path: root/doc/database.org

- github Document reduction issue

* The small test database (2GB)

The default install comes with a smaller database which includes a
number of the BSD's and the Human liver dataset (GSE9588).

* GeneNetwork database

** Estimated table sizes 


select table_name,round(((data_length + index_length) / 1024 / 1024), 2) `Size in MB` from information_schema.TABLES where table_schema = "db_webqtl" order by data_length;

+-------------------------+------------+
| table_name              | Size in MB |
+-------------------------+------------+
| ProbeSetData            |   59358.80 |
| SnpAll                  |   15484.67 |
| ProbeData               |   22405.44 |
| SnpPattern              |    9177.05 |
| ProbeSetSE              |   14551.02 |
| QuickSearch             |    5972.86 |
| ProbeSetXRef            |    4532.89 |
| LCorrRamin3             |   18506.53 |
| ProbeSE                 |    6263.83 |
| ProbeSet                |    2880.21 |
| Probe                   |    2150.30 |
| GenoData                |    3291.91 |
| CeleraINFO_mm6          |     989.80 |
| pubmedsearch            |    1032.50 |
| ProbeXRef               |     743.38 |
| GeneRIF_BASIC           |     448.54 |
| BXDSnpPosition          |     224.44 |
| EnsemblProbe            |     133.66 |
| EnsemblProbeLocation    |     105.49 |
| Genbank                 |      37.71 |
| TissueProbeSetData      |      74.42 |
| AccessLog               |      42.38 |
| GeneList                |      34.11 |
| Geno                    |      33.90 |
| MachineAccessLog        |      28.34 |
| IndelAll                |      22.42 |
| PublishData             |      22.54 |
| TissueProbeSetXRef      |      14.73 |
| ProbeH2                 |      13.26 |
| GenoXRef                |      22.83 |
| TempData                |       8.35 |
| GeneList_rn3            |       5.54 |
| GORef                   |       4.97 |
| Phenotype               |       6.50 |
| temporary               |       3.59 |
| InfoFiles               |       3.32 |
| Publication             |       3.42 |
| Homologene              |       5.69 |
| Datasets                |       2.31 |
| GeneList_rn33           |       2.61 |
| PublishSE               |       4.71 |
| GeneRIF                 |       2.18 |
| Vlookup                 |       1.87 |
| H2                      |       2.18 |
| PublishXRef             |       2.18 |
| NStrain                 |       4.80 |
| IndelXRef               |       2.91 |
| Strain                  |       1.07 |
| GeneMap_cuiyan          |       0.51 |
| user_collection         |       0.30 |
| CaseAttributeXRef       |       0.44 |
| StrainXRef              |       0.56 |
| GeneIDXRef              |       0.77 |
| Docs                    |       0.17 |
| News                    |       0.17 |
| ProbeSetFreeze          |       0.22 |
| GeneRIFXRef             |       0.24 |
| Sample                  |       0.06 |
| login                   |       0.06 |
| user                    |       0.04 |
| TableFieldAnnotation    |       0.05 |
| DatasetMapInvestigator  |       0.05 |
| User                    |       0.04 |
| ProbeFreeze             |       0.06 |
| TableComments           |       0.02 |
| Investigators           |       0.02 |
| DBList                  |       0.03 |
| Tissue                  |       0.02 |
| GeneChip                |       0.01 |
| GeneCategory            |       0.01 |
| SampleXRef              |       0.01 |
| InbredSet               |       0.01 |
| SnpAllele_to_be_deleted |       0.00 |
| Organizations           |       0.01 |
| PublishFreeze           |       0.00 |
| GenoFreeze              |       0.00 |
| Chr_Length              |       0.01 |
| SnpSource               |       0.00 |
| AvgMethod               |       0.00 |
| Species                 |       0.00 |
| Dataset_mbat            |       0.00 |
| TissueProbeFreeze       |       0.00 |
| EnsemblChip             |       0.00 |
| TissueProbeSetFreeze    |       0.01 |
| UserPrivilege           |       0.00 |
| CaseAttribute           |       0.00 |
| MappingMethod           |       0.00 |
| DBType                  |       0.00 |
| InfoFilesUser_md5       |       0.00 |
| GenoCode                |       0.00 |
| DatasetStatus           |       0.00 |
| GeneChipEnsemblXRef     |       0.00 |
| GenoSE                  |       0.00 |
| user_openids            |       0.00 |
| roles_users             |       0.00 |
| role                    |       0.00 |
| Temp                    |       NULL |
+-------------------------+------------+
97 rows in set, 1 warning (0.01 sec)

All *Data tables are large

** User access

According to the meta data:

This table tracks access time and IP addresses. Used for logging in
registered users and tracking cookies.

