From e42749edb171151665093db8345a9052d680f016 Mon Sep 17 00:00:00 2001 From: Munyoki Kilyungi Date: Fri, 12 Apr 2024 13:27:06 +0300 Subject: Update RDF documentation. Signed-off-by: Munyoki Kilyungi --- rdf-documentation/dataset-metadata.md | 53 ++++----- rdf-documentation/genelist.md | 193 +++++++++++++++++++++++++++++++++ rdf-documentation/probeset-metadata.md | 76 ++----------- rdf-documentation/strains.md | 4 +- 4 files changed, 226 insertions(+), 100 deletions(-) create mode 100644 rdf-documentation/genelist.md diff --git a/rdf-documentation/dataset-metadata.md b/rdf-documentation/dataset-metadata.md index d5f4f2b..e918653 100644 --- a/rdf-documentation/dataset-metadata.md +++ b/rdf-documentation/dataset-metadata.md @@ -6,7 +6,7 @@ The following SQL query was executed: ```sql -SELECT InfoFiles.InfoPageName, IF(GenoFreeze.Id IS NOT NULL, 'gnc:Genotype', IF(PublishFreeze.Id IS NOT NULL, 'gnc:Phenotype', IF(ProbeSetFreeze.Name IS NOT NULL, 'gnc:Probeset', ''))) AS DatasetType, InfoFiles.InfoPageName, IFNULL(GenoFreeze.FullName, IFNULL(PublishFreeze.FullName, '')) AS DatasetFullName, Datasets.DatasetName AS DatasetGroup, Datasets.PublicationTitle, InfoFiles.InfoFileTitle, IFNULL(GenoFreeze.CreateTime, IFNULL(PublishFreeze.CreateTime, IFNULL(ProbeSetFreeze.CreateTime, ''))) AS createTimeGenoFreeze, Investigators.FirstName, Investigators.LastName, Investigators.Email, Organizations.OrganizationName, InfoFiles.GN_AccesionId, DatasetStatus.DatasetStatusName, IFNULL(InbredSet.Name, IFNULL(PublishInbredSet.Name, GenoInbredSet.Name)) AS InbredSetName, Tissue.Short_Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS AvgMethodName, GeneChip.Name AS GeneChip, Datasets.Summary, IFNULL(Datasets.GeoSeries, '') AS GeoSeries, Datasets.AboutTissue, InfoFiles.Specifics, Datasets.AboutCases, Datasets.AboutPlatform, Datasets.AboutDataProcessing, Datasets.Notes, Datasets.ExperimentDesign, Datasets.Contributors, Datasets.Citation, Datasets.Acknowledgment FROM InfoFiles LEFT JOIN PublishFreeze ON InfoFiles.InfoPageName = PublishFreeze.Name LEFT JOIN GenoFreeze ON InfoFiles.InfoPageName = GenoFreeze.Name LEFT JOIN ProbeSetFreeze ON InfoFiles.InfoPageName = ProbeSetFreeze.Name LEFT JOIN InbredSet ON InfoFiles.InbredSetId = InbredSet.InbredSetId LEFT JOIN Species ON InfoFiles.SpeciesId = Species.SpeciesId LEFT JOIN Datasets USING (DatasetId) LEFT JOIN DatasetStatus USING (DatasetStatusId) LEFT JOIN Tissue USING (TissueId) LEFT JOIN Investigators USING (InvestigatorId) LEFT JOIN AvgMethod USING (AvgMethodId) LEFT JOIN Organizations USING (OrganizationId) LEFT JOIN GeneChip USING (GeneChipId) LEFT JOIN InbredSet PublishInbredSet ON PublishFreeze.InbredSetId = PublishInbredSet.InbredSetId LEFT JOIN InbredSet GenoInbredSet ON GenoFreeze.InbredSetId = GenoInbredSet.InbredSetId WHERE GN_AccesionId IS NOT NULL +SELECT InfoFiles.InfoPageName, IF(GenoFreeze.Id IS NOT NULL, 'gnc:Genotype', IF(PublishFreeze.Id IS NOT NULL, 'gnc:Phenotype', IF(ProbeSetFreeze.Name IS NOT NULL, 'gnc:Probeset', ''))) AS DatasetType, InfoFiles.InfoPageName, IFNULL(GenoFreeze.FullName, IFNULL(PublishFreeze.FullName, '')) AS DatasetFullName, Datasets.DatasetName AS DatasetGroup, Datasets.PublicationTitle, InfoFiles.InfoFileTitle, IFNULL(GenoFreeze.CreateTime, IFNULL(PublishFreeze.CreateTime, IFNULL(ProbeSetFreeze.CreateTime, ''))) AS createTimeGenoFreeze, Investigators.FirstName, Investigators.LastName, Investigators.Email, Organizations.OrganizationName, InfoFiles.GN_AccesionId, DatasetStatus.DatasetStatusName, IFNULL(InbredSet.Name, IFNULL(PublishInbredSet.Name, GenoInbredSet.Name)) AS