFiles.InfoFileTitle, Datasets.PublicationTitle, IFNULL(GenoFreeze.CreateTime, IFNULL(PublishFreeze.CreateTime, IFNULL(ProbeSetFreeze.CreateTime, ''))) AS createTimeGenoFreeze, Investigators.FirstName, Investigators.LastName, Investigators.Email, Organizations.OrganizationName, InfoFiles.GN_AccesionId, DatasetStatus.DatasetStatusName, InbredSet.Name, Tissue.Short_Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS AvgMethodName, GeneChip.Name AS GeneChip, Datasets.Summary, IFNULL(Datasets.GeoSeries, '') AS GeoSeries, Datasets.AboutTissue, InfoFiles.Specifics, Datasets.AboutCases, Datasets.AboutPlatform, Datasets.AboutDataProcessing, Datasets.Notes, Datasets.ExperimentDesign, Datasets.Contributors, Datasets.Citation, InfoFiles.Data_Source_Acknowledge, Datasets.Acknowledgment FROM InfoFiles LEFT JOIN PublishFreeze ON InfoFiles.InfoPageName = PublishFreeze.Name LEFT JOIN GenoFreeze ON InfoFiles.InfoPageName = GenoFreeze.Name LEFT JOIN ProbeSetFreeze ON InfoFiles.InfoPageName = ProbeSetFreeze.Name LEFT JOIN InbredSet ON InfoFiles.InbredSetId = InbredSet.InbredSetId LEFT JOIN Species ON InfoFiles.SpeciesId = Species.SpeciesId LEFT JOIN Datasets USING (DatasetId) LEFT JOIN DatasetStatus USING (DatasetStatusId) LEFT JOIN Tissue USING (TissueId) LEFT JOIN Investigators USING (InvestigatorId) LEFT JOIN AvgMethod USING (AvgMethodId) LEFT JOIN Organizations USING (OrganizationId) LEFT JOIN GeneChip USING (GeneChipId) WHERE GN_AccesionId IS NOT NULL +SELECT InfoFiles.InfoPageName, IF(GenoFreeze.Id IS NOT NULL, 'gnc:Genotype', IF(PublishFreeze.Id IS NOT NULL, 'gnc:Phenotype', IF(ProbeSetFreeze.Name IS NOT NULL, 'gnc:Probeset', ''))) AS DatasetType, InfoFiles.InfoPageName, IFNULL(GenoFreeze.FullName, IFNULL(PublishFreeze.FullName, '')) AS DatasetFullName, Datasets.DatasetName AS DatasetGroup, Datasets.PublicationTitle, InfoFiles.InfoFileTitle, IFNULL(GenoFreeze.CreateTime, IFNULL(PublishFreeze.CreateTime, IFNULL(ProbeSetFreeze.CreateTime, ''))) AS createTimeGenoFreeze, Investigators.FirstName, Investigators.LastName, Investigators.Email, Organizations.OrganizationName, InfoFiles.GN_AccesionId, DatasetStatus.DatasetStatusName, InbredSet.Name AS InbredSetName, Tissue.Short_Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS AvgMethodName, GeneChip.Name AS GeneChip, Datasets.Summary, IFNULL(Datasets.GeoSeries, '') AS GeoSeries, Datasets.AboutTissue, InfoFiles.Specifics, Datasets.AboutCases, Datasets.AboutPlatform, Datasets.AboutDataProcessing, Datasets.Notes, Datasets.ExperimentDesign, Datasets.Contributors, Datasets.Citation, Datasets.Acknowledgment FROM InfoFiles LEFT JOIN PublishFreeze ON InfoFiles.InfoPageName = PublishFreeze.Name LEFT JOIN GenoFreeze ON InfoFiles.InfoPageName = GenoFreeze.Name LEFT JOIN ProbeSetFreeze ON InfoFiles.InfoPageName = ProbeSetFreeze.Name LEFT JOIN InbredSet ON InfoFiles.InbredSetId = InbredSet.InbredSetId LEFT JOIN Species ON InfoFiles.SpeciesId = Species.SpeciesId LEFT JOIN Datasets USING (DatasetId) LEFT JOIN DatasetStatus USING (DatasetStatusId) LEFT JOIN Tissue USING (TissueId) LEFT JOIN Investigators USING (InvestigatorId) LEFT JOIN AvgMethod USING (AvgMethodId) LEFT JOIN Organizations USING (OrganizationId) LEFT JOIN GeneChip USING (GeneChipId) WHERE GN_AccesionId IS NOT NULL ``` The above query results to triples that have the form: ```text -gn:Infofiles_infopagename_ -> rdf:type -> rdfType +gn:Infofiles_infopagename_ -> rdf:type -> dcat:Dataset +gn:Infofiles_infopagename_ -> xkos:classifiedUnder -> DatasetType gn:Infofiles_infopagename_ -> rdfs:label -> InfoFiles(InfoPageName) gn:Infofiles_infopagename_ -> skos:prefLabel -> DatasetFullName -gn:Infofiles_infopagename_ -> skos:prefLabel -> Datasets(DatasetGroup) -gn:Infofiles_infopagename_ -> gdmt:hasTitleInfo -> InfoFiles(InfoFileTitle) +gn:Infofiles_infopagename_ -> skos:altLabel -> Datasets(DatasetGroup) gn:Infofiles_infopagename_ -> dct:title -> Datasets(PublicationTitle) gn:Infofiles_infopagename_ -> dct:created -> createTimeGenoFreeze -gn:Infofiles_infopagename_ -> gdmt:hasCreatorInfo -> gn:investigator_investigators_firstname_investigators_lastname_investigators_email -gn:Infofiles_infopagename_ -> gdmt:hasCreatorAffiliation -> Organizations(OrganizationName) -gn:Infofiles_infopagename_ -> gdmt:hasDatasetIdentifierSubType -> GNInfoFiles(GN_AccesionId) -gn:Infofiles_infopagename_ -> gdmt:hasRightsInfo -> datasetstatus(datasetstatusname) -gn:Infofiles_infopagename_ -> gnt:belongsToSet -> gn:setInbredset_name -gn:Infofiles_infopagename_ -> gnt:hasTissue -> gn:tissue_tissue_short_name -gn:Infofiles_infopagename_ -> gnt:usesNormalization -> gn:avgmethod_avgmethod_avgmethodname -gn:Infofiles_infopagename_ -> gnt:usesPlatform -> gn:platform_genechip_genechip -gn:Infofiles_infopagename_ -> gdmt:isDescribedBy -> DatasetsSummary +gn:Infofiles_infopagename_ -> dcat:contactPoint -> gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email +gn:Infofiles_infopagename_ -> foaf:Organization -> Organizations(OrganizationName) +gn:Infofiles_infopagename_ -> dct:identifier -> GNInfoFiles(GN_AccesionId) +gn:Infofiles_infopagename_ -> dct:accessRights -> datasetstatus(datasetstatusname) +gn:Infofiles_infopagename_ -> xkos:classifiedUnder -> gn:setInbredset_inbredsetname +gn:Infofiles_infopagename_ -> gnt:hasTissue -> gn:tissueTissue_short_name +gn:Infofiles_infopagename_ -> gnt:usesNormalization -> gn:avgMethodAvgmethod_avgmethodname +gn:Infofiles_infopagename_ -> gnt:usesPlatform -> gn:platformGenechip_genechip +gn:Infofiles_infopagename_ -> dct:description -> DatasetsSummary gn:Infofiles_infopagename_ -> gnt:hasGeoSeriesId -> gn:Infofiles_infopagename_ -> gnt:hasTissueInfo -> DatasetsAboutTissue gn:Infofiles_infopagename_ -> gnt:hasContentInfo -> InfoFilesSpecifics @@ -36,9 +36,8 @@ gn:Infofiles_infopagename_ -> gnt:hasPlatformInfo -> DatasetsAboutPlatform gn:Infofiles_infopagename_ -> gnt:hasDataProcessingInfo -> DatasetsAboutDataProcessing gn:Infofiles_infopagename_ -> gnt:hasNotes -> DatasetsNotes gn:Infofiles_infopagename_ -> gnt:hasExperimentDesignInfo -> DatasetsExperimentDesign -gn:Infofiles_infopagename_ -> gdmt:hasContributorInfo -> DatasetsContributors -gn:Infofiles_infopagename_ -> gdmt:IsCitedBy -> DatasetsCitation -gn:Infofiles_infopagename_ -> gnt:hasAcknowledgement -> InfoFilesData_Source_Acknowledge +gn:Infofiles_infopagename_ -> dct:creator -> DatasetsContributors +gn:Infofiles_infopagename_ -> dct:isReferencedBy -> DatasetsCitation gn:Infofiles_infopagename_ -> gnt:hasAcknowledgement -> DatasetsAcknowledgment ``` Here's an example query: @@ -46,8 +45,10 @@ Here's an example query: ```sparql PREFIX v: PREFIX foaf: -PREFIX gdmt: +PREFIX xsd: +PREFIX dcat: PREFIX skos: +PREFIX xkos: PREFIX geoSeries: PREFIX gnt: PREFIX gn: @@ -59,9 +60,9 @@ PREFIX taxon: PREFIX dct: SELECT * WHERE { - ?s rdf:type gnc:probesetDataset . + ?s rdf:type dcat:Dataset . + ?s xkos:classifiedUnder gnc:Probeset . ?s rdfs:label "Br_U_0803_M" . - ?s skos:prefLabel "UTHSC Brain mRNA U74Av2 (Aug-Sep03)" . ?s ?p ?o . } ``` @@ -69,26 +70,25 @@ SELECT * WHERE { Expected Result: ```rdf -gn:Br_u_0803_m rdf:type gnc:probesetDataset . +gn:Br_u_0803_m rdf:type dcat:Dataset . +gn:Br_u_0803_m xkos:classifiedUnder gnc:Probeset . gn:Br_u_0803_m rdfs:label "Br_U_0803_M" . -gn:Br_u_0803_m skos:prefLabel "UTHSC Brain mRNA U74Av2 (Aug-Sep03)" . -gn:Br_u_0803_m gdmt:hasTitleInfo "UTHSC Brain mRNA U74Av2 (Aug03) MAS5" . +gn:Br_u_0803_m skos:altLabel "UTHSC Brain mRNA U74Av2 (Aug-Sep03)" . gn:Br_u_0803_m dct:created "2003-08-01" . -gn:Br_u_0803_m gdmt:hasCreatorInfo gn:investigator_robert_williams_rwilliams_uthsc.edu . -gn:Br_u_0803_m gdmt:hasCreatorAffiliation "University of Tennessee Health Science Center" . -gn:Br_u_0803_m gdmt:hasDatasetIdentifierSubType "GN1" . -gn:Br_u_0803_m gdmt:hasRightsInfo "public" . -gn:Br_u_0803_m gnt:belongsToSet gn:setBxd . -gn:Br_u_0803_m gnt:hasTissue gn:tissue_brn . -gn:Br_u_0803_m gnt:usesNormalization gn:avgmethod_mas5 . -gn:Br_u_0803_m gnt:usesPlatform gn:platform_mg_u74av2 . -gn:Br_u_0803_m gdmt:isDescribedBy "

This August 2003 freeze provides estimates of mRNA expression in brains of BXD recombinant inbred mice measured using Affymetrix U74Av2 microarrays. This is data set includes six arrays which are of marginal quality. New users are encouraged to use one of the more recent data sets December 2003 or March 2004 from which these six arrays have been excluded. Data were generated at the University of Tennessee Health Science Center UTHSC. Over 300 brain samples from 35 strains were hybridized in small pools n=3 to 106 arrays. Data were processed using the Microarray Suite 5 MAS 5 protocol of Affymetrix. To simplify comparison between transforms, MAS 5 values of each array were adjusted to an average of 8 units and a variance of 2 units. In general, the MAS 5 transform does not perform as well as RMA, PDNN, or the new heritability weighted transforms HW1PM.