# GN1 uses access table and GN2 uses user table (true/false?)

 select * from AccessLog limit 5;
+-------+---------------------+----------------+
| id    | accesstime          | ip_address     |
+-------+---------------------+----------------+
| 12174 | 2003-10-28 02:17:41 | 130.120.104.71 |
| 12173 | 2003-10-28 02:16:27 | 130.120.104.71 |
|     3 | 2003-02-22 07:38:33 | 192.117.159.1  |
|     4 | 2003-02-22 07:49:13 | 192.117.159.1  |
|     5 | 2003-02-22 07:51:08 | 192.117.159.1  |
+-------+---------------------+----------------+

select * from AccessLog order by accesstime desc limit 5;
+---------+---------------------+---------------+
| id      | accesstime          | ip_address    |
+---------+---------------------+---------------+
| 1025735 | 2016-02-08 14:23:29 | 100.43.81.157 |
| 1025734 | 2016-02-08 13:54:28 | 180.76.15.144 |
| 1025733 | 2016-02-08 13:43:37 | 66.249.65.217 |
| 1025732 | 2016-02-08 13:39:50 | 66.249.65.217 |
| 1025731 | 2016-02-08 13:15:46 | 66.249.65.217 |
+---------+---------------------+---------------+

Quite a few trait page hits:

select count(*) from AccessLog;

+----------+
| count(*) |
+----------+
|  1025685 |
+----------+

show indexes from AccessLog;
+-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Table     | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
+-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| AccessLog |          0 | PRIMARY  |            1 | id          | A         |     1025685 |     NULL | NULL   |      | BTREE      |         |               |
+-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+

This table is being used by both GN1 and GN2 from the trait pages!

: grep -ir AccessLog *|grep -e "^gn1\|^gn2"|grep \.py|grep -v doc

gn1/web/webqtl/showTrait/ShowTraitPage.py:              query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \
gn1/web/webqtl/showTrait/ShowTraitPage.py:                      self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)" ,user_ip)
gn1/web/webqtl/textUI/cmdClass.py:                      query = """SELECT count(id) FROM AccessLog WHERE ip_address = %s AND UNIX_TIMESTAMP()-UNIX_TIMESTAMP(accesstime)<86400"""
gn1/web/webqtl/textUI/cmdClass.py:                      query = """INSERT INTO AccessLog(accesstime,ip_address) values(Now(),%s)""" 
gn2/wqflask/wqflask/show_trait/show_trait_page.py:        query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \
gn2/wqflask/wqflask/show_trait/show_trait_page.py:        self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)", user_ip)

When looking at the code in GN1 and GN2 it restricts the daily use of
the trait data page (set to 1,000 - whoever reaches that?). Unlike
mentioned in the schema description, this table does *not* keep track
of cookies. 

From the code it looks like GN2 uses a mixture of Redis and sqlalchemy
to keep track of logged in sessions (see
gn2/wqflask/wqflask/user_manager.py) and cookies through a user_uuid in 
model.py.

In gn2/wqflask/wqflask/templates/collections/view_anonymous.html it
show_trait_page appears to be loaded (need to check).

** AvgMethod 

Probesetfreeze refers to AvgMethod

** BXDSnPosition

Snp table (all snps)

Mapping in GN1 shows snps when  you select a chromosome.

** CaseAttribute(XRef)

Metadata

** CeleralINFO_mm6

?

** Chr_Length

Default mm9, column for mm8

** Dataset_mbat

Menu for BXD (linkouts)

** DatasetMapInvestigator

Arthur?