InbredSetName, Tissue.Short_Name, AvgMethod.Name AS AvgMethodName, AvgMethod.Name AS AvgMethodName, GeneChip.Name AS GeneChip, IFNULL(Datasets.GeoSeries, '') AS GeoSeries FROM InfoFiles LEFT JOIN PublishFreeze ON InfoFiles.InfoPageName = PublishFreeze.Name LEFT JOIN GenoFreeze ON InfoFiles.InfoPageName = GenoFreeze.Name LEFT JOIN ProbeSetFreeze ON InfoFiles.InfoPageName = ProbeSetFreeze.Name LEFT JOIN InbredSet ON InfoFiles.InbredSetId = InbredSet.InbredSetId LEFT JOIN Species ON InfoFiles.SpeciesId = Species.SpeciesId LEFT JOIN Datasets USING (DatasetId) LEFT JOIN DatasetStatus USING (DatasetStatusId) LEFT JOIN Tissue USING (TissueId) LEFT JOIN Investigators USING (InvestigatorId) LEFT JOIN AvgMethod USING (AvgMethodId) LEFT JOIN Organizations USING (OrganizationId) LEFT JOIN GeneChip USING (GeneChipId) LEFT JOIN InbredSet PublishInbredSet ON PublishFreeze.InbredSetId = PublishInbredSet.InbredSetId LEFT JOIN InbredSet GenoInbredSet ON GenoFreeze.InbredSetId = GenoInbredSet.InbredSetId WHERE GN_AccesionId IS NOT NULL ``` The above query results to triples that have the form: @@ -27,18 +27,7 @@ gn:Infofiles_infopagename_ -> gnt:belongsToGroup -> gn:setInbredsetname gn:Infofiles_infopagename_ -> gnt:hasTissue -> gn:tissueTissue_short_name gn:Infofiles_infopagename_ -> gnt:usesNormalization -> gn:avgMethodAvgmethod_avgmethodname gn:Infofiles_infopagename_ -> gnt:usesPlatform -> gn:platformGenechip_genechip -gn:Infofiles_infopagename_ -> dct:description -> DatasetsSummary gn:Infofiles_infopagename_ -> gnt:hasGeoSeriesId -> -gn:Infofiles_infopagename_ -> gnt:hasTissueInfo -> DatasetsAboutTissue -gn:Infofiles_infopagename_ -> gnt:hasContentInfo -> InfoFilesSpecifics -gn:Infofiles_infopagename_ -> gnt:hasCaseInfo -> DatasetsAboutCases -gn:Infofiles_infopagename_ -> gnt:hasPlatformInfo -> DatasetsAboutPlatform -gn:Infofiles_infopagename_ -> gnt:hasDataProcessingInfo -> DatasetsAboutDataProcessing -gn:Infofiles_infopagename_ -> gnt:hasNotes -> DatasetsNotes -gn:Infofiles_infopagename_ -> gnt:hasExperimentDesignInfo -> DatasetsExperimentDesign -gn:Infofiles_infopagename_ -> dct:creator -> DatasetsContributors -gn:Infofiles_infopagename_ -> dct:isReferencedBy -> DatasetsCitation -gn:Infofiles_infopagename_ -> gnt:hasAcknowledgement -> DatasetsAcknowledgment ``` Here's an example query: @@ -61,8 +50,9 @@ PREFIX dct: SELECT * WHERE { ?s rdf:type dcat:Dataset . - ?s xkos:classifiedUnder gnc:Probeset . - ?s rdfs:label "Br_U_0803_M" . + ?s xkos:classifiedUnder gnc:Phenotype . + ?s rdfs:label "GITrMetPublish" . + ?s skos:prefLabel "GI Tract Metagenome Phenotypes" . ?s ?p ?o . } ``` @@ -70,26 +60,21 @@ SELECT * WHERE { Expected Result: ```rdf -gn:Br_u_0803_m rdf:type dcat:Dataset . -gn:Br_u_0803_m xkos:classifiedUnder gnc:Probeset . -gn:Br_u_0803_m rdfs:label "Br_U_0803_M" . -gn:Br_u_0803_m skos:altLabel "UTHSC Brain mRNA U74Av2 (Aug-Sep03)" . -gn:Br_u_0803_m dct:created "2003-08-01" . -gn:Br_u_0803_m dcat:contactPoint gn:investigatorRobert_williams_rwilliams_uthsc.edu . -gn:Br_u_0803_m foaf:Organization "University of Tennessee Health Science Center" . -gn:Br_u_0803_m dct:identifier "GN1" . -gn:Br_u_0803_m dct:accessRights "public" . -gn:Br_u_0803_m gnt:belongsToGroup gn:setBxd . -gn:Br_u_0803_m gnt:hasTissue gn:tissueBrn . -gn:Br_u_0803_m gnt:usesNormalization gn:avgMethodMas5 . -gn:Br_u_0803_m gnt:usesPlatform gn:platformMg_u74av2 . -gn:Br_u_0803_m dct:description "