" . +gn:Br_u_0803_m dcat:contactPoint gn:investigatorRobert_williams_rwilliams_uthsc.edu . +gn:Br_u_0803_m foaf:Organization "University of Tennessee Health Science Center" . +gn:Br_u_0803_m dct:identifier "GN1" . +gn:Br_u_0803_m dct:accessRights "public" . +gn:Br_u_0803_m xkos:classifiedUnder gn:setBxd . +gn:Br_u_0803_m gnt:hasTissue gn:tissueBrn . +gn:Br_u_0803_m gnt:usesNormalization gn:avgMethodMas5 . +gn:Br_u_0803_m gnt:usesPlatform gn:platformMg_u74av2 . +gn:Br_u_0803_m dct:description "

This August 2003 freeze provides estimates of mRNA expression in brains of BXD recombinant inbred mice measured using Affymetrix U74Av2 microarrays. This is data set includes six arrays which are of marginal quality. New users are encouraged to use one of the more recent data sets December 2003 or March 2004 from which these six arrays have been excluded. Data were generated at the University of Tennessee Health Science Center UTHSC. Over 300 brain samples from 35 strains were hybridized in small pools n=3 to 106 arrays. Data were processed using the Microarray Suite 5 MAS 5 protocol of Affymetrix. To simplify comparison between transforms, MAS 5 values of each array were adjusted to an average of 8 units and a variance of 2 units. In general, the MAS 5 transform does not perform as well as RMA, PDNN, or the new heritability weighted transforms HW1PM.

" . gn:Br_u_0803_m gnt:hasTissueInfo "

Each array was hybridized with labeled cRNA generated from a pool of three brains from adult animals usually of the same age and always of the same sex. The brain region included most of the forebrain and midbrain, bilaterally. However, the sample excluded the olfactory bulbs, retinas, or the posterior pituitary all formally part of the forebrain. A total of 100 such pooled samples were arrayed: 74 from females and 26 from males. Animals ranged in age from 56 to 441 days, usually with a balanced design: one pool at approximately 8 weeks, one pool at approximately 20 weeks, and one pool at approximately 1 year. Strain averages of mRNA expression level are therefore typically based on three pooled biological replicate arrays. This data set does not incorporate statistical adjustment for possible effects of age and sex. Users can select the strain symbol in the table above to review details about the specific cases and array processing center DP = Divyen Patel at Genome Explorations, Inc; TS = Thomas Sutter at University of Memphis. You can also click on the individual symbols males or females to view the array image.

" . gn:Br_u_0803_m gnt:hasCaseInfo "

This data set includes estimate of gene expression for 35 genetically uniform lines of mice: C57BL/6J B6, or simply B, DBA/2J D2 or D, their B6D2 F1 intercross, and 32 BXD recombinant inbred RI strains derived by crossing female B6 mice with male D2 mice and then inbreeding progeny for over 21 generations. This set of RI strains is a remarkable resource because many of these strains have been extensively phenotyped for hundreds of interesting traits over a 25-year period. A significant advantage of this RI set is that the two parental strains B6 and D2 have both been extensively sequenced and are known to differ at approximately 1.8 million SNPs. Coding variants mostly single nucleotide polymorphisms and insertion-deletions that may produce interesting phenotypes can be rapidly identified in this particular RI set.

\r\n\r\n

BXD1 through BXD32 were produced by Benjamin A. Taylor starting in the late 1970s. BXD33 through BXD42 were also produced by Taylor, but from a second set of crosses initiated in the early 1990s. These strains are all available from the Jackson Laboratory, Bar Harbor, Maine. BXD43 through BXD99 were produced by Lu Lu, Jeremy Peirce, Lee M. Silver, and Robert W. Williams in the late 1990s and early 2000s using advanced intercross progeny Peirce et al. 2004. Only two of these incipient strains are included in the current database BXD67 and BXD68.

\r\n\r\n

In this mRNA expression database we generally used progeny of stock obtained from The Jackson Laboratory between 1999 and 2001. Animals were generated in-house at the University of Alabama by John Mountz and Hui-Chen Hsu and at the University of Tennessee Health Science Center by Lu Lu and Robert Williams.

\r\n\r\n

The table below lists the arrays by strain, sex, and age. Each array was hybridized to a pool of mRNA from three mice. Note that this table includes six arrays dropped from the December 2003 data sets BXD6, n=2; BXD12, BXD16, BXD40, and BXD67, n=1 each.

\r\n\r\n\r\n \r\n \r\n \r\n \r\n \r\n
\r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n
Strain\r\n

Age

\r\n
Strain\r\n

Age

\r\n
\r\n

8 Wks

\r\n
\r\n

20 Wks

\r\n
\r\n

52 Wks

\r\n
\r\n

8 Wks

\r\n
\r\n

20 Wks

\r\n
\r\n

52 Wks

\r\n
C57BL/6J B6♂♂♂♀♀DBA/2J D2♀♀♂♂ 
B6D2F1 F1♀ ♀♀ BXD1♀♀ â™€
BXD2♂♀♀BXD5♂♂♀  
BXD6♀♀♀BXD8♀♂♀ 
BXD9♂♀♀BXD11♀♀ â™€
BXD12 â™‚♀♀BXD13♀   
BXD14 â™€â™€â™€BXD15♀ â™€
BXD16♀♀♀ BXD18♀♂♀
BXD19♀♀♀BXD21♀♀♂♂ 
BXD22♀♀♀ BXD23♀  
BXD24♀♀ â™€BXD25♀♀ ♀♀  
BXD27  â™€â™€BXD28♀♀♀
BXD29♂ â™€BXD31♀♀♀♀ 
BXD32♀♂♀♀BXD33♂♀♀ 
BXD34♂♀♀ BXD38♂♀♀  
BXD39♂♀ ♂ BXD40♂♂♀♀  
BXD42♂♂ ♀  BXD67 F8♀ ♀♂  
BXD68 F9♀ ♀♂     
\r\n
" . gn:Br_u_0803_m gnt:hasPlatformInfo "

Affymetrix U74Av2 GeneChip: The expression data were generated using 100 U74Av2 arrays. The chromosomal locations of U74Av2 probe sets were determined by BLAT analysis of concatenated probe sequences using the Mouse Genome Sequencing Consortium May 2004 mm5 assembly. This BLAT analysis is performed periodically by Yanhua Qu as each new build of the mouse genome is released see http://genome.ucsc.edu/cgi-bin/hgBlat?command=start&org=mouse. We thank Yan Cui UTHSC for allowing us to use his Linux cluster to perform this analysis. It is possiible to confirm the BLAT alignment results yourself simply by clicking on the Verify link in the Trait Data and Editing Form right side of the Location line.

" . gn:Br_u_0803_m gnt:hasDataProcessingInfo "
Probe cell level data from the CEL file: Probe signal intensity estimates in the Affymetrix CEL files are the 75% quantile value taken from a set of 36 6x6 pixels per probe cell in the DAT image file.\r\n
    \r\n
  • Step 1: We added an offset of 1.0 to the CEL expression values for each cell to ensure that all values could be logged without generating negative values.
  • \r\n
  • Step 2: We took the log2 of each cell signal intensity.
  • \r\n
  • Step 3: We computed the Z score for each of these log2 cell signal intensity values within a single array.
  • \r\n
  • Step 4: We multiplied all Z scores by 2.
  • \r\n
  • Step 5: We added a constant of 8 units to the value of the Z score. The consequence of this simple set of transformations is to produce a set of Z scores that have a mean of 8 units, a variance of 4 units, and a standard deviation of 2 units. The advantage of this modified Z score is that a 2-fold difference in expression level corresponds roughly to 1 unit.
  • \r\n
  • Step 6: We computed the arithmetic mean of the values for the set of microarrays for each strain. We have not corrected for variance introduced by sex, age, source of animals, or any possible interaction. We have not corrected for background beyond that implemented by Affymetrix in generating the CEL file.
  • \r\n
\r\nProbe set data from the CHP file: Probe set estimates of expression were initially generated using the standard Affymetrix MAS 5 algorithm. The CHP values were then processed following precisely the same six steps listed above to normalize expression and stabilize the variance of all 106 arrays. The mean expression within each array is therefore 8 units with a standard deviation of 2 units. A 1-unit difference represents roughly a 2-fold difference in expression level. Expression levels below 5 are close to the background noise level. While a value of 8 unit is nominally the average expression, this average includes all those transcripts with negligible expression in the brain that would often be eliminated from subsequent analysis so-called "absent" and "marginal" calls in the CHP file.
\r\n\r\n

About the array probe set names:

\r\n\r\n
\r\n

Most probe sets on the U74Av2 array consist of a total of 32 probes, divided into 16 perfect match probes and 16 mismatch controls. Each set of these 25-nucleotide-long probes has an identifier code that includes a unique number, an underscore character, and several suffix characters that highlight design features. The most common probe set suffix is at. This code indicates that the probes should hybridize relatively selectively with the complementary anti-sense target i.e., the complemenary RNA produced from a single gene. Other codes include:

\r\n\r\n
    \r\n
  • f_at sequence family: Some probes in this probe set will hybridize to identical and/or slightly different sequences of related gene transcripts.
  • \r\n
  • s_at similarity constraint: All Probes in this probe set target common sequences found in transcripts from several genes.
  • \r\n
  • g_at common groups: Some probes in this set target identical sequences in multiple genes and some target unique sequences in the intended target gene.
  • \r\n
  • r_at rules dropped: Probe sets for which it was not possible to pick a full set of unique probes using the Affymetrix probe selection rules. Probes were picked after dropping some of the selection rules.
  • \r\n
  • i_at incomplete: Designates probe sets for which there are fewer than the standard numbers of unique probes specified in the design 16 perfect match for the U74Av2.
  • \r\n
  • st sense target: Designates a sense target; almost always generated in error.
  • \r\n
\r\n\r\n

Descriptions for the probe set extensions were taken from the Affymetrix GeneChip Expression Analysis Fundamentals.