** DataSets

Information/metadata

** DatasetStatus

Arthur private/public

** DBList and DBType

Hooked in API (URL encoding)

** Docs

GN2 only (see menu bar)

** Ensembl* 

Probe information

(will be deprecated)

** Genbank

Linkout and not important

** GeneCategory

Not important. GeneWiki notes function classification.

Deprecate.

** GeneChip

** GeneIDXRef

Interspecies gene comparison

** GeneList

Track info

** Genlist_rn3(3)

Rat list

** GeneMap_cuiyan

Link outs

** GeneRIF

Wiki info (nightly updated from NCBI)

XRef should be foreign keys

** Geno

SNP or marker info

** GenoCode

Belongs to someone else

** GenoData

Allele info

** GenoFreeze

Big menu (Freeze refers to menu)

** GenoSE

SE standard err, not used

** GenoXREF

Very important. Key links between Geno, GenoData

** GORef

GO terms

** H2

Heritability for probeset(?)

** Homologene

Homology, not used much

** InbredSet

Group in menu

** Indelall, SnpAll, SnpPattern, SnpSource

Indel Snp browser (variant browser Gn1)

** Info*

Infra system PhP 

Data Info button 

Infosystem users has separate entries

Also Investigators, User, Organizations, 

** LCorrRamin3 

Lit. Correlations Prof. Ramin

** Login

GN2 login info

** MachineAccessLog

Old

** MappingMethod

GN1

** News

GN2

** NStrain

pheno           publishfreeze (menu)
                       xref (keys)
                          xref links to publish (pubmed), phenotype, pubishdata
geno            genofreeze
                       xref (keys)
                          xref links to publish (pubmed), genotype, genodata
probeset/expr.  probesetfreeze
                       xref (keys)
                          xref links to publish (pubmed), probeset, probesetdata
probe/expr.  probefreeze
                       xref (keys)
                          xref links to publish (pubmed), probe, probedata

Each dataset has 3 values (real value (1), number of samples (2), stderr (3))

NStrain = number of phenotype samples

ProbesetFreeze contains all data, incl. metabolomic.

** Phenotype

This table contains names, full descriptions, and short symbols for
traits and phenotype used primarily in the Published Phenotypes
databases.

Contains 10k rows, March 2016, of which 5000 are for the BXDs). 

| Id | Pre_publication_description | Post_publication_description                                                                                         | Original_description                                                                                                                                        | Units                | Pre_publication_abbreviation | Post_publication_abbreviation | Lab_code | Submitter   | Owner | Authorized_Users |
+----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+
|  1 | NULL                        | Hippocampus weight                                                                                                   | Original post publication description: Hippocampus weight                                                                                                   | Unknown              | NULL                         | HPCWT                         | NULL     | robwilliams | NULL  | robwilliams      |
|  2 | NULL                        | Cerebellum weight                                                                                                    | Original post publication description: Cerebellum weight                                                                                                    | mg                   | NULL                         | CBLWT                         | NULL     | robwilliams | NULL  | robwilliams      |
|  3 | NULL                        | Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide  [units/100 ug protein] | Original post publication description: Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide  [units/100 ug protein] | units/100 ug protein | NULL                         | IL1Activity                   | NULL     | robwilliams | NULL  | robwilliams      |
|  4 | NULL                        | Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg]                 | Original post publication description: Cerebellum weight [mg]                                                                                               | mg                   | NULL                         | CBLWT2                        | NULL     | robwilliams | NULL  | robwilliams      |
|  5 | NULL                        | The coat color of 79 BXD RI strain                                                                                   | Original post publication description: The coat color of 79 BXD RI strain                                                                                   | Unknown              | NULL                         | CoatColor                     | NULL     | robwilliams | NULL  | robwilliams      |
+----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+
5 rows in set (0.00 sec)

** ProbeData

Table with fine-grained probe level Affymetrix data only. Contains 1
billion rows March 2016. This table may be deletable since it is only
used by the Probe Table display in GN1. Not used in GN2
(double-check).

In comparison the "ProbeSetData" table contains more molecular assay
data, including probe set data, RNA-seq data, proteomic data, and
metabolomic data. 2.5 billion rows March 2016. In comparison,
ProbeData contains data only for Affymetrix probe level data
(e.g. Exon array probes and M430 probes).