This August 2003 freeze provides estimates of mRNA expression in brains of BXD recombinant inbred mice measured using Affymetrix U74Av2 microarrays. This is data set includes six arrays which are of marginal quality. New users are encouraged to use one of the more recent data sets December 2003 or March 2004 from which these six arrays have been excluded. Data were generated at the University of Tennessee Health Science Center UTHSC. Over 300 brain samples from 35 strains were hybridized in small pools n=3 to 106 arrays. Data were processed using the Microarray Suite 5 MAS 5 protocol of Affymetrix. To simplify comparison between transforms, MAS 5 values of each array were adjusted to an average of 8 units and a variance of 2 units. In general, the MAS 5 transform does not perform as well as RMA, PDNN, or the new heritability weighted transforms HW1PM.

" . -gn:Br_u_0803_m gnt:hasTissueInfo "

Each array was hybridized with labeled cRNA generated from a pool of three brains from adult animals usually of the same age and always of the same sex. The brain region included most of the forebrain and midbrain, bilaterally. However, the sample excluded the olfactory bulbs, retinas, or the posterior pituitary all formally part of the forebrain. A total of 100 such pooled samples were arrayed: 74 from females and 26 from males. Animals ranged in age from 56 to 441 days, usually with a balanced design: one pool at approximately 8 weeks, one pool at approximately 20 weeks, and one pool at approximately 1 year. Strain averages of mRNA expression level are therefore typically based on three pooled biological replicate arrays. This data set does not incorporate statistical adjustment for possible effects of age and sex. Users can select the strain symbol in the table above to review details about the specific cases and array processing center DP = Divyen Patel at Genome Explorations, Inc; TS = Thomas Sutter at University of Memphis. You can also click on the individual symbols males or females to view the array image.

" . -gn:Br_u_0803_m gnt:hasCaseInfo "

This data set includes estimate of gene expression for 35 genetically uniform lines of mice: C57BL/6J B6, or simply B, DBA/2J D2 or D, their B6D2 F1 intercross, and 32 BXD recombinant inbred RI strains derived by crossing female B6 mice with male D2 mice and then inbreeding progeny for over 21 generations. This set of RI strains is a remarkable resource because many of these strains have been extensively phenotyped for hundreds of interesting traits over a 25-year period. A significant advantage of this RI set is that the two parental strains B6 and D2 have both been extensively sequenced and are known to differ at approximately 1.8 million SNPs. Coding variants mostly single nucleotide polymorphisms and insertion-deletions that may produce interesting phenotypes can be rapidly identified in this particular RI set.

\r\n\r\n

BXD1 through BXD32 were produced by Benjamin A. Taylor starting in the late 1970s. BXD33 through BXD42 were also produced by Taylor, but from a second set of crosses initiated in the early 1990s. These strains are all available from the Jackson Laboratory, Bar Harbor, Maine. BXD43 through BXD99 were produced by Lu Lu, Jeremy Peirce, Lee M. Silver, and Robert W. Williams in the late 1990s and early 2000s using advanced intercross progeny Peirce et al. 2004. Only two of these incipient strains are included in the current database BXD67 and BXD68.

\r\n\r\n

In this mRNA expression database we generally used progeny of stock obtained from The Jackson Laboratory between 1999 and 2001. Animals were generated in-house at the University of Alabama by John Mountz and Hui-Chen Hsu and at the University of Tennessee Health Science Center by Lu Lu and Robert Williams.

\r\n\r\n

The table below lists the arrays by strain, sex, and age. Each array was hybridized to a pool of mRNA from three mice. Note that this table includes six arrays dropped from the December 2003 data sets BXD6, n=2; BXD12, BXD16, BXD40, and BXD67, n=1 each.

\r\n\r\n\r\n \r\n \r\n \r\n \r\n \r\n
\r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n \r\n
Strain\r\n

Age

\r\n
Strain\r\n

Age

\r\n
\r\n

8 Wks

\r\n
\r\n

20 Wks

\r\n
\r\n

52 Wks

\r\n
\r\n

8 Wks

\r\n
\r\n

20 Wks

\r\n
\r\n

52 Wks

\r\n
C57BL/6J B6♂♂♂♀♀DBA/2J D2♀♀♂♂ 
B6D2F1 F1♀ ♀♀ BXD1♀♀ â™€
BXD2♂♀♀BXD5♂♂♀  
BXD6♀♀♀BXD8♀♂♀ 
BXD9♂♀♀BXD11♀♀ â™€
BXD12 â™‚♀♀BXD13♀   
BXD14 â™€â™€â™€BXD15♀ â™€
BXD16♀♀♀ BXD18♀♂♀
BXD19♀♀♀BXD21♀♀♂♂ 
BXD22♀♀♀ BXD23♀  
BXD24♀♀ â™€BXD25♀♀ ♀♀  
BXD27  â™€â™€BXD28♀♀♀
BXD29♂ â™€BXD31♀♀♀♀ 
BXD32♀♂♀♀BXD33♂♀♀ 
BXD34♂♀♀ BXD38♂♀♀  
BXD39♂♀ ♂ BXD40♂♂♀♀  
BXD42♂♂ ♀  BXD67 F8♀ ♀♂  
BXD68 F9♀ ♀♂     
\r\n
" . -gn:Br_u_0803_m gnt:hasPlatformInfo "

Affymetrix U74Av2 GeneChip: The expression data were generated using 100 U74Av2 arrays. The chromosomal locations of U74Av2 probe sets were determined by BLAT analysis of concatenated probe sequences using the Mouse Genome Sequencing Consortium May 2004 mm5 assembly. This BLAT analysis is performed periodically by Yanhua Qu as each new build of the mouse genome is released see http://genome.ucsc.edu/cgi-bin/hgBlat?command=start&org=mouse. We thank Yan Cui UTHSC for allowing us to use his Linux cluster to perform this analysis. It is possiible to confirm the BLAT alignment results yourself simply by clicking on the Verify link in the Trait Data and Editing Form right side of the Location line.