\r\n
" . gn:Br_u_0803_m gnt:hasNotes "

This text file originally generated by RWW, EJC, and YHQ, August 2003. Updated by RWW, October 30, 2004.

" . -gn:Br_u_0803_m gnt:hasAcknowledgement "

Data were generated with funds to RWW from the Dunavant Chair of\r\nExcellence, University of Tennessee Health Science Center, Department\r\nof Pediatrics. The majority of arrays were processed at Genome Explorations by Divyen Patel. We thank Guomin Zhou for generating advanced intercross stock used to produce most of the new BXD RI strains.\r\n

" . gn:Br_u_0803_m gnt:hasAcknowledgement "

Data were generated with funds to RWW from the Dunavant Chair of Excellence, University of Tennessee Health Science Center, Department of Pediatrics. The majority of arrays were processed at Genome Explorations by Divyen Patel. We thank Guomin Zhou for generating advanced intercross stock used to produce most of the new BXD RI strains.

" . ``` @@ -100,26 +100,28 @@ gn:Br_u_0803_m gnt:hasAcknowledgement "

Data were generated with funds to RWW The following SQL query was executed: ```sql -SELECT PublishFreeze.Name, PublishFreeze.Name, PublishFreeze.FullName, PublishFreeze.ShortName, PublishFreeze.CreateTime, InbredSet.Name FROM PublishFreeze LEFT JOIN InfoFiles ON InfoFiles.InfoPageName = PublishFreeze.Name LEFT JOIN InbredSet ON PublishFreeze.InbredSetId = InbredSet.InbredSetId WHERE PublishFreeze.public > 0 AND PublishFreeze.confidentiality < 1 AND InfoFiles.InfoFileId IS NULL +SELECT PublishFreeze.Name, PublishFreeze.FullName, PublishFreeze.Name, PublishFreeze.ShortName, PublishFreeze.CreateTime, InbredSet.Name AS InbredSetName FROM PublishFreeze LEFT JOIN InfoFiles ON InfoFiles.InfoPageName = PublishFreeze.Name LEFT JOIN InbredSet ON PublishFreeze.InbredSetId = InbredSet.InbredSetId WHERE PublishFreeze.public > 0 AND PublishFreeze.confidentiality < 1 AND InfoFiles.InfoFileId IS NULL ``` The above query results to triples that have the form: ```text -gn:Publishfreeze_name_ -> rdf:type -> gnc:phenotypeDataset +gn:Publishfreeze_name_ -> xkos:classifiedUnder -> gnc:Phenotype +gn:Publishfreeze_name_ -> dct:title -> PublishFreeze(FullName) gn:Publishfreeze_name_ -> rdfs:label -> PublishFreeze(Name) -gn:Publishfreeze_name_ -> skos:prefLabel -> PublishFreeze(FullName) gn:Publishfreeze_name_ -> skos:altLabel -> PublishFreeze(ShortName) gn:Publishfreeze_name_ -> dct:created -> "PublishFreeze(CreateTime)"^^xsd:date -gn:Publishfreeze_name_ -> gnt:belongsToSet -> gn:setInbredset_name +gn:Publishfreeze_name_ -> xkos:classifiedUnder -> gn:setInbredset_inbredsetname ``` Here's an example query: ```sparql PREFIX v: PREFIX foaf: -PREFIX gdmt: +PREFIX xsd: +PREFIX dcat: PREFIX skos: +PREFIX xkos: PREFIX geoSeries: PREFIX gnt: PREFIX gn: @@ -131,9 +133,9 @@ PREFIX taxon: PREFIX dct: SELECT * WHERE { - ?s rdf:type gnc:phenotypeDataset . + ?s xkos:classifiedUnder gnc:Phenotype . + ?s dct:title "B6D2F2 PSU Phenotypes" . ?s rdfs:label "B6D2F2-PSUPublish" . - ?s skos:prefLabel "B6D2F2 PSU Phenotypes" . ?s ?p ?o . } ``` @@ -141,12 +143,12 @@ SELECT * WHERE { Expected Result: ```rdf -gn:B6d2f2_psupublish rdf:type gnc:phenotypeDataset . +gn:B6d2f2_psupublish xkos:classifiedUnder gnc:Phenotype . +gn:B6d2f2_psupublish dct:title "B6D2F2 PSU Phenotypes" . gn:B6d2f2_psupublish rdfs:label "B6D2F2-PSUPublish" . -gn:B6d2f2_psupublish skos:prefLabel "B6D2F2 PSU Phenotypes" . gn:B6d2f2_psupublish skos:altLabel "B6D2F2 PSU Publish" . gn:B6d2f2_psupublish dct:created "2015-03-18"^^xsd:date . -gn:B6d2f2_psupublish gnt:belongsToSet gn:setB6d2f2-psupublish . +gn:B6d2f2_psupublish xkos:classifiedUnder gn:setB6d2f2-psu . ``` @@ -163,20 +165,22 @@ SELECT GenoFreeze.Name, GenoFreeze.Name, GenoFreeze.FullName, GenoFreeze.ShortNa The above query results to triples that have the form: ```text -gn:Genofreeze_name_ -> rdf:type -> gnc:genotypeDataset +gn:Genofreeze_name_ -> xkos:classifiedUnder -> gnc:Genotype gn:Genofreeze_name_ -> rdfs:label -> GenoFreeze(Name) -gn:Genofreeze_name_ -> skos:prefLabel -> GenoFreeze(FullName) +gn:Genofreeze_name_ -> dct:title -> GenoFreeze(FullName) gn:Genofreeze_name_ -> skos:altLabel -> GenoFreeze(ShortName) gn:Genofreeze_name_ -> dct:created -> "GenoFreeze(CreateTime)"^^xsd:date -gn:Genofreeze_name_ -> gnt:belongsToSet -> gn:setInbredset_name +gn:Genofreeze_name_ -> xkos:classifiedUnder -> gn:setInbredset_name ``` Here's an example query: ```sparql PREFIX v: PREFIX foaf: -PREFIX gdmt: +PREFIX xsd: +PREFIX dcat: PREFIX skos: +PREFIX xkos: PREFIX geoSeries: PREFIX gnt: PREFIX gn: @@ -188,9 +192,9 @@ PREFIX taxon: PREFIX dct: SELECT * WHERE { - ?s rdf:type gnc:genotypeDataset . + ?s xkos:classifiedUnder gnc:Genotype . ?s rdfs:label "B6D2RIGeno" . - ?s skos:prefLabel "B6D2RI Genotypes" . + ?s dct:title "B6D2RI Genotypes" . ?s ?p ?o . } ``` @@ -198,12 +202,12 @@ SELECT * WHERE { Expected Result: ```rdf -gn:B6d2rigeno rdf:type gnc:genotypeDataset . +gn:B6d2rigeno xkos:classifiedUnder gnc:Genotype . gn:B6d2rigeno rdfs:label "B6D2RIGeno" . -gn:B6d2rigeno skos:prefLabel "B6D2RI Genotypes" . +gn:B6d2rigeno dct:title "B6D2RI Genotypes" . gn:B6d2rigeno skos:altLabel "B6D2RIGeno" . gn:B6d2rigeno dct:created "2022-10-24"^^xsd:date . -gn:B6d2rigeno gnt:belongsToSet gn:setB6d2rigeno . +gn:B6d2rigeno xkos:classifiedUnder gn:setB6d2rigeno . ``` @@ -214,30 +218,32 @@ gn:B6d2rigeno gnt:belongsToSet gn:setB6d2rigeno . The following SQL query was executed: ```sql -SELECT ProbeSetFreeze.Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS AvgMethodName, ProbeSetFreeze.FullName, ProbeSetFreeze.ShortName, ProbeSetFreeze.Name, ProbeSetFreeze.Name2, ProbeSetFreeze.CreateTime, ProbeSetFreeze.DataScale, Tissue.Short_Name, InbredSet.Name FROM ProbeSetFreeze LEFT JOIN InfoFiles ON InfoFiles.InfoPageName = ProbeSetFreeze.Name LEFT JOIN ProbeFreeze USING (ProbeFreezeId) LEFT JOIN AvgMethod ON AvgMethod.AvgMethodId = ProbeSetFreeze.AvgID LEFT JOIN InbredSet ON ProbeFreeze.InbredSetId = InbredSet.Id LEFT JOIN Tissue ON ProbeFreeze.TissueId = Tissue.TissueId WHERE ProbeSetFreeze.public > 0 AND InfoFiles.InfoPageName IS NULL GROUP BY ProbeFreeze.Id +SELECT ProbeSetFreeze.Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS AvgMethodName, ProbeSetFreeze.FullName, ProbeSetFreeze.ShortName, ProbeSetFreeze.Name, ProbeSetFreeze.Name2, ProbeSetFreeze.CreateTime, ProbeSetFreeze.DataScale, Tissue.Short_Name, InbredSet.Name AS InbredSetName FROM ProbeSetFreeze LEFT JOIN InfoFiles ON InfoFiles.InfoPageName = ProbeSetFreeze.Name LEFT JOIN ProbeFreeze USING (ProbeFreezeId) LEFT JOIN AvgMethod ON AvgMethod.AvgMethodId = ProbeSetFreeze.AvgID LEFT JOIN InbredSet ON ProbeFreeze.InbredSetId = InbredSet.Id LEFT JOIN Tissue ON ProbeFreeze.TissueId = Tissue.TissueId WHERE ProbeSetFreeze.public > 0 AND InfoFiles.InfoPageName IS NULL GROUP BY ProbeFreeze.Id ``` The above query results to triples that have the form: ```text -gn:Probesetfreeze_name_ -> rdf:type -> gnc:probesetDataset -gn:Probesetfreeze_name_ -> gnt:usesNormalization -> gn:avgmethod_avgmethod_avgmethodname +gn:Probesetfreeze_name_ -> xkos:classifiedUnder -> gnc:Probeset +gn:Probesetfreeze_name_ -> gnt:usesNormalization -> gn:avgMethodAvgmethod_avgmethodname gn:Probesetfreeze_name_ -> dct:title -> ProbeSetFreeze(FullName) gn:Probesetfreeze_name_ -> rdfs:label -> ProbeSetFreeze(ShortName) gn:Probesetfreeze_name_ -> skos:prefLabel -> ProbeSetFreeze(Name) gn:Probesetfreeze_name_ -> skos:altLabel -> ProbeSetFreeze(Name2) gn:Probesetfreeze_name_ -> dct:created -> "ProbeSetFreeze(CreateTime)"^^xsd:datetime gn:Probesetfreeze_name_ -> gnt:usesDataScale -> ProbeSetFreeze(DataScale) -gn:Probesetfreeze_name_ -> gnt:hasTissue -> gn:tissue_tissue_short_name -gn:Probesetfreeze_name_ -> gnt:belongsToSet -> gn:setInbredset_name +gn:Probesetfreeze_name_ -> gnt:hasTissue -> gn:tissueTissue_short_name +gn:Probesetfreeze_name_ -> xkos:classifiedUnder -> gn:setInbredset_inbredsetname ``` Here's an example query: ```sparql PREFIX v: PREFIX foaf: -PREFIX