"ProbeData.StrainId" should be "CaseId" or "SampleId".

"ProbeData" should probably be "AssayData" or something more neutral.

select * from ProbeData limit 2;
+--------+----------+---------+
| Id     | StrainId | value   |
+--------+----------+---------+
| 503636 |       42 | 11.6906 |
| 503636 |       43 | 11.4205 |
+--------+----------+---------+
2 rows in set (0.00 sec)

select count(*) from ProbeData limit 2;
+-----------+
| count(*)  |
+-----------+
| 976753435 |
+-----------+
1 row in set (0.00 sec)

** ProbeSet

Comment: PLEASE CHANGE TABLE NAME and rework fields carefully. This is
a terrible table but it works well (RWW March 2016). It is used in
combination with the crucial TRAIT DATA and ANALYSIS pages in GN1 and
GN2. It is also used by annotators using the UPDATE INFO AND DATA web
form to correct and update annotation. It is used by Arthur to enter
new annotation files and metadata for arrays, genes, proteins,
metabolites. The main problem with this table is that it is doing too
much work.

Initially (2003) this table contained only Affymetrix ProbeSet data
for mouse (U74aV2 initially). Many other array platforms for different
species were added. At least four other major categories of molecular
assays have been added since about 2010.

1. RNA-seq annotation and sequence data for transcripts using ENSEMBL
   identifiers or NCBI NM_XXXXX and NR_XXXXX type identifiers

2. Protein and peptide annotation and sequence data (see BXD Liver
   Proteome data, SRM and SWATH type data) with identifiers such as
   "abcb10_q9ji39_t311" for SRM data and "LLGNMIVIVLGHHLGKDFTPAAQAA"
   for SWATH data where the latter is just the peptide fragment that
   has been quantified. Data first entered in 2015 for work by Rudi
   Aebersold and colleagues.

3. Metabolite annotation and metadata (see BXD Liver Metabolome data)
   with identifiers that are usually Mass charge ratios such as
   "149.0970810_MZ"

4. Epigenomic and methylome data (e.g. Human CANDLE Methylation data
   with identifiers such as "cg24523000")

It would make good sense to break this table into four or more types
of molecular assay metadata or annotation tables) (AssayRNA_Anno,
AssayProtein_Anno, AssayMetabolite_Anno, AssayEpigenome_Anno,
AssayMetagenome_Anno), since these assays will have many differences
in annotation content compared to RNAs.

Some complex logic is used to update contents of this table when
annotators modify and correct the information (for example, updating
gene symbols). These features requested by Rob so that annotating one
gene symbol in one species would annotate all gene symbols in the same
species based on common NCBI GeneID number. For example, changing the
gene alias for one ProbeSet.Id will changing the list of aliases in
all instances with the same gene symbol.

If the ProbeSet.BlatSeq (or is this ProbSetTargetSeq) is identical
between different ProbeSet.Ids then annotation is forced to be the
same even if the symbol or geneID is different. This "feature" was
implemented when we found many probe sets with identical sequence but
different annotations and identifiers.


select count(*) from ProbeSet limit 5;
+----------+
| count(*) |
+----------+
|  4351030 |
+----------+