" . -gn:Br_u_0803_m gnt:hasDataProcessingInfo "
Probe cell level data from the CEL file: Probe signal intensity estimates in the Affymetrix CEL files are the 75% quantile value taken from a set of 36 6x6 pixels per probe cell in the DAT image file.\r\n
    \r\n
  • Step 1: We added an offset of 1.0 to the CEL expression values for each cell to ensure that all values could be logged without generating negative values.
  • \r\n
  • Step 2: We took the log2 of each cell signal intensity.
  • \r\n
  • Step 3: We computed the Z score for each of these log2 cell signal intensity values within a single array.
  • \r\n
  • Step 4: We multiplied all Z scores by 2.
  • \r\n
  • Step 5: We added a constant of 8 units to the value of the Z score. The consequence of this simple set of transformations is to produce a set of Z scores that have a mean of 8 units, a variance of 4 units, and a standard deviation of 2 units. The advantage of this modified Z score is that a 2-fold difference in expression level corresponds roughly to 1 unit.
  • \r\n
  • Step 6: We computed the arithmetic mean of the values for the set of microarrays for each strain. We have not corrected for variance introduced by sex, age, source of animals, or any possible interaction. We have not corrected for background beyond that implemented by Affymetrix in generating the CEL file.
  • \r\n
\r\nProbe set data from the CHP file: Probe set estimates of expression were initially generated using the standard Affymetrix MAS 5 algorithm. The CHP values were then processed following precisely the same six steps listed above to normalize expression and stabilize the variance of all 106 arrays. The mean expression within each array is therefore 8 units with a standard deviation of 2 units. A 1-unit difference represents roughly a 2-fold difference in expression level. Expression levels below 5 are close to the background noise level. While a value of 8 unit is nominally the average expression, this average includes all those transcripts with negligible expression in the brain that would often be eliminated from subsequent analysis so-called "absent" and "marginal" calls in the CHP file.
\r\n\r\n

About the array probe set names:

\r\n\r\n
\r\n

Most probe sets on the U74Av2 array consist of a total of 32 probes, divided into 16 perfect match probes and 16 mismatch controls. Each set of these 25-nucleotide-long probes has an identifier code that includes a unique number, an underscore character, and several suffix characters that highlight design features. The most common probe set suffix is at. This code indicates that the probes should hybridize relatively selectively with the complementary anti-sense target i.e., the complemenary RNA produced from a single gene. Other codes include:

\r\n\r\n
    \r\n
  • f_at sequence family: Some probes in this probe set will hybridize to identical and/or slightly different sequences of related gene transcripts.
  • \r\n
  • s_at similarity constraint: All Probes in this probe set target common sequences found in transcripts from several genes.
  • \r\n
  • g_at common groups: Some probes in this set target identical sequences in multiple genes and some target unique sequences in the intended target gene.
  • \r\n
  • r_at rules dropped: Probe sets for which it was not possible to pick a full set of unique probes using the Affymetrix probe selection rules. Probes were picked after dropping some of the selection rules.
  • \r\n
  • i_at incomplete: Designates probe sets for which there are fewer than the standard numbers of unique probes specified in the design 16 perfect match for the U74Av2.
  • \r\n
  • st sense target: Designates a sense target; almost always generated in error.
  • \r\n
\r\n\r\n

Descriptions for the probe set extensions were taken from the Affymetrix GeneChip Expression Analysis Fundamentals.

\r\n
" . -gn:Br_u_0803_m gnt:hasNotes "

This text file originally generated by RWW, EJC, and YHQ, August 2003. Updated by RWW, October 30, 2004.

" . -gn:Br_u_0803_m gnt:hasAcknowledgement "

Data were generated with funds to RWW from the Dunavant Chair of Excellence, University of Tennessee Health Science Center, Department of Pediatrics. The majority of arrays were processed at Genome Explorations by Divyen Patel. We thank Guomin Zhou for generating advanced intercross stock used to produce most of the new BXD RI strains.