gdmt: +PREFIX xsd: +PREFIX dcat: PREFIX skos: +PREFIX xkos: PREFIX geoSeries: PREFIX gnt: PREFIX gn: @@ -249,8 +255,8 @@ PREFIX taxon: PREFIX dct: SELECT * WHERE { - ?s rdf:type gnc:probesetDataset . - ?s gnt:usesNormalization gn:avgmethod_rankinv . + ?s xkos:classifiedUnder gnc:Probeset . + ?s gnt:usesNormalization gn:avgMethodRankinv . ?s dct:title "UBC/CMMT BXD P0 Cerebellum ILM Mouse WG-6 v2.0 (May13) RankInv" . ?s rdfs:label "UBC/CMMT BXD P0 Cerebellum ILM Mouse WG-6 v2.0 (May13) RankInv" . ?s ?p ?o . @@ -260,16 +266,16 @@ SELECT * WHERE { Expected Result: ```rdf -gn:Cmmtubcbxdp00cerilm0513 rdf:type gnc:probesetDataset . -gn:Cmmtubcbxdp00cerilm0513 gnt:usesNormalization gn:avgmethod_rankinv . +gn:Cmmtubcbxdp00cerilm0513 xkos:classifiedUnder gnc:Probeset . +gn:Cmmtubcbxdp00cerilm0513 gnt:usesNormalization gn:avgMethodRankinv . gn:Cmmtubcbxdp00cerilm0513 dct:title "UBC/CMMT BXD P0 Cerebellum ILM Mouse WG-6 v2.0 (May13) RankInv" . gn:Cmmtubcbxdp00cerilm0513 rdfs:label "UBC/CMMT BXD P0 Cerebellum ILM Mouse WG-6 v2.0 (May13) RankInv" . gn:Cmmtubcbxdp00cerilm0513 skos:prefLabel "CMMTUBCBXDP00CerILM0513" . gn:Cmmtubcbxdp00cerilm0513 skos:altLabel "CMMTUBCBXDP00CerILMMay13" . gn:Cmmtubcbxdp00cerilm0513 dct:created "2013-04-22"^^xsd:datetime . gn:Cmmtubcbxdp00cerilm0513 gnt:usesDataScale "log2" . -gn:Cmmtubcbxdp00cerilm0513 gnt:hasTissue gn:tissue_cb . -gn:Cmmtubcbxdp00cerilm0513 gnt:belongsToSet gn:setCmmtubcbxdp00cerilm0513 . +gn:Cmmtubcbxdp00cerilm0513 gnt:hasTissue gn:tissueCb . +gn:Cmmtubcbxdp00cerilm0513 xkos:classifiedUnder gn:setBxd . ``` @@ -286,24 +292,26 @@ SELECT Investigators.FirstName, Investigators.LastName, Investigators.Email, Inv The above query results to triples that have the form: ```text -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> rdf:type -> foaf:Person -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> foaf:name -> Investigators(FirstName) Investigators(LastName) -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> foaf:givenName -> Investigators(FirstName) -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> foaf:familyName -> Investigators(LastName) -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> foaf:homepage -> Investigators(Url) -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> v:adr -> Investigators(Address) -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> v:locality -> Investigators(City) -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> v:region -> Investigators(State) -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> v:postal-code -> Investigators(ZipCode) -gn:investigator_investigators_firstname_investigators_lastname_investigators_email -> v:country-name -> Investigators(Country) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> rdf:type -> foaf:Person +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> foaf:name -> Investigators(FirstName) Investigators(LastName) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> foaf:givenName -> Investigators(FirstName) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> foaf:familyName -> Investigators(LastName) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> foaf:homepage -> Investigators(Url) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> v:adr -> Investigators(Address) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> v:locality -> Investigators(City) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> v:region -> Investigators(State) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> v:postal-code -> Investigators(ZipCode) +gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email -> v:country-name -> Investigators(Country) ``` Here's an example query: ```sparql PREFIX v: PREFIX foaf: -PREFIX gdmt: +PREFIX xsd: +PREFIX dcat: PREFIX skos: +PREFIX xkos: PREFIX geoSeries: PREFIX gnt: PREFIX gn: @@ -326,11 +334,11 @@ SELECT * WHERE { Expected Result: ```rdf -gn:investigator_evan_williams_ rdf:type foaf:Person . -gn:investigator_evan_williams_ foaf:name "Evan Williams" . -gn:investigator_evan_williams_ foaf:givenName "Evan" . -gn:investigator_evan_williams_ foaf:familyName "Williams" . -gn:investigator_evan_williams_ v:country-name "Switzerland" . +gn:investigatorEvan_williams_ rdf:type foaf:Person . +gn:investigatorEvan_williams_ foaf:name "Evan Williams" . +gn:investigatorEvan_williams_ foaf:givenName "Evan" . +gn:investigatorEvan_williams_ foaf:familyName "Williams" . +gn:investigatorEvan_williams_ v:country-name "Switzerland" . ``` @@ -347,21 +355,23 @@ SELECT GeneChip.Name, GeneChip.GeneChipName, GeneChip.Name, IF(GeneChip.GeneChip The above query results to triples that have the form: ```text -gn:platform_genechip_name -> rdf:type -> gnc:geneChip -gn:platform_genechip_name -> rdfs:label -> GeneChip(GeneChipName) -gn:platform_genechip_name -> skos:prefLabel -> GeneChip(Name) -gn:platform_genechip_name -> skos:altLabel -> Title -gn:platform_genechip_name -> gnt:hasGOTreeValue -> GeneChip(Go_tree_value) -gn:platform_genechip_name -> gnt:belongsToSpecies -> gn:Species_fullname -gn:platform_genechip_name -> gnt:hasGeoSeriesId -> geoSeries:GeneChip(GeoPlatform) +gn:platformGenechip_name -> rdf:type -> gnc:geneChip +gn:platformGenechip_name -> rdfs:label -> GeneChip(GeneChipName) +gn:platformGenechip_name -> skos:prefLabel -> GeneChip(Name) +gn:platformGenechip_name -> skos:altLabel -> Title +gn:platformGenechip_name -> gnt:hasGOTreeValue -> GeneChip(Go_tree_value) +gn:platformGenechip_name -> xkos:classifiedUnder -> gn:Species_fullname +gn:platformGenechip_name -> gnt:hasGeoSeriesId -> geoSeries:GeneChip(GeoPlatform) ``` Here's an example query: ```sparql PREFIX v: PREFIX foaf: -PREFIX gdmt: +PREFIX xsd: +PREFIX dcat: PREFIX skos: +PREFIX xkos: PREFIX geoSeries: PREFIX gnt: PREFIX gn: @@ -383,11 +393,11 @@ SELECT * WHERE { Expected Result: ```rdf -gn:platform_mg_u74av2 rdf:type gnc:geneChip . -gn:platform_mg_u74av2 rdfs:label "Affy Mouse Genome U74Av2 (GPL81)" . -gn:platform_mg_u74av2 skos:prefLabel "MG_U74AV2" . -gn:platform_mg_u74av2 gnt:hasGOTreeValue "affy_mg_u74av2" . -gn:platform_mg_u74av2 gnt:belongsToSpecies gn:Mus_musculus . -gn:platform_mg_u74av2 gnt:hasGeoSeriesId geoSeries:GPL81 . +gn:platformMg_u74av2 rdf:type gnc:geneChip . +gn:platformMg_u74av2 rdfs:label "Affy Mouse Genome U74Av2 (GPL81)" . +gn:platformMg_u74av2 skos:prefLabel "MG_U74AV2" . +gn:platformMg_u74av2 gnt:hasGOTreeValue "affy_mg_u74av2" . +gn:platformMg_u74av2 xkos:classifiedUnder gn:Mus_musculus . +gn:platformMg_u74av2 gnt:hasGeoSeriesId geoSeries:GPL81 . ``` diff --git a/rdf-documentation/genbank-metadata.md b/rdf-documentation/genbank-metadata.md new file mode 100644 index 0000000..7e519fd --- /dev/null +++ b/rdf-documentation/genbank-metadata.md @@ -0,0 +1,50 @@ +# Genebank Metadata +## 'genbank' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT Genbank.Id, Genbank.Sequence, Species.Fullname FROM Genbank LEFT JOIN Species USING (SpeciesId) +``` + +The above query results to triples that have the form: + +```text +genbank:Genbank(Id) -> gnt:hasSequence -> Genbank(Sequence) +genbank:Genbank(Id) -> xkos:classifiedUnder -> gn:Species_fullname +``` +Here's an example query: + +```sparql +PREFIX rdf: +PREFIX rdfs: +PREFIX skos: +PREFIX xkos: +PREFIX gn: +PREFIX gnc: +PREFIX gnt: +PREFIX dct: +PREFIX foaf: +PREFIX pubmed: +PREFIX ncbiTaxon: +PREFIX generif: +PREFIX xsd: +PREFIX genbank: +PREFIX owl: + +SELECT * WHERE { + ?s gnt:hasSequence "GAAAAGGACGAGAGAAAATTATTTTTAAGATAATTAAACATAAAAACCCTGGTGCTTATTACATTATAAAGTACGTTTTTAAAAACCCACAAACTATTATACATACGTTTATGAATCAATTAAATACTCTGCACTTGTTAGGAACACGCATATCCCTTCTTTGTTGAGTTTAACGGAACGGGACAGCGGCGTGCGCCCGCGGCTGGGCTGCTCTGGCCGCGGGTCTCCCCAGGCG" . + ?s xkos:classifiedUnder gn:Mus_musculus . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +genbank:AA002843 gnt:hasSequence "GAAAAGGACGAGAGAAAATTATTTTTAAGATAATTAAACATAAAAACCCTGGTGCTTATTACATTATAAAGTACGTTTTTAAAAACCCACAAACTATTATACATACGTTTATGAATCAATTAAATACTCTGCACTTGTTAGGAACACGCATATCCCTTCTTTGTTGAGTTTAACGGAACGGGACAGCGGCGTGCGCCCGCGGCTGGGCTGCTCTGGCCGCGGGTCTCCCCAGGCG" . +genbank:AA002843 xkos:classifiedUnder gn:Mus_musculus . +``` + diff --git a/rdf-documentation/generif-metadata.md b/rdf-documentation/generif-metadata.md index fc058bc..7e3c4d6 100644 --- a/rdf-documentation/generif-metadata.md +++ b/rdf-documentation/generif-metadata.md @@ -6,35 +6,33 @@ The following SQL query was executed: ```sql -SELECT GeneRIF_BASIC.GeneId, GROUP_CONCAT(DISTINCT symbol) AS symbol, GROUP_CONCAT(DISTINCT Species.SpeciesName) AS species, GROUP_CONCAT(DISTINCT TaxID) AS taxId FROM GeneRIF_BASIC LEFT JOIN Species USING (SpeciesId) GROUP BY GeneId ORDER BY BINARY symbol +SELECT GeneRIF_BASIC.symbol, GeneRIF_BASIC.symbol FROM GeneRIF_BASIC GROUP BY BINARY symbol ``` The above query results to triples that have the form: ```text -generif:GeneRIF_BASIC(GeneId) -> gnt:symbol -> symbol -generif:GeneRIF_BASIC(GeneId) -> gnt:belongsToSpecies -> species -generif:GeneRIF_BASIC(GeneId) -> dct:relation -> ncbiTaxon:taxId +gn:symbolGeneRIF_BASIC_symbol_ -> rdfs:label -> GeneRIF_BASIC(symbol) ``` Here's an example query: ```sparql PREFIX rdf: PREFIX rdfs: +PREFIX skos: +PREFIX xkos: PREFIX gn: PREFIX gnc: PREFIX gnt: PREFIX dct: PREFIX foaf: PREFIX pubmed: -PREFIX ncbiTaxon: +PREFIX taxon: PREFIX generif: PREFIX xsd: PREFIX owl: SELECT * WHERE { - ?s gnt:belongsToSpecies "Human" . - ?s dct:relation ncbiTaxon:9606 . ?s ?p ?o . } ``` @@ -42,8 +40,6 @@ SELECT * WHERE { Expected Result: ```rdf -generif:233 gnt:belongsToSpecies "Human" . -generif:233 dct:relation ncbiTaxon:9606 . ``` @@ -54,43 +50,34 @@ generif:233 dct:relation ncbiTaxon:9606 . The following SQL query was executed: ```sql -SELECT Species.FullName, GeneRIF.comment, GeneRIF.symbol, GeneRIF.createtime, GeneRIF.comment, GeneRIF.symbol, GROUP_CONCAT(DISTINCT GeneCategory.Name SEPARATOR '$$') AS GeneCategory, Species.Fullname, IFNULL(GeneRIF.PubMed_ID, '') AS PubMed_ID, GeneRIF.createtime, GeneRIF.email, Investigators.Email, Investigators.FirstName, Investigators.LastName, Investigators.Email, GeneRIF.weburl FROM GeneRIF LEFT JOIN Species ON Species.SpeciesId = GeneRIF.SpeciesId LEFT JOIN GeneRIFXRef ON GeneRIFXRef.GeneRIFId = GeneRIF.Id LEFT JOIN GeneCategory ON GeneRIFXRef.GeneCategoryId = GeneCategory.Id LEFT JOIN Investigators ON Investigators.Email = GeneRIF.email WHERE GeneRIF.display > 0 AND GeneRIF.VersionId = 0 AND GeneRIF.comment IS NOT NULL GROUP BY GeneRIF.comment, GeneRIF.createtime +SELECT GeneRIF.symbol, GeneRIF.comment, GeneRIF.createtime AS EntryCreateTime, GeneRIF.PubMed_ID AS PMID, GeneRIF.weburl, Species.Fullname, GROUP_CONCAT(DISTINCT GeneCategory.Name SEPARATOR '$$') AS GeneCategory, GeneRIF.email, Investigators.Email, Investigators.FirstName, Investigators.LastName, Investigators.Email FROM GeneRIF LEFT JOIN Species ON Species.SpeciesId = GeneRIF.SpeciesId LEFT JOIN GeneRIFXRef ON GeneRIFXRef.GeneRIFId = GeneRIF.Id LEFT JOIN GeneCategory ON GeneRIFXRef.GeneCategoryId = GeneCategory.Id LEFT JOIN Investigators ON Investigators.Email = GeneRIF.email WHERE GeneRIF.display > 0 AND GeneRIF.VersionId = 0 AND GeneRIF.comment IS NOT NULL GROUP BY GeneRIF.comment, BINARY GeneRIF.symbol ``` The above query results to triples that have the form: ```text -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> rdf:type -> gnc:GNWikiEntry -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> rdfs:label -> GeneRIFcomment -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> gnt:symbol -> GeneRIF(symbol) -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> gnt:belongsToSpecies -> gn:Species_fullname -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> dct:created -> -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> dct:creator -> gn:investigator_investigators_firstname_investigators_lastname_investigators_email -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> foaf:homepage -> GeneRIF(weburl) -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> gnt:belongsToCategory -> GeneCategory -gn:generif_e72e92f4-59b5-3bbd-ac46-a39a23f25e55 -> dct:references -> pubmed:PubMed_ID +gn:symbolGeneRIF_symbol_ -> rdfs:comment -> [ rdf:type gnc:GNWikiEntry ; xkos:classifiedUnder gn:Species_fullname ; rdfs:comment "GeneRIFcomment"^^xsd:string ; dct:references pubmed:GeneRIF(PMID) ; dct:creator gn:investigatorInvestigators_firstname_investigators_lastname_investigators_email ; gnt:belongsToCategory "GeneCategory" ; foaf:homepage "GeneRIF(weburl)" ; ] ``` Here's an example query: ```sparql PREFIX rdf: PREFIX rdfs: +PREFIX skos: +PREFIX xkos: PREFIX gn: PREFIX gnc: PREFIX gnt: PREFIX dct: PREFIX foaf: PREFIX pubmed: -PREFIX ncbiTaxon: +PREFIX taxon: PREFIX generif: PREFIX xsd: PREFIX owl: SELECT * WHERE { - ?s rdf:type gnc:GNWikiEntry . - ?s rdfs:label "Part 2 of the Slc9a1 wiki.\r\n\r\nThe human SLC9A1 gene was cloned and mapped to human chromosome 1p Lifton et al., 1990.\r\n\r\nThe mouse Slc9a1 gene maps to chromosome 4. Morahan et al., 1993. There are three common alleles of Slc9a1, originally detected by RFLP analyses. Each of these allelic SLC9A1 proteins have different levels of antiporter activity. Morahan et al. 1994 Remarkably, intracellular pH varies between strains based on their Slc9a1 alleles. McClive et al. 1996." . - ?s gnt:symbol "Slc9a1" . - ?s gnt:belongsToSpecies gn:Mus_musculus . + ?s rdfs:comment #{\x5b; rdf:type gnc:GNWikiEntry ; xkos:classifiedUnder gn:Mus_musculus ; rdfs:comment "Part 2 of the Slc9a1 wiki.\\r\\n\\r\\nThe human SLC9A1 gene was cloned and mapped to human chromosome 1p Lifton et al., 1990.\\r\\n\\r\\nThe mouse Slc9a1 gene maps to chromosome 4. Morahan et al., 1993. There are three common alleles of Slc9a1, originally detected by RFLP analyses. Each of these allelic SLC9A1 proteins have different levels of antiporter activity. Morahan et al. 1994 Remarkably, intracellular pH varies between strains based on their Slc9a1 alleles. McClive et al. 1996."^^xsd:string ; dct:created "2011-06-10T12:06:30"^^xsd:datetime ; dct:references pubmed:094369 ; dct:references pubmed:8016086 ; dct:references pubmed:8550102 ; dct:creator gn:investigatorGrant_morahan_gem_waimr.uwa.edu.au ; gnt:belongsToCategory "Biochemistry" ; gnt:belongsToCategory "Genetic variation and alleles" ; gnt:belongsToCategory "Physiology and function" ; \x5d; }# . ?s ?p ?o . } ``` @@ -98,18 +85,7 @@ SELECT * WHERE { Expected Result: ```rdf -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f rdf:type gnc:GNWikiEntry . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f rdfs:label "Part 2 of the Slc9a1 wiki.\r\n\r\nThe human SLC9A1 gene was cloned and mapped to human chromosome 1p Lifton et al., 1990.\r\n\r\nThe mouse Slc9a1 gene maps to chromosome 4. Morahan et al., 1993. There are three common alleles of Slc9a1, originally detected by RFLP analyses. Each of these allelic SLC9A1 proteins have different levels of antiporter activity. Morahan et al. 1994 Remarkably, intracellular pH varies between strains based on their Slc9a1 alleles. McClive et al. 1996." . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f gnt:symbol "Slc9a1" . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f gnt:belongsToSpecies gn:Mus_musculus . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f dct:created "2011-06-10T12:06:30"^^xsd:datetime . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f dct:creator gn:investigator_grant_morahan_gem_waimr.uwa.edu.au . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f gnt:belongsToCategory "Biochemistry" . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f gnt:belongsToCategory "Genetic variation and alleles" . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f gnt:belongsToCategory "Physiology and function" . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f dct:references pubmed:094369 . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f dct:references pubmed:8016086 . -gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f dct:references pubmed:8550102 . +gn:symbolSlc9a1 rdfs:comment [ rdf:type gnc:GNWikiEntry ; xkos:classifiedUnder gn:Mus_musculus ; rdfs:comment "Part 2 of the Slc9a1 wiki.\\r\\n\\r\\nThe human SLC9A1 gene was cloned and mapped to human chromosome 1p Lifton et al., 1990.\\r\\n\\r\\nThe mouse Slc9a1 gene maps to chromosome 4. Morahan et al., 1993. There are three common alleles of Slc9a1, originally detected by RFLP analyses. Each of these allelic SLC9A1 proteins have different levels of antiporter activity. Morahan et al. 1994 Remarkably, intracellular pH varies between strains based on their Slc9a1 alleles. McClive et al. 1996."^^xsd:string ; dct:created "2011-06-10T12:06:30"^^xsd:datetime ; dct:references pubmed:094369 ; dct:references pubmed:8016086 ; dct:references pubmed:8550102 ; dct:creator gn:investigatorGrant_morahan_gem_waimr.uwa.edu.au ; gnt:belongsToCategory "Biochemistry" ; gnt:belongsToCategory "Genetic variation and alleles" ; gnt:belongsToCategory "Physiology and function" ; ] . ``` @@ -120,39 +96,34 @@ gn:generif_beb6fe8c-d5bc-36b7-9a9f-9030f19e605f dct:references pubmed:8550102 . The following SQL query was executed: ```sql -SELECT GeneRIF_BASIC.GeneId, GeneRIF_BASIC.VersionId, GeneRIF_BASIC.comment, GeneRIF_BASIC.symbol, GeneRIF_BASIC.createtime, GeneRIF_BASIC.comment, GeneRIF_BASIC.symbol, GROUP_CONCAT(PubMed_ID) AS pmids, GeneRIF_BASIC.VersionId, GeneRIF_BASIC.createtime FROM GeneRIF_BASIC GROUP BY GeneId, comment, createtime +SELECT GeneRIF_BASIC.symbol AS GeneRIFSymbol, GeneRIF_BASIC.comment, Species.Fullname AS SpeciesFullName, GeneRIF_BASIC.TaxID AS TaxonomicId, GeneRIF_BASIC.createtime AS EntryCreateTime, GeneRIF_BASIC.PubMed_ID AS PMID, GeneRIF_BASIC.GeneId, GeneRIF_BASIC.VersionId FROM GeneRIF_BASIC LEFT JOIN Species USING (SpeciesId) WHERE GeneRIF_BASIC.comment IS NOT NULL AND TRIM(GeneRIF_BASIC.comment) != '' AND TRIM(GeneRIF_BASIC.symbol) != '' GROUP BY GeneRIF_BASIC.comment, GeneRIF_BASIC.createtime, GeneRIF_BASIC.VersionId, GeneRIF_BASIC.SpeciesId, GeneRIF_BASIC.TaxID ``` The above query results to triples that have the form: ```text -gn:generif_d6552bcc-c798-34ab-a533-e23323255d1b -> rdf:type -> gnc:NCBIWikiEntry -gn:generif_d6552bcc-c798-34ab-a533-e23323255d1b -> rdfs:label -> "GeneRIF_BASIC(comment)"^^xsd:string -gn:generif_d6552bcc-c798-34ab-a533-e23323255d1b -> gnt:symbol -> GeneRIF_BASIC(symbol) -gn:generif_d6552bcc-c798-34ab-a533-e23323255d1b -> gnt:hasVersion -> GeneRIF_BASIC(VersionId) -gn:generif_d6552bcc-c798-34ab-a533-e23323255d1b -> dct:created -> -gn:generif_d6552bcc-c798-34ab-a533-e23323255d1b -> dct:references -> pubmed:pmids +gn:symbolGeneRIF_BASIC_GeneRIFSymbol_ -> rdfs:comment -> [ rdf:type gnc:NCBIWikiEntry ; rdfs:comment "GeneRIF_BASICcomment"^^xsd:string ; xkos:classifiedUnder gn:Species_speciesfullname ; skos:notation taxon:GeneRIF_BASIC(TaxonomicId) ; gnt:hasGeneId generif:GeneRIF_BASIC(GeneId) ; gnt:hasVersionId 'GeneRIF_BASIC(VersionId)'^^xsd:integer ; dct:references pubmed:GeneRIF_BASIC(PMID) ; ] ``` Here's an example query: ```sparql PREFIX rdf: PREFIX rdfs: +PREFIX skos: +PREFIX xkos: PREFIX gn: PREFIX gnc: PREFIX gnt: PREFIX dct: PREFIX foaf: PREFIX pubmed: -PREFIX ncbiTaxon: +PREFIX taxon: PREFIX generif: PREFIX xsd: PREFIX owl: SELECT * WHERE { - ?s rdf:type gnc:NCBIWikiEntry . - ?s rdfs:label #{"A1BG-cysteine-rich secretory protein 3 complex displays a similar function in protecting the circulation from a potentially harmful effect of free CRISP-3"^^xsd:string}# . - ?s gnt:symbol "A1BG" . + ?s rdfs:comment #{\x5b; rdf:type gnc:NCBIWikiEntry ; rdfs:comment "he results demonstrate that apoM-S1P inhibits ox-LDL-induced inflammation in HUVECs via the S1PR2-mediated PI3K/Akt signaling pathway."^^xsd:string ; xkos:classifiedUnder gn:Homo_sapiens ; skos:notation taxon:9606 ; gnt:hasGeneId generif:55937 ; gnt:hasVersionId '1'^^xsd:integer ; dct:created "2019-08-03T07:43:00"^^xsd:datetime ; \x5d;}# . ?s ?p ?o . } ``` @@ -160,11 +131,6 @@ SELECT * WHERE { Expected Result: ```rdf -gn:generif_fc8da76d-e68e-3622-b23a-d5a5daf06c99 rdf:type gnc:NCBIWikiEntry . -gn:generif_fc8da76d-e68e-3622-b23a-d5a5daf06c99 rdfs:label "A1BG-cysteine-rich secretory protein 3 complex displays a similar function in protecting the circulation from a potentially harmful effect of free CRISP-3"^^xsd:string . -gn:generif_fc8da76d-e68e-3622-b23a-d5a5daf06c99 gnt:symbol "A1BG" . -gn:generif_fc8da76d-e68e-3622-b23a-d5a5daf06c99 gnt:hasVersion "1" . -gn:generif_fc8da76d-e68e-3622-b23a-d5a5daf06c99 dct:created "2010-01-20T18:00:00"^^xsd:datetime . -gn:generif_fc8da76d-e68e-3622-b23a-d5a5daf06c99 dct:references pubmed:15461460 . +gn:symbolAPOM rdfs:comment [ rdf:type gnc:NCBIWikiEntry ; rdfs:comment "he results demonstrate that apoM-S1P inhibits ox-LDL-induced inflammation in HUVECs via the S1PR2-mediated PI3K/Akt signaling pathway."^^xsd:string ; xkos:classifiedUnder gn:Homo_sapiens ; skos:notation taxon:9606 ; gnt:hasGeneId generif:55937 ; gnt:hasVersionId '1'^^xsd:integer ; dct:created "2019-08-03T07:43:00"^^xsd:datetime ; ] . ``` diff --git a/rdf-documentation/genotype-metadata.md b/rdf-documentation/genotype-metadata.md index fc2682c..4ca1bd2 100644 --- a/rdf-documentation/genotype-metadata.md +++ b/rdf-documentation/genotype-metadata.md @@ -12,7 +12,7 @@ SELECT Geno.Name, Geno.Name, Geno.Chr, IFNULL(Geno.Mb, '') AS Mb, IFNULL(Geno.Mb The above query results to triples that have the form: ```text -gn:Geno_name_ -> rdf:type -> gnc:genotype +gn:Geno_name_ -> rdf:type -> gnc:Genotype gn:Geno_name_ -> skos:prefLabel -> GenoName gn:Geno_name_ -> gnt:chr -> Geno(Chr) gn:Geno_name_ -> gnt:mb -> "Mb"^^xsd:double @@ -39,7 +39,7 @@ PREFIX skos: PREFIX xsd: SELECT * WHERE { - ?s rdf:type gnc:genotype . + ?s rdf:type gnc:Genotype . ?s skos:prefLabel "D1Mit296" . ?s gnt:chr "1" . ?s gnt:mb #{"9.749729"^^xsd:double}# . @@ -50,7 +50,7 @@ SELECT * WHERE { Expected Result: ```rdf -gn:D1mit296 rdf:type gnc:genotype . +gn:D1mit296 rdf:type gnc:Genotype . gn:D1mit296 skos:prefLabel "D1Mit296" . gn:D1mit296 gnt:chr "1" . gn:D1mit296 gnt:mb "9.749729"^^xsd:double . diff --git a/rdf-documentation/phenotype-metadata.md b/rdf-documentation/phenotype-metadata.md index b673bb1..8a7e421 100644 --- a/rdf-documentation/phenotype-metadata.md +++ b/rdf-documentation/phenotype-metadata.md @@ -6,27 +6,27 @@ The following SQL query was executed: ```sql -SELECT CONCAT(IFNULL(InbredSet.Name, PublishXRef.InbredSetId), '_', PublishXRef.Id) AS Phenotype, InbredSet.Name, PublishXRef.Id, CONCAT(IFNULL(InbredSet.Name, PublishXRef.InbredSetId), '_', PublishXRef.Id) AS Phenotype, Phenotype.Post_publication_description, Phenotype.Post_publication_abbreviation, Phenotype.Lab_code, Phenotype.Submitter, Phenotype.Owner, IFNULL(PublishXRef.mean, '') AS mean, PublishXRef.Locus, IFNULL(PublishXRef.LRS, '') AS lrs, IFNULL(PublishXRef.additive, '') AS additive, PublishXRef.Sequence, IF(Publication.PubMed_ID IS NULL, '', CONVERT(Publication.PubMed_Id, INT)) AS pmid, Publication.Id FROM PublishXRef LEFT JOIN InbredSet ON InbredSet.InbredSetId = PublishXRef.InbredSetId LEFT JOIN Publication ON Publication.Id = PublishXRef.PublicationId LEFT JOIN Phenotype ON Phenotype.Id = PublishXRef.PhenotypeId WHERE PublishXRef.InbredSetId IN (SELECT PublishFreeze.InbredSetId FROM PublishFreeze) +SELECT CONCAT(IFNULL(InbredSet.Name, PublishXRef.InbredSetId), '_', PublishXRef.Id) AS Phenotype, InbredSet.Name AS InbredSetName, PublishXRef.Id, CONCAT(IFNULL(InbredSet.Name, PublishXRef.InbredSetId), '_', PublishXRef.Id) AS Phenotype, Phenotype.Post_publication_description, Phenotype.Post_publication_abbreviation, Phenotype.Lab_code, Phenotype.Submitter, Phenotype.Owner, IFNULL(PublishXRef.mean, '') AS mean, PublishXRef.Locus, IFNULL(PublishXRef.LRS, '') AS lrs, IFNULL(PublishXRef.additive, '') AS additive, PublishXRef.Sequence, IF(Publication.PubMed_ID IS NULL, '', CONVERT(Publication.PubMed_Id, INT)) AS pmid, Publication.Id FROM PublishXRef LEFT JOIN InbredSet