| Id   | ChipId | Name     | TargetId | Symbol | description                                  | Chr  | Mb        | alias    | GeneId | GenbankId | SNP  | BlatSeq                                                                                                                                                                      | TargetSeq                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             | UniGeneId | Strand_Probe | Strand_Gene | OMIM   | comments | Probe_set_target_region | Probe_set_specificity | Probe_set_BLAT_score | Probe_set_Blat_Mb_start | Probe_set_Blat_Mb_end | Probe_set_strand | Probe_set_Note_by_RW | flag | Symbol_H | description_H | chromosome_H | MB_H | alias_H | GeneId_H | chr_num | name_num | Probe_Target_Description | RefSeq_TranscriptId | Chr_mm8 | Mb_mm8    | Probe_set_Blat_Mb_start_mm8 | Probe_set_Blat_Mb_end_mm8 | HomoloGeneID | Biotype_ENS | ProteinID | ProteinName | Flybase_Id | HMDB_ID | Confidence | ChEBI_ID | ChEMBL_ID | CAS_number | PubChem_ID | ChemSpider_ID | UNII_ID | EC_number | KEGG_ID | Molecular_Weight | Nugowiki_ID | Type | Tissue | PrimaryName | SecondaryNames | PeptideSequence |
+------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+
| 7282 |      1 | 93288_at | NULL     | Arpc2  | actin related protein 2/3 complex, subunit 2 | 1    | 74.310961 | AK008777 | 76709  | AI835883  |    0 | CCGACTTCCTTAAGGTGCTCAACCGGACTGCTTGCTACTGGATAATCGTGAGGGATTCTCCATTTGGGTTCCATTTTGTACGAGTTTGGCAAATAACCTGCAGAAACGAGCTGTGCTTGCAAGGACTTGATAGTTCCTAATCCTTTTCCAAGCTGTTTGCTTTGCAATATGT | ccgacttccttaaggtgctcaaccgtnnnnnnccnannnnccnagaaaaaagaaatgaaaannnnnnnnnnnnnnnnnnnttcatcccgctaactcttgggaactgaggaggaagcgctgtcgaccgaagnntggactgcttgctactggataatcgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgagggattctccatttgggttccattttgtacgagtttggcaaataacctgcagaaacgagctgtgcttgcaaggacttgatagttcctaagaattanaanaaaaaaaanaanttccacttgatcaanttaattcccttttatttttcctccctcantccccttccttttccaagctgtttgctttgcaatatgt                                                                                                                                                                                                                                     | Mm.337038 | +            |             | 604224 |          | NULL                    |                  8.45 |                  169 |               74.310961 |              74.31466 | NULL             | NULL                 | 3    | NULL     | NULL          | NULL         | NULL | NULL    | NULL     |       1 |    93288 | NULL                     | XM_129773           | 1       | 74.197594 |                   74.197594 |                 74.201293 | 4187         | NULL        | NULL      | NULL        | NULL       | NULL    |       NULL |     NULL | NULL      | NULL       |       NULL |          NULL | NULL    | NULL      | NULL    |             NULL |        NULL | NULL | NULL   | NULL        | NULL           | NULL            |
+------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+
2 rows in set (0.00 sec)



** ProbeSetData

Probedata - main molecular data. Probesets, metabolome, 

Almost all important molecular assay data is in this table including
probe set data, RNA-seq data, proteomic data, and metabolomic
data. 2.5 billion rows March 2016. In comparison, ProbeData contains
data only for Affymetrix probe level data (e.g. Exon array probes and
M430 probes).

select count(*) from ProbeSetData limit 5;
+---------------+
| count(*)      |
+---------------+
| 2,510,566,472 |
+---------------+


select * from ProbeSetData limit 5;
+----+----------+-------+
| Id | StrainId | value |
+----+----------+-------+
|  1 |        1 | 5.742 |
|  1 |        2 | 5.006 |
|  1 |        3 | 6.079 |
|  1 |        4 | 6.414 |
|  1 |        5 | 4.885 |
+----+----------+-------+

show indexes  from ProbeSetData;
+--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Table        | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
+--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| ProbeSetData |          0 | DataId   |            1 | Id          | A         |    34868978 |     NULL | NULL   |      | BTREE      |         |               |
| ProbeSetData |          0 | DataId   |            2 | StrainId    | A         |  2510566472 |     NULL | NULL   |      | BTREE      |         |               |
+--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+

select * from Strain limit 5;
+----+----------+----------+-----------+--------+-------+
| Id | Name     | Name2    | SpeciesId | Symbol | Alias |
+----+----------+----------+-----------+--------+-------+
|  1 | B6D2F1   | B6D2F1   |         1 | NULL   | NULL  |
|  2 | C57BL/6J | C57BL/6J |         1 | B6J    | NULL  |
|  3 | DBA/2J   | DBA/2J   |         1 | D2J    | NULL  |
|  4 | BXD1     | BXD1     |         1 | NULL   | NULL  |
|  5 | BXD2     | BXD2     |         1 | NULL   | NULL  |
+----+----------+----------+-----------+--------+-------+

show indexes from Strain;
+--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Table  | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment |
+--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+
| Strain |          0 | PRIMARY  |            1 | Id          | A         |       14368 |     NULL | NULL   |      | BTREE      |         |               |
| Strain |          0 | Name     |            1 | Name        | A         |       14368 |     NULL | NULL   | YES  | BTREE      |         |               |
| Strain |          0 | Name     |            2 | SpeciesId   | A         |       14368 |     NULL | NULL   |      | BTREE      |         |               |
| Strain |          1 | Symbol   |            1 | Symbol      | A         |       14368 |     NULL | NULL   | YES  | BTREE      |         |               |
+--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+