" . +gn:Gitrmetpublish rdf:type dcat:Dataset . +gn:Gitrmetpublish xkos:classifiedUnder gnc:Phenotype . +gn:Gitrmetpublish rdfs:label "GITrMetPublish" . +gn:Gitrmetpublish skos:prefLabel "GI Tract Metagenome Phenotypes" . +gn:Gitrmetpublish skos:altLabel "GI Tract Metagenome Phenotypes" . +gn:Gitrmetpublish dct:title "GI Tract Metagenome Phenotypes" . +gn:Gitrmetpublish dct:created "2016-10-27" . +gn:Gitrmetpublish dcat:contactPoint gn:investigatorByron_jones_bjone129_uthsc.edu . +gn:Gitrmetpublish foaf:Organization "University of Tennessee Health Science Center" . +gn:Gitrmetpublish dct:identifier "GN658" . +gn:Gitrmetpublish dct:accessRights "private" . +gn:Gitrmetpublish gnt:belongsToGroup gn:setBxd . +gn:Gitrmetpublish gnt:hasTissue gn:tissueGut . +gn:Gitrmetpublish gnt:usesNormalization gn:avgMethodRma . +gn:Gitrmetpublish gnt:usesPlatform gn:platformMogene-1_0-st-v1 . ``` diff --git a/rdf-documentation/genelist.md b/rdf-documentation/genelist.md new file mode 100644 index 0000000..1636c49 --- /dev/null +++ b/rdf-documentation/genelist.md @@ -0,0 +1,193 @@ +# Gene Metadata +## 'genelist-rn33' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT GeneList_rn33.id AS GENE_UID, GeneList_rn33.geneSymbol, GeneList_rn33.chromosome, GeneList_rn33.txStart, GeneList_rn33.txEnd, GeneList_rn33.strand, GeneList_rn33.NM_ID, GeneList_rn33.kgID, GeneList_rn33.geneSymbol, GeneList_rn33.geneSymbol, GeneList_rn33.geneSymbol, GeneList_rn33.geneSymbol, GeneList_rn33.geneSymbol FROM GeneList_rn33 +``` + +The above query results to triples that have the form: + +```text +gn:gene_rn33Genelist_rn33_gene_uid -> rdf:type -> gnc:Gene +gn:gene_rn33Genelist_rn33_gene_uid -> gnt:belongsToSpecies -> gn:Rattus_norvegicus +gn:gene_rn33Genelist_rn33_gene_uid -> gnt:geneSymbol -> GeneList_rn33(geneSymbol) +gn:gene_rn33Genelist_rn33_gene_uid -> gnt:chromosome -> GeneList_rn33(chromosome) +gn:gene_rn33Genelist_rn33_gene_uid -> gnt:TxStart -> "GeneList_rn33(txStart)"^^xsd:double +gn:gene_rn33Genelist_rn33_gene_uid -> gnt:TxEnd -> "GeneList_rn33(txEnd)"^^xsd:double +gn:gene_rn33Genelist_rn33_gene_uid -> gnt:Strand -> GeneList_rn33(strand) +gn:gene_rn33Genelist_rn33_gene_uid -> gnt:transcript -> transcript:GeneList_rn33(NM_ID) +gn:gene_rn33Genelist_rn33_gene_uid -> gnt:hasKgID -> GeneList_rn33(kgID) +gn:gene_rn33Genelist_rn33_gene_uid -> dct:references -> . + a gnc:PantherLink +gn:gene_rn33Genelist_rn33_gene_uid -> dct:references -> . + a gnc:ebiGwasLink +gn:gene_rn33Genelist_rn33_gene_uid -> dct:references -> . + a gnc:stringLink +gn:gene_rn33Genelist_rn33_gene_uid -> dct:references -> . + a gnc:gtexLink +gn:gene_rn33Genelist_rn33_gene_uid -> dct:references -> . + a gnc:proteinAtlasLink +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX probeset: +PREFIX gnc: +PREFIX gnt: +PREFIX rdf: +PREFIX rdfs: +PREFIX dct: +PREFIX owl: +PREFIX xsd: +PREFIX qb: +PREFIX gene: +PREFIX sdmx-measure: +PREFIX transcript: +PREFIX skos: + +SELECT * WHERE { + ?s rdf:type gnc:Gene . + ?s gnt:belongsToSpecies gn:Rattus_norvegicus . + ?s gnt:geneSymbol "0610031j06rik" . + ?s gnt:chromosome "2" . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gn:gene_rn331 rdf:type gnc:Gene . +gn:gene_rn331 gnt:belongsToSpecies gn:Rattus_norvegicus . +gn:gene_rn331 gnt:geneSymbol "0610031j06rik" . +gn:gene_rn331 gnt:chromosome "2" . +gn:gene_rn331 gnt:TxStart "180.388175"^^xsd:double . +gn:gene_rn331 gnt:TxEnd "180.391765"^^xsd:double . +gn:gene_rn331 gnt:Strand "+" . +gn:gene_rn331 gnt:transcript transcript:NM_001004226 . +gn:gene_rn331 dct:references . + a gnc:PantherLink . +gn:gene_rn331 dct:references . + a gnc:ebiGwasLink . +gn:gene_rn331 dct:references . + a gnc:stringLink . +gn:gene_rn331 dct:references . + a gnc:gtexLink . +gn:gene_rn331 dct:references . + a gnc:proteinAtlasLink . +``` + + +## 'genelist' + +## Generated Triples: + +The following SQL query was executed: + +```sql +SELECT CONCAT_WS('_', GeneSymbol, GeneID, AlignID) AS GENE_UID, GeneList.GeneSymbol, GeneList.GeneDescription, GeneList.GeneId, GeneList.GeneSymbol, GeneList.GeneSymbol, GeneList.GeneID, Species.Name, GeneList.GeneSymbol, Species.Name, GeneList.GeneID, Species.Name, GeneList.GeneID, GeneList.GeneSymbol, Species.FullName, GeneList.GeneSymbol, GeneList.GeneSymbol, GeneList.GeneSymbol, GeneList.GeneSymbol, GeneList.Chromosome, GeneList.TxStart, GeneList.TxEnd, GeneList.Strand, Species.Name, GeneList.NM_ID, GeneList.kgID, GeneList.UnigenID, GeneList.ProteinID, GeneList.AlignID, IFNULL(RGD_ID, '') AS