ON InbredSet.InbredSetId = PublishXRef.InbredSetId LEFT JOIN Publication ON Publication.Id = PublishXRef.PublicationId LEFT JOIN Phenotype ON Phenotype.Id = PublishXRef.PhenotypeId WHERE PublishXRef.InbredSetId IN (SELECT PublishFreeze.InbredSetId FROM PublishFreeze) ``` The above query results to triples that have the form: ```text -gn:trait_phenotype -> rdf:type -> gnc:phenotype -gn:trait_phenotype -> gnt:belongsToSet -> gn:setInbredset_name -gn:trait_phenotype -> rdfs:label -> PublishXRef(Id) -gn:trait_phenotype -> skos:altLabel -> Phenotype -gn:trait_phenotype -> dct:description -> PhenotypePost_publication_description -gn:trait_phenotype -> gnt:abbreviation -> Phenotype(Post_publication_abbreviation) -gn:trait_phenotype -> gnt:labCode -> Phenotype(Lab_code) -gn:trait_phenotype -> gnt:submitter -> PhenotypeSubmitter -gn:trait_phenotype -> gnt:mean -> "mean"^^xsd:double -gn:trait_phenotype -> gnt:locus -> PublishXRef(Locus) -gn:trait_phenotype -> gnt:LRS -> "lrs"^^xsd:double -gn:trait_phenotype -> gnt:additive -> "additive"^^xsd:double -gn:trait_phenotype -> gnt:sequence -> "PublishXRef(Sequence)"^^xsd:integer -gn:trait_phenotype -> dct:isReferencedBy -> pubmed:pmid -gn:trait_phenotype -> dct:contributor -> PhenotypeOwner +gn:traitPhenotype -> rdf:type -> gnc:Phenotype +gn:traitPhenotype -> xkos:classifiedUnder -> gn:setInbredset_inbredsetname +gn:traitPhenotype -> rdfs:label -> PublishXRef(Id) +gn:traitPhenotype -> skos:altLabel -> Phenotype +gn:traitPhenotype -> dct:description -> PhenotypePost_publication_description +gn:traitPhenotype -> gnt:abbreviation -> Phenotype(Post_publication_abbreviation) +gn:traitPhenotype -> gnt:labCode -> Phenotype(Lab_code) +gn:traitPhenotype -> gnt:submitter -> PhenotypeSubmitter +gn:traitPhenotype -> gnt:mean -> "mean"^^xsd:double +gn:traitPhenotype -> gnt:locus -> PublishXRef(Locus) +gn:traitPhenotype -> gnt:LRS -> "lrs"^^xsd:double +gn:traitPhenotype -> gnt:additive -> "additive"^^xsd:double +gn:traitPhenotype -> gnt:sequence -> "PublishXRef(Sequence)"^^xsd:integer +gn:traitPhenotype -> dct:isReferencedBy -> pubmed:pmid +gn:traitPhenotype -> dct:contributor -> PhenotypeOwner ``` Here's an example query: @@ -36,15 +36,17 @@ PREFIX gn: PREFIX owl: PREFIX gnc: PREFIX gnt: +PREFIX sdmx-measure: PREFIX skos: PREFIX rdf: PREFIX rdfs: PREFIX xsd: +PREFIX qb: PREFIX pubmed: SELECT * WHERE { - ?s rdf:type gnc:phenotype . - ?s gnt:belongsToSet gn:setBxd . + ?s rdf:type gnc:Phenotype . + ?s xkos:classifiedUnder gn:setBxd . ?s rdfs:label "10001" . ?s skos:altLabel "BXD_10001" . ?s ?p ?o . @@ -54,18 +56,18 @@ SELECT * WHERE { Expected Result: ```rdf -gn:trait_bxd_10001 rdf:type gnc:phenotype . -gn:trait_bxd_10001 gnt:belongsToSet gn:setBxd . -gn:trait_bxd_10001 rdfs:label "10001" . -gn:trait_bxd_10001 skos:altLabel "BXD_10001" . -gn:trait_bxd_10001 dct:description "Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg]" . -gn:trait_bxd_10001 gnt:abbreviation "CBLWT2" . -gn:trait_bxd_10001 gnt:submitter "robwilliams" . -gn:trait_bxd_10001 gnt:mean "52.13529418496525"^^xsd:double . -gn:trait_bxd_10001 gnt:locus "rs48756159" . -gn:trait_bxd_10001 gnt:LRS "13.4974911471087"^^xsd:double . -gn:trait_bxd_10001 gnt:additive "2.39444435069444"^^xsd:double . -gn:trait_bxd_10001 gnt:sequence "1"^^xsd:integer . -gn:trait_bxd_10001 dct:isReferencedBy pubmed:11438585 . +gn:traitBxd_10001 rdf:type gnc:Phenotype . +gn:traitBxd_10001 xkos:classifiedUnder gn:setBxd . +gn:traitBxd_10001 rdfs:label "10001" . +gn:traitBxd_10001 skos:altLabel "BXD_10001" . +gn:traitBxd_10001 dct:description "Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg]" . +gn:traitBxd_10001 gnt:abbreviation "CBLWT2" . +gn:traitBxd_10001 gnt:submitter "robwilliams" . +gn:traitBxd_10001 gnt:mean "52.13529418496525"^^xsd:double . +gn:traitBxd_10001 gnt:locus "rs48756159" . +gn:traitBxd_10001 gnt:LRS "13.4974911471087"^^xsd:double . +gn:traitBxd_10001 gnt:additive "2.39444435069444"^^xsd:double . +gn:traitBxd_10001 gnt:sequence "1"^^xsd:integer . +gn:traitBxd_10001 dct:isReferencedBy pubmed:11438585 . ``` diff --git a/rdf-documentation/probeset-metadata.md b/rdf-documentation/probeset-metadata.md index 2387145..cde4e43 100644 --- a/rdf-documentation/probeset-metadata.md +++ b/rdf-documentation/probeset-metadata.md @@ -12,32 +12,32 @@ SELECT IF(NULLIF(TRIM(ProbeSet.Name), '') IS NULL, '', TRIM(ProbeSet.Name)) AS P The above query results to triples that have the form: ```text -gn:probeset_probesetidname -> rdf:type -> gnc:probeset -gn:probeset_probesetidname -> rdfs:label -> ProbeSet(Name) -gn:probeset_probesetidname -> skos:altLabel -> ProbeSet(alias) -gn:probeset_probesetidname -> gnt:hasChip -> gn:platform_genechipname -gn:probeset_probesetidname -> gnt:hasTargetId -> TargetId -gn:probeset_probesetidname -> gnt:symbol -> ProbeSet(Symbol) -gn:probeset_probesetidname -> dct:description -> ProbeSetdescription -gn:probeset_probesetidname -> gnt:targetsRegion -> Probe_set_target_region -gn:probeset_probesetidname -> gnt:chr -> ProbeSet(Chr) -gn:probeset_probesetidname -> gnt:mb -> "Mb"^^xsd:double -gn:probeset_probesetidname -> gnt:mbMm8 -> "Mb_mm8"^^xsd:double -gn:probeset_probesetidname -> gnt:mb2016 -> "Mb_2016"^^xsd:double -gn:probeset_probesetidname -> gnt:hasSpecificity -> Probe_set_specificity -gn:probeset_probesetidname -> gnt:hasBlatScore -> Probe_set_BLAT_score -gn:probeset_probesetidname -> gnt:hasBlatMbStart -> "Probe_set_Blat_Mb_start"^^xsd:double -gn:probeset_probesetidname -> gnt:hasBlatMbStart2016 -> "Probe_set_Blat_Mb_start_2016"^^xsd:double -gn:probeset_probesetidname -> gnt:hasBlatMbEnd -> "Probe_set_Blat_Mb_end"^^xsd:double -gn:probeset_probesetidname -> gnt:hasBlatMbEnd2016 -> "Probe_set_Blat_Mb_start_2016"^^xsd:double -gn:probeset_probesetidname -> gnt:hasBlatSeq -> ProbeSetBlatSeq -gn:probeset_probesetidname -> gnt:hasTargetSeq -> ProbeSetTargetSeq -gn:probeset_probesetidname -> gnt:hasHomologeneId -> homologene:HomoloGeneID -gn:probeset_probesetidname -> gnt:hasUniprotId -> uniprot:UniProtID -gn:probeset_probesetidname -> gnt:hasPubChemId -> pubchem:PubChem_ID -gn:probeset_probesetidname -> gnt:hasKeggId -> kegg:KEGG_ID -gn:probeset_probesetidname -> gnt:hasOmimId -> -gn:probeset_probesetidname -> gnt:hasChebiId -> chebi:ChEBI_ID +gn:probesetProbesetidname -> rdf:type -> gnc:Probeset +gn:probesetProbesetidname -> rdfs:label -> ProbeSet(Name) +gn:probesetProbesetidname -> skos:altLabel -> ProbeSet(alias) +gn:probesetProbesetidname -> gnt:hasChip -> gn:platformGenechipname +gn:probesetProbesetidname -> gnt:hasTargetId -> TargetId +gn:probesetProbesetidname -> gnt:symbol -> ProbeSet(Symbol) +gn:probesetProbesetidname -> dct:description -> ProbeSetdescription +gn:probesetProbesetidname -> gnt:targetsRegion -> Probe_set_target_region +gn:probesetProbesetidname -> gnt:chr -> ProbeSet(Chr) +gn:probesetProbesetidname -> gnt:mb -> "Mb"^^xsd:double +gn:probesetProbesetidname -> gnt:mbMm8 -> "Mb_mm8"^^xsd:double +gn:probesetProbesetidname -> gnt:mb2016 -> "Mb_2016"^^xsd:double +gn:probesetProbesetidname -> gnt:hasSpecificity -> Probe_set_specificity +gn:probesetProbesetidname -> gnt:hasBlatScore -> Probe_set_BLAT_score +gn:probesetProbesetidname -> gnt:hasBlatMbStart -> "Probe_set_Blat_Mb_start"^^xsd:double +gn:probesetProbesetidname -> gnt:hasBlatMbStart2016 -> "Probe_set_Blat_Mb_start_2016"^^xsd:double +gn:probesetProbesetidname -> gnt:hasBlatMbEnd -> "Probe_set_Blat_Mb_end"^^xsd:double +gn:probesetProbesetidname -> gnt:hasBlatMbEnd2016 -> "Probe_set_Blat_Mb_start_2016"^^xsd:double +gn:probesetProbesetidname -> gnt:hasBlatSeq -> ProbeSetBlatSeq +gn:probesetProbesetidname -> gnt:hasTargetSeq -> ProbeSetTargetSeq +gn:probesetProbesetidname -> gnt:hasHomologeneId -> homologene:HomoloGeneID +gn:probesetProbesetidname -> gnt:hasUniprotId -> uniprot:UniProtID +gn:probesetProbesetidname -> gnt:hasPubChemId -> pubchem:PubChem_ID +gn:probesetProbesetidname -> gnt:hasKeggId -> kegg:KEGG_ID +gn:probesetProbesetidname -> gnt:hasOmimId -> +gn:probesetProbesetidname -> gnt:hasChebiId -> chebi:ChEBI_ID ``` Here's an example query: @@ -57,13 +57,15 @@ PREFIX dct: PREFIX owl: PREFIX homologene: PREFIX xsd: +PREFIX qb: +PREFIX sdmx-measure: PREFIX skos: SELECT * WHERE { - ?s rdf:type gnc:probeset . + ?s rdf:type gnc:Probeset . ?s rdfs:label "100001_at" . ?s skos:altLabel "T3g; Ctg3; Ctg-3" . - ?s gnt:hasChip gn:platform_mg_u74av2 . + ?s gnt:hasChip gn:platformMg_u74av2 . ?s ?p ?o . } ``` @@ -71,25 +73,25 @@ SELECT * WHERE { Expected Result: ```rdf -gn:probeset_100001_at rdf:type gnc:probeset . -gn:probeset_100001_at rdfs:label "100001_at" . -gn:probeset_100001_at skos:altLabel "T3g; Ctg3; Ctg-3" . -gn:probeset_100001_at gnt:hasChip gn:platform_mg_u74av2 . -gn:probeset_100001_at gnt:symbol "Cd3g" . -gn:probeset_100001_at dct:description "CD3d antigen, gamma polypeptide" . -gn:probeset_100001_at gnt:chr "9" . -gn:probeset_100001_at gnt:mb "44.970689"^^xsd:double . -gn:probeset_100001_at gnt:mbMm8 "44.721684"^^xsd:double . -gn:probeset_100001_at gnt:mb2016 "44.778772"^^xsd:double . -gn:probeset_100001_at gnt:hasSpecificity "9.3" . -gn:probeset_100001_at gnt:hasBlatScore "186" . -gn:probeset_100001_at gnt:hasBlatMbStart "44.970689"^^xsd:double . -gn:probeset_100001_at gnt:hasBlatMbStart2016 "44.778772"^^xsd:double . -gn:probeset_100001_at gnt:hasBlatMbEnd "44.971291"^^xsd:double . -gn:probeset_100001_at gnt:hasBlatMbEnd2016 "44.778772"^^xsd:double . -gn:probeset_100001_at gnt:hasBlatSeq "CTCTGTTGCAAAATGAACAGCTGTACAGCCCCTCAAGGACCGGGAATATGACCAGTACAGCCATCTCCAAGGAAACCAACTGAGGAAGAAGTGAACTCAGCAGGACTCAGGGTGTCCCCACAATGCATTTTGGAGAGAGCCCAGACTGCAAGCAGAGAGGAAGAACTGAGGAAAACAAGCACAGCGTGGTGTT" . -gn:probeset_100001_at gnt:hasTargetSeq "ctctgttgcaaaatgaacagctgtaccagcccctcaaggaccgggaatatgaccagtacagccatctccaaggaaaccaactgaggaagaagtgaactcagcaggactcagggtgtccccccttntatccagcacccagaatcaaaacaatgcattttggagagagcccagtagagagattttcaaccctacaggtagactgcaagcagagaggaagaactgtcaaagaaattttggtcttttttttttttttnncaaaataaaataaaagcttggaggagccagtggtatgantnnnnnntgnancanttgtcaaccttgtttggggttnncagcaccccacccccagaccccccaaaaaaattcagtgaaggaaaacaagcacagcgtggtgtt" . -gn:probeset_100001_at gnt:hasHomologeneId homologene:55 . -gn:probeset_100001_at gnt:hasOmimId omim:186740 . +gn:probeset100001_at rdf:type gnc:Probeset . +gn:probeset100001_at rdfs:label "100001_at" . +gn:probeset100001_at skos:altLabel "T3g; Ctg3; Ctg-3" . +gn:probeset100001_at gnt:hasChip gn:platformMg_u74av2 . +gn:probeset100001_at gnt:symbol "Cd3g" . +gn:probeset100001_at dct:description "CD3d antigen, gamma polypeptide" . +gn:probeset100001_at gnt:chr "9" . +gn:probeset100001_at gnt:mb "44.970689"^^xsd:double . +gn:probeset100001_at gnt:mbMm8 "44.721684"^^xsd:double . +gn:probeset100001_at gnt:mb2016 "44.778772"^^xsd:double . +gn:probeset100001_at gnt:hasSpecificity "9.3" . +gn:probeset100001_at gnt:hasBlatScore "186" . +gn:probeset100001_at gnt:hasBlatMbStart "44.970689"^^xsd:double . +gn:probeset100001_at gnt:hasBlatMbStart2016 "44.778772"^^xsd:double . +gn:probeset100001_at gnt:hasBlatMbEnd "44.971291"^^xsd:double . +gn:probeset100001_at gnt:hasBlatMbEnd2016 "44.778772"^^xsd:double . +gn:probeset100001_at gnt:hasBlatSeq "CTCTGTTGCAAAATGAACAGCTGTACAGCCCCTCAAGGACCGGGAATATGACCAGTACAGCCATCTCCAAGGAAACCAACTGAGGAAGAAGTGAACTCAGCAGGACTCAGGGTGTCCCCACAATGCATTTTGGAGAGAGCCCAGACTGCAAGCAGAGAGGAAGAACTGAGGAAAACAAGCACAGCGTGGTGTT" . +gn:probeset100001_at gnt:hasTargetSeq "ctctgttgcaaaatgaacagctgtaccagcccctcaaggaccgggaatatgaccagtacagccatctccaaggaaaccaactgaggaagaagtgaactcagcaggactcagggtgtccccccttntatccagcacccagaatcaaaacaatgcattttggagagagcccagtagagagattttcaaccctacaggtagactgcaagcagagaggaagaactgtcaaagaaattttggtcttttttttttttttnncaaaataaaataaaagcttggaggagccagtggtatgantnnnnnntgnancanttgtcaaccttgtttggggttnncagcaccccacccccagaccccccaaaaaaattcagtgaaggaaaacaagcacagcgtggtgtt" . +gn:probeset100001_at gnt:hasHomologeneId homologene:55 . +gn:probeset100001_at gnt:hasOmimId omim:186740 . ``` diff --git a/rdf-documentation/publication-metadata.md b/rdf-documentation/publication-metadata.md index 018f6da..c4262dc 100644 --- a/rdf-documentation/publication-metadata.md +++ b/rdf-documentation/publication-metadata.md @@ -46,6 +46,6 @@ SELECT * WHERE { Expected Result: ```rdf -gn:unpublished_1 rdf:type fabio:ResearchPaper . +gn:unpublished1 rdf:type fabio:ResearchPaper . ``` diff --git a/rdf-documentation/strains.md b/rdf-documentation/strains.md new file mode 100644 index 0000000..4ecb12f --- /dev/null +++ b/rdf-documentation/strains.md @@ -0,0 +1,138 @@ +# Species Metadata +## 'strain' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT Strain.Name, Species.Fullname, Strain.Name, IF ((Strain.Name2 != Strain.Name), Strain.Name2, '') AS Name2, IF ((Strain.Alias != Strain.Name), Strain.Alias, '') AS Alias, IF ((Strain.Symbol != Strain.Name), Strain.Symbol, '') AS Symbol FROM Strain LEFT JOIN Species ON Strain.SpeciesId = Species.SpeciesId +``` + +The above query results to triples that have the form: + +```text +gn:Strain_name_ -> rdf:type -> gnc:strain +gn:Strain_name_ -> xkos:classifiedUnder -> gn:Species_fullname +gn:Strain_name_ -> rdfs:label -> StrainName +gn:Strain_name_ -> skos:altLabel -> Name2 +gn:Strain_name_ -> gnt:alias -> Alias +gn:Strain_name_ -> gnt:symbol -> Symbol +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX gnc: +PREFIX owl: +PREFIX gnt: +PREFIX skos: +PREFIX xkos: +PREFIX rdf: +PREFIX rdfs: +PREFIX taxon: + +SELECT * WHERE { + ?s rdf:type gnc:strain . + ?s xkos:classifiedUnder gn:Mus_musculus . + ?s rdfs:label "B6D2F1" . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gn:B6d2f1 rdf:type gnc:strain . +gn:B6d2f1 xkos:classifiedUnder gn:Mus_musculus . +gn:B6d2f1 rdfs:label "B6D2F1" . +``` + + +## 'mapping-method' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT MappingMethod.Name, MappingMethod.Name FROM MappingMethod +``` + +The above query results to triples that have the form: + +```text +gn:mappingMethodMappingmethod_name -> rdf:type -> gnc:mappingMethod +gn:mappingMethodMappingmethod_name -> rdfs:label -> MappingMethod(Name) +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX gnc: +PREFIX owl: +PREFIX gnt: +PREFIX skos: +PREFIX xkos: +PREFIX rdf: +PREFIX rdfs: +PREFIX taxon: + +SELECT * WHERE { + ?s rdf:type gnc:mappingMethod . + ?s rdfs:label "qtlreaper" . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gn:mappingMethodQtlreaper rdf:type gnc:mappingMethod . +gn:mappingMethodQtlreaper rdfs:label "qtlreaper" . +``` + + +## 'avg-method' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT AvgMethod.Name, AvgMethod.Normalization FROM AvgMethod +``` + +The above query results to triples that have the form: + +```text +gn:avgMethodAvgmethod_name -> rdf:type -> gnc:avgMethod +gn:avgMethodAvgmethod_name -> rdfs:label -> AvgMethod(Normalization) +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX gnc: +PREFIX owl: +PREFIX gnt: +PREFIX skos: +PREFIX xkos: +PREFIX rdf: +PREFIX rdfs: +PREFIX taxon: + +SELECT * WHERE { + ?s rdf:type gnc:avgMethod . + ?s rdfs:label "MAS5" . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gn:avgMethodMas5 rdf:type gnc:avgMethod . +gn:avgMethodMas5 rdfs:label "MAS5" . +``` + diff --git a/rdf-documentation/tissue-metadata.md b/rdf-documentation/tissue-metadata.md index 3c4fae9..37145c4 100644 --- a/rdf-documentation/tissue-metadata.md +++ b/rdf-documentation/tissue-metadata.md @@ -12,8 +12,8 @@ SELECT Tissue.Short_Name, Tissue.Name FROM Tissue The above query results to triples that have the form: ```text -gn:tissue_tissue_short_name -> rdf:type -> gnc:tissue -gn:tissue_tissue_short_name -> rdfs:label -> Tissue(Name) +gn:tissueTissue_short_name -> rdf:type -> gnc:tissue +gn:tissueTissue_short_name -> rdfs:label -> Tissue(Name) ``` Here's an example query: @@ -35,7 +35,7 @@ SELECT * WHERE { Expected Result: ```rdf -gn:tissue_brn rdf:type gnc:tissue . -gn:tissue_brn rdfs:label "Brain mRNA" . +gn:tissueBrn rdf:type gnc:tissue . +gn:tissueBrn rdfs:label "Brain mRNA" . ``` -- cgit v1.2.3