A typical query may look like

SELECT Strain.Name, ProbeSetData.value, ProbeSetSE.error, ProbeSetData.Id
                    FROM (ProbeSetData, ProbeSetFreeze, Strain, ProbeSet, ProbeSetXRef)
                    left join ProbeSetSE on
                      (ProbeSetSE.DataId = ProbeSetData.Id AND ProbeSetSE.StrainId = ProbeSetData.StrainId)
                    WHERE
                      ProbeSetFreeze.name = 'B139_K_1206_M' AND
                      ProbeSetXRef.ProbeSetId = ProbeSet.Id AND
                      ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND
                      ProbeSetXRef.DataId = ProbeSetData.Id AND
                      ProbeSetData.StrainId = Strain.Id
                    Order BY Strain.Name

+-------+-------+-------+----------+
| Name  | value | error | Id       |
+-------+-------+-------+----------+
| SM001 |  38.3 |  NULL | 25309550 |
| SM001 |   2.7 |  NULL | 25309520 |
| SM001 |  20.3 |  NULL | 25309507 |
| SM001 | 125.8 |  NULL | 25309511 |
| SM001 |   8.2 |  NULL | 25309534 |
+-------+-------+-------+----------+
5 rows in set (22.28 sec)

select * from ProbeSetFreeze limit 5;
+----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
| Id | ProbeFreezeId | AvgID | Name        | Name2                           | FullName                                    | ShortName               | CreateTime | OrderList | public | confidentiality | AuthorisedUsers | DataScale |
+----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+
|  1 |             3 |     1 | Br_U_0803_M | BXDMicroArray_ProbeSet_August03 | UTHSC Brain mRNA U74Av2 (Aug03) MAS5        | Brain U74Av2 08/03 MAS5 | 2003-08-01 |      NULL |      0 |               0 | NULL            | log2      |
|  2 |            10 |     1 | Br_U_0603_M | BXDMicroArray_ProbeSet_June03   | UTHSC Brain mRNA U74Av2 (Jun03) MAS5        | Brain U74Av2 06/03 MAS5 | 2003-06-01 |      NULL |      0 |               0 | NULL            | log2      |
|  3 |             8 |     1 | Br_U_0303_M | BXDMicroArray_ProbeSet_March03  | UTHSC Brain mRNA U74Av2 (Mar03) MAS5        | Brain U74Av2 03/03 MAS5 | 2003-03-01 |      NULL |      0 |               0 | NULL            | log2      |
|  4 |             5 |     1 | Br_U_0503_M | BXDMicroArray_ProbeSet_May03    | UTHSC Brain mRNA U74Av2 (May03) MAS5        | Brain U74Av2 05/03 MAS5 | 2003-05-01 |      NULL |      0 |               0 | NULL            | log2      |
|  5 |             4 |     1 | HC_U_0303_M | GNFMicroArray_ProbeSet_March03  | GNF Hematopoietic Cells U74Av2 (Mar03) MAS5 | GNF U74Av2 03/03 MAS5   | 2003-03-01 |      NULL |      0 |               0 | NULL            | log2      |
+----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+