RGD_ID FROM GeneList LEFT JOIN Species USING (SpeciesId) +``` + +The above query results to triples that have the form: + +```text +gn:geneGENE_UID -> rdf:type -> gnc:Gene +gn:geneGENE_UID -> gnt:geneSymbol -> GeneList(GeneSymbol) +gn:geneGENE_UID -> dct:description -> GeneListGeneDescription +gn:geneGENE_UID -> gnt:hasGeneId -> gene:GeneList(GeneId) +gn:geneGENE_UID -> dct:references -> . + a gnc:ebiGwasLink +gn:geneGENE_UID -> dct:references -> +gn:geneGENE_UID -> dct:references -> +gn:geneGENE_UID -> dct:references -> +gn:geneGENE_UID -> dct:references -> . + a gnc:gemmaLink +gn:geneGENE_UID -> dct:references -> +gn:geneGENE_UID -> dct:references -> . + a gnc:pantherLink +gn:geneGENE_UID -> dct:references -> . + a gnc:stringLink +gn:geneGENE_UID -> dct:references -> . + a gnc:gtexLink +gn:geneGENE_UID -> dct:references -> . + a gnc:proteinAtlasLink +gn:geneGENE_UID -> gnt:chromosome -> GeneList(Chromosome) +gn:geneGENE_UID -> gnt:TxStart -> "GeneList(TxStart)"^^xsd:double +gn:geneGENE_UID -> gnt:TxEnd -> "GeneList(TxEnd)"^^xsd:double +gn:geneGENE_UID -> gnt:Strand -> GeneList(Strand) +gn:geneGENE_UID -> gnt:belongsToSpecies -> gn:Species_name +gn:geneGENE_UID -> gnt:transcript -> transcript:GeneList(NM_ID) +gn:geneGENE_UID -> gnt:hasKgID -> GeneList(kgID) +gn:geneGENE_UID -> gnt:hasUnigenID -> GeneList(UnigenID) +gn:geneGENE_UID -> gnt:hasProteinID -> GeneList(ProteinID) +gn:geneGENE_UID -> gnt:hasAlignID -> GeneList(AlignID) +gn:geneGENE_UID -> gnt:hasRgdID -> RGD_ID +``` +Here's an example query: + +```sparql +PREFIX gn: +PREFIX probeset: +PREFIX gnc: +PREFIX gnt: +PREFIX rdf: +PREFIX rdfs: +PREFIX dct: +PREFIX owl: +PREFIX xsd: +PREFIX qb: +PREFIX gene: +PREFIX sdmx-measure: +PREFIX transcript: +PREFIX skos: + +SELECT * WHERE { + ?s rdf:type gnc:Gene . + ?s gnt:geneSymbol "OTTMUSG00000007" . + ?s dct:description "predicted gene, OTTMUSG00000007987" . + ?s gnt:hasGeneId gene:100137011 . + ?s ?p ?o . +} +``` + +Expected Result: + +```rdf +gn:geneOTTMUSG00000007_100137011_G211062 rdf:type gnc:Gene . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:geneSymbol "OTTMUSG00000007" . +gn:geneOTTMUSG00000007_100137011_G211062 dct:description "predicted gene, OTTMUSG00000007987" . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:hasGeneId gene:100137011 . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:ebiGwasLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:abaLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:rgdLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:biogpsLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:gemmaLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:genemaniaLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:pantherLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:stringLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:gtexLink . +gn:geneOTTMUSG00000007_100137011_G211062 dct:references . + a gnc:proteinAtlasLink . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:chromosome "11" . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:TxStart "60.630829"^^xsd:double . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:TxEnd "60.632734"^^xsd:double . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:belongsToSpecies gn:Mouse . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:transcript transcript:AK046412 . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:hasProteinID "Q8BQU9" . +gn:geneOTTMUSG00000007_100137011_G211062 gnt:hasAlignID "G211062" . +``` + diff --git a/rdf-documentation/probeset-metadata.md b/rdf-documentation/probeset-metadata.md index ce51854..fe857b9 100644 --- a/rdf-documentation/probeset-metadata.md +++ b/rdf-documentation/probeset-metadata.md @@ -6,7 +6,7 @@ The following SQL query was executed: ```sql -SELECT IF(NULLIF(TRIM(ProbeSet.Name), '') IS NULL, '', TRIM(ProbeSet.Name)) AS ProbeSetIdName, ProbeSet.Id, ProbeSet.Name, ProbeSet.alias, IFNULL(GeneChip.Name, '') AS GeneChipName, NULLIF(TRIM(ProbeSet.TargetId), '') AS TargetId, ProbeSet.Symbol, ProbeSet.description, NULLIF(TRIM(ProbeSet.Probe_set_target_region), '') AS Probe_set_target_region, ProbeSet.Chr, IFNULL(ProbeSet.Mb, '') AS Mb, ProbeSet.Mb, ProbeSet.Chr, ProbeSet.Strand_Probe, ProbeSet.GeneId, ProbeSet.OMIM, ProbeSet.HomoloGeneID, ProbeSet.UniProtID, ProbeSet.Symbol, ProbeSet.Symbol, ProbeSet.Symbol, ProbeSet.Symbol, ProbeSet.Symbol, Species.Name, ProbeSet.RefSeq_TranscriptId, GeneList_rn33.kgId, (GeneList.txStart * 1000000) AS TranscriptStartMm10, (GeneList_rn33.txStart * 1000000) AS TranscriptStartRn7, GeneList.Chromosome, GeneList_rn33.Chromosome, (GeneList.txEnd * 1000000) AS TranscriptEndMm10, (GeneList_rn33.txEnd * 1000000) AS TranscriptEndRn7, ProbeSet.Symbol, ProbeSet.GeneId, Species.FullName, ProbeSet.Symbol, ProbeSet.GeneId, Species.name, ProbeSet.GeneId, ProbeSet.GeneId, Species.Name, ProbeSet.Strand_Probe, IFNULL(ProbeSet.Probe_set_specificity, '') AS Probe_set_specificity, IFNULL(ProbeSet.Probe_set_BLAT_score, '') AS Probe_set_BLAT_score, IFNULL(ProbeSet.Probe_set_Blat_Mb_start, '') AS Probe_set_Blat_Mb_start, IFNULL(ProbeSet.Probe_set_Blat_Mb_end, '') AS Probe_set_Blat_Mb_end, ProbeSet.BlatSeq, ProbeSet.TargetSeq FROM ProbeSet LEFT JOIN GeneChip ON GeneChip.Id = ProbeSet.ChipId LEFT JOIN GeneList ON GeneList.GeneID = ProbeSet.GeneId LEFT JOIN GeneList_rn33 ON GeneList.geneSymbol = ProbeSet.Symbol LEFT JOIN Species ON GeneChip.SpeciesId = Species.Id +SELECT IF(NULLIF(TRIM(ProbeSet.Name), '') IS NULL, '', TRIM(ProbeSet.Name)) AS ProbeSetIdName, ProbeSet.Id, ProbeSet.Name, ProbeSet.alias, IFNULL(GeneChip.Name, '') AS GeneChipName, NULLIF(TRIM(ProbeSet.TargetId), '') AS TargetId, ProbeSet.Symbol, ProbeSet.description, NULLIF(TRIM(ProbeSet.Probe_set_target_region), '') AS Probe_set_target_region, ProbeSet.Chr, IFNULL(ProbeSet.Mb, '') AS Mb, ProbeSet.Mb, ProbeSet.Chr, ProbeSet.Strand_Probe, ProbeSet.GeneId, ProbeSet.OMIM, ProbeSet.HomoloGeneID, ProbeSet.UniProtID, ProbeSet.Strand_Probe, IFNULL(ProbeSet.Probe_set_specificity, '') AS Probe_set_specificity, IFNULL(ProbeSet.Probe_set_BLAT_score, '') AS Probe_set_BLAT_score, IFNULL(ProbeSet.Probe_set_Blat_Mb_start, '') AS Probe_set_Blat_Mb_start, IFNULL(ProbeSet.Probe_set_Blat_Mb_end, '') AS Probe_set_Blat_Mb_end, ProbeSet.BlatSeq, ProbeSet.TargetSeq FROM ProbeSet LEFT JOIN GeneChip ON GeneChip.Id = ProbeSet.ChipId LEFT JOIN Species ON GeneChip.SpeciesId = Species.Id WHERE ProbeSet.Name IS NOT NULL ``` The above query results to triples that have the form: @@ -17,36 +17,18 @@ gn:probesetProbesetidname -> rdfs:label -> ProbeSet(Name) gn:probesetProbesetidname -> skos:altLabel -> ProbeSet(alias) gn:probesetProbesetidname -> gnt:hasChip -> gn:platformGenechipname gn:probesetProbesetidname -> gnt:hasTargetId -> TargetId -gn:probesetProbesetidname -> gnt:symbol -> ProbeSet(Symbol) +gn:probesetProbesetidname -> gnt:geneSymbol -> ProbeSet(Symbol) gn:probesetProbesetidname -> dct:description -> ProbeSetdescription gn:probesetProbesetidname -> gnt:targetsRegion -> Probe_set_target_region gn:probesetProbesetidname -> gnt:chr -> ProbeSet(Chr) gn:probesetProbesetidname -> gnt:mb -> "Mb"^^xsd:double -gn:probesetProbesetidname -> gnt:location -> Chr ProbeSet(Chr) @ ProbeSet(Mb) -gn:probesetProbesetidname -> dct:references -> . - a gnc:NCBIGeneLink -gn:probesetProbesetidname -> dct:references -> . - a gnc:omimLink -gn:probesetProbesetidname -> dct:references -> . - a gnc:homologeneLink -gn:probesetProbesetidname -> dct:references -> . - a gnc:uniprotLink -gn:probesetProbesetidname -> dct:references -> . - a gnc:stringLink -gn:probesetProbesetidname -> dct:references -> . - a gnc:gtexLink -gn:probesetProbesetidname -> dct:references -> . - a gnc:ebiGwasLink -gn:probesetProbesetidname -> dct:references -> . - a gnc:proteinAtlasLink -gn:probesetProbesetidname -> dct:references -> -gn:probesetProbesetidname -> dct:references -> . - a gnc:PantherLink -gn:probesetProbesetidname -> dct:references -> -gn:probesetProbesetidname -> dct:references -> -gn:probesetProbesetidname -> dct:references -> . - a gnc:gemmaLink -gn:probesetProbesetidname -> dct:references -> +gn:probesetProbesetidname -> gnt:location -> Chr ProbeSet(Chr) @ ProbeSet(Mb) Mb +gn:probesetProbesetidname -> gnt:hasGeneId -> gene:ProbeSet(GeneId) +gn:probesetProbesetidname -> dct:references -> . + a gnc:omimLink +gn:probesetProbesetidname -> dct:references -> . + a gnc:homologeneLink +gn:probesetProbesetidname -> gnt:uniprot -> uniprot:ProbeSet(UniProtID) gn:probesetProbesetidname -> gnt:strandProbe -> ProbeSet(Strand_Probe) gn:probesetProbesetidname -> gnt:hasSpecificity -> Probe_set_specificity gn:probesetProbesetidname -> gnt:hasBlatScore -> Probe_set_BLAT_score @@ -61,6 +43,7 @@ Here's an example query: PREFIX gn: PREFIX probeset: PREFIX gnc: +PREFIX gene: PREFIX gnt: PREFIX rdf: PREFIX rdfs: @@ -73,9 +56,6 @@ PREFIX skos: SELECT * WHERE { ?s rdf:type gnc:Probeset . - ?s rdfs:label "100322_at" . - ?s skos:altLabel "IGHG2A; AU044919; MGC102604; MGC102659; Ighg" . - ?s gnt:hasChip gn:platformMg_u74av2 . ?s ?p ?o . } ``` @@ -83,39 +63,7 @@ SELECT * WHERE { Expected Result: ```rdf -gn:probeset100322_at rdf:type gnc:Probeset . -gn:probeset100322_at rdfs:label "100322_at" . -gn:probeset100322_at skos:altLabel "IGHG2A; AU044919; MGC102604; MGC102659; Ighg" . -gn:probeset100322_at gnt:hasChip gn:platformMg_u74av2 . -gn:probeset100322_at gnt:symbol "Ighg" . -gn:probeset100322_at dct:description "immunoglobulin heavy chain gamma polypeptide" . -gn:probeset100322_at gnt:chr "12" . -gn:probeset100322_at gnt:mb "114.322406"^^xsd:double . -gn:probeset100322_at gnt:location "Chr 12 @ 114.322406 on the minus strand" . -gn:probeset100322_at dct:references . - a gnc:NCBIGeneLink . -gn:probeset100322_at dct:references . - a gnc:stringLink . -gn:probeset100322_at dct:references . - a gnc:gtexLink . -gn:probeset100322_at dct:references . - a gnc:ebiGwasLink . -gn:probeset100322_at dct:references . - a gnc:proteinAtlasLink . -gn:probeset100322_at dct:references . - a gnc:PantherLink . -gn:probeset100322_at dct:references . - a gnc:genemaniaLink . -gn:probeset100322_at dct:references . - Ighg . -gn:probeset100322_at dct:references . - a gnc:gemmaLink . -gn:probeset100322_at gnt:strandProbe "-" . -gn:probeset100322_at gnt:hasSpecificity "3.1" . -gn:probeset100322_at gnt:hasBlatScore "62" . -gn:probeset100322_at gnt:hasBlatMbStart "114.322406"^^xsd:double . -gn:probeset100322_at gnt:hasBlatMbEnd "114.322571"^^xsd:double . -gn:probeset100322_at gnt:hasBlatSeq "TGGTCACAGCTTTCCGCTCACGTTCACTGAAACGGGCTGATGCTGCACCAACTGTATCTTCCCACCATCCAGTAAGCTTGGGCCCGGTGGTTACTGGAACTGGATCCGGAAATTCCCAGGGAATATTACCTGCAGTTGAATTCTGTGACTACT" . -gn:probeset100322_at gnt:hasTargetSeq "tggtcacagctttccgctcacgttcggtgctgggaccaagctggaactgaaacgggctgatgctgcaccaactgtatccatcttcccaccatccagtaagcttgggcccggtgggggcnnnnngnnnngnnnnnnntnnnnnnngnnngncnnnnngnnnnncnnntcngaggtgcagcttcaggagtcaggacctngcctngnnaaaccttctcagactctgtccctcacctgttctgtcactggcnactccatcaccagtgnttactggaactggatccggaaattcccagggaataaacttgantacatgggntacataanctacagtggtnncacttactacaatccatctctcaaaagtcgaatctccatnactnnagacacatccaagaaccantattacctgcagttgaattctgtgactact" . +gn:probeset1824795 rdf:type gnc:Probeset . +gn:probeset1824795 gnt:location "Not available" . ``` diff --git a/rdf-documentation/strains.md b/rdf-documentation/strains.md index 87a8ce9..db05318 100644 --- a/rdf-documentation/strains.md +++ b/rdf-documentation/strains.md @@ -6,7 +6,7 @@ The following SQL query was executed: ```sql -SELECT Strain.Name, Species.Fullname, Strain.Name, IF ((Strain.Name2 != Strain.Name), Strain.Name2, '') AS Name2, IF ((Strain.Alias != Strain.Name), Strain.Alias, '') AS Alias, IF ((Strain.Symbol != Strain.Name), Strain.Symbol, '') AS Symbol FROM Strain LEFT JOIN Species ON Strain.SpeciesId = Species.SpeciesId +SELECT Strain.Name, Species.Fullname, Strain.Name, IF ((Strain.Name2 != Strain.Name), Strain.Name2, '') AS Name2, IF ((Strain.Alias != Strain.Name), Strain.Alias, '') AS Alias, Strain.Symbol FROM Strain LEFT JOIN Species ON Strain.SpeciesId = Species.SpeciesId ``` The above query results to triples that have the form: @@ -17,7 +17,7 @@ gn:Strain_name_ -> gnt:belongsToSpecies -> gn:Species_fullname gn:Strain_name_ -> rdfs:label -> StrainName gn:Strain_name_ -> skos:altLabel -> Name2 gn:Strain_name_ -> gnt:alias -> Alias -gn:Strain_name_ -> gnt:symbol -> Symbol +gn:Strain_name_ -> gnt:geneSymbol -> Strain(Symbol) ``` Here's an example query: -- cgit v1.2.3