 select * from ProbeSetXRef limit 5;
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old  | LRS_old            | pValue_old | mean              | se                  | Locus           | LRS                | pValue | additive             | h2   |
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+
|                1 |          1 |      1 | 10.095.400 |   13.3971627898894 |      0.163 |  5.48794285714286 | 0.08525787814808819 | rs13480619      | 12.590069931048001 |  0.269 |          -0.28515625 | NULL |
|                1 |          2 |      2 | D15Mit189  | 10.042057464356201 |      0.431 |  9.90165714285714 |  0.0374686634976217 | CEL-17_50896182 |   10.5970737900941 |  0.304 | -0.11678333333333299 | NULL |
|                1 |          3 |      3 | D5Mit139   |   5.43678531742749 |      0.993 |  7.83948571428571 |  0.0457583416912569 | rs13478499      |    6.0970532702754 |  0.988 |    0.112957489878542 | NULL |
|                1 |          4 |      4 | D1Mit511   |   9.87815279480766 |      0.483 | 8.315628571428569 |  0.0470396593931327 | rs6154379       | 11.774867551173099 |  0.286 |   -0.157113725490196 | NULL |
|                1 |          5 |      5 | D16H21S16  | 10.191723834264499 |      0.528 |  9.19345714285714 |  0.0354801718293322 | rs4199265       | 10.923263374016202 |  0.468 |  0.11476470588235299 | NULL |
+------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+


Note that the following unlimited search is very slow:

select max(value) from ProbeSetData; 

+------------+
| max(value) |
+------------+
|   26436006 |
+------------+
1 row in set (2 min 16.31 sec)

which is in some form is used in the search page, see [[https://github.com/genenetwork/genenetwork2_diet/blob/master/wqflask/wqflask/do_search.py#L811][the search code]].


*** Improvements?

Suggestions on the schema page:

"StrainId" should be "CaseId" or "SampleId".

"ProbeSetData" should probably be "AssayData" or something more neutral. 

*** Comments

I think the ProbeSetData table should be generalized to a 'phenotypes'
table with an 'sample_id' column and a 'value' column. 

A new table 'samples' will link each sample against an 'experiment',
an 'individual' and which in turn can link to a 'strain'.

Experiment is here in a wide sense, GTex can be one - I don't want to
use dataset ;)

This means a (slight) reordering:

phenotypes:  (id), sample_id, value
samples:     experiment_id, individual_id
experiments: name, version
individual:  strain_id
strains:     species_id
species:     ...

ProbeData is also interesting, because it has the same structure as
ProbeSetData, but only contains microarrays. This tables should be one
(when we clear up the cross-referencing) as they both contain
phenotype values. Both are large tables.

PublishData is another phenotype table with values only which can be
merged into that same table.

So we have phenotype data in 3 tables with exactly the same
layout. There is also TissueProbeSet*, but we'll ignore those for
now. I think we should merge these into one and have the sample ref
refer to the type of data (probeset, probe, metabolomics,
whatever). These are all phenotype values and by having them split
into different tables they won't play well when looking for
correlations.

ProbeSet contains the metadata on the probes and should (eventually)
move into NoSQL. There is plenty redundancy in that table now.

I know it is going to be a pain to reorganize the database, but if we
want to use it in the long run we are going to have to simplify it.



** Publication and publishdata (all pheno)

Phenotype pubs

** QuickSearch

No longer used

** role

empty

** Sample*

No longer used

** Species & Strain (should be sample)

Menu

** InbredSet 

Menu

** TableComments

Metadata on DB

** Temp*

User upload data

** Tissue

Menu - 3rd level

** TissueP*

Correlation tables

** User collection

User selection - retained

** UserPrivilege

** Vlookup 

* Fetching Data

** Fetch phenotypes

To get at phenotype data ProbeSetData is the main table (almost all
important molecular assay data is in this table including probe set
data, RNA-seq data, proteomic data, and metabolomic data. 2.5 billion
rows March 2016)

select count(*) from ProbeSetData limit 5;
+---------------+
| count(*)      |
+---------------+
| 2,510,566,472 |
+---------------+

select * from ProbeSetData limit 5;
+----+----------+-------+
| Id | StrainId | value |
+----+----------+-------+
|  1 |        1 | 5.742 |
|  1 |        2 | 5.006 |
|  1 |        3 | 6.079 |
|  1 |        4 | 6.414 |
|  1 |        5 | 4.885 |
+----+----------+-------+

This table is used in

: wqflask/base/do_search.py
: wqflask/base/data_set.py
: wqflask/utility/AJAX_table.py
: wqflask/wqflask/correlation/show_corr_results.py

In there we find 'ProbeSetData.Id = ProbeSetXRef.dataId'.