- github Document reduction issue * The small test database (2GB) The default install comes with a smaller database which includes a number of the BSD's and the Human liver dataset (GSE9588). * GeneNetwork database ** Estimated table sizes select table_name,round(((data_length + index_length) / 1024 / 1024), 2) `Size in MB` from information_schema.TABLES where table_schema = "db_webqtl" order by data_length; +-------------------------+------------+ | table_name | Size in MB | +-------------------------+------------+ | ProbeSetData | 59358.80 | | SnpAll | 15484.67 | | ProbeData | 22405.44 | | SnpPattern | 9177.05 | | ProbeSetSE | 14551.02 | | QuickSearch | 5972.86 | | ProbeSetXRef | 4532.89 | | LCorrRamin3 | 18506.53 | | ProbeSE | 6263.83 | | ProbeSet | 2880.21 | | Probe | 2150.30 | | GenoData | 3291.91 | | CeleraINFO_mm6 | 989.80 | | pubmedsearch | 1032.50 | | ProbeXRef | 743.38 | | GeneRIF_BASIC | 448.54 | | BXDSnpPosition | 224.44 | | EnsemblProbe | 133.66 | | EnsemblProbeLocation | 105.49 | | Genbank | 37.71 | | TissueProbeSetData | 74.42 | | AccessLog | 42.38 | | GeneList | 34.11 | | Geno | 33.90 | | MachineAccessLog | 28.34 | | IndelAll | 22.42 | | PublishData | 22.54 | | TissueProbeSetXRef | 14.73 | | ProbeH2 | 13.26 | | GenoXRef | 22.83 | | TempData | 8.35 | | GeneList_rn3 | 5.54 | | GORef | 4.97 | | Phenotype | 6.50 | | temporary | 3.59 | | InfoFiles | 3.32 | | Publication | 3.42 | | Homologene | 5.69 | | Datasets | 2.31 | | GeneList_rn33 | 2.61 | | PublishSE | 4.71 | | GeneRIF | 2.18 | | Vlookup | 1.87 | | H2 | 2.18 | | PublishXRef | 2.18 | | NStrain | 4.80 | | IndelXRef | 2.91 | | Strain | 1.07 | | GeneMap_cuiyan | 0.51 | | user_collection | 0.30 | | CaseAttributeXRef | 0.44 | | StrainXRef | 0.56 | | GeneIDXRef | 0.77 | | Docs | 0.17 | | News | 0.17 | | ProbeSetFreeze | 0.22 | | GeneRIFXRef | 0.24 | | Sample | 0.06 | | login | 0.06 | | user | 0.04 | | TableFieldAnnotation | 0.05 | | DatasetMapInvestigator | 0.05 | | User | 0.04 | | ProbeFreeze | 0.06 | | TableComments | 0.02 | | Investigators | 0.02 | | DBList | 0.03 | | Tissue | 0.02 | | GeneChip | 0.01 | | GeneCategory | 0.01 | | SampleXRef | 0.01 | | InbredSet | 0.01 | | SnpAllele_to_be_deleted | 0.00 | | Organizations | 0.01 | | PublishFreeze | 0.00 | | GenoFreeze | 0.00 | | Chr_Length | 0.01 | | SnpSource | 0.00 | | AvgMethod | 0.00 | | Species | 0.00 | | Dataset_mbat | 0.00 | | TissueProbeFreeze | 0.00 | | EnsemblChip | 0.00 | | TissueProbeSetFreeze | 0.01 | | UserPrivilege | 0.00 | | CaseAttribute | 0.00 | | MappingMethod | 0.00 | | DBType | 0.00 | | InfoFilesUser_md5 | 0.00 | | GenoCode | 0.00 | | DatasetStatus | 0.00 | | GeneChipEnsemblXRef | 0.00 | | GenoSE | 0.00 | | user_openids | 0.00 | | roles_users | 0.00 | | role | 0.00 | | Temp | NULL | +-------------------------+------------+ 97 rows in set, 1 warning (0.01 sec) All *Data tables are large ** User access According to the meta data: This table tracks access time and IP addresses. Used for logging in registered users and tracking cookies. # GN1 uses access table and GN2 uses user table (true/false?) select * from AccessLog limit 5; +-------+---------------------+----------------+ | id | accesstime | ip_address | +-------+---------------------+----------------+ | 12174 | 2003-10-28 02:17:41 | 130.120.104.71 | | 12173 | 2003-10-28 02:16:27 | 130.120.104.71 | | 3 | 2003-02-22 07:38:33 | 192.117.159.1 | | 4 | 2003-02-22 07:49:13 | 192.117.159.1 | | 5 | 2003-02-22 07:51:08 | 192.117.159.1 | +-------+---------------------+----------------+ select * from AccessLog order by accesstime desc limit 5; +---------+---------------------+---------------+ | id | accesstime | ip_address | +---------+---------------------+---------------+ | 1025735 | 2016-02-08 14:23:29 | 100.43.81.157 | | 1025734 | 2016-02-08 13:54:28 | 180.76.15.144 | | 1025733 | 2016-02-08 13:43:37 | 66.249.65.217 | | 1025732 | 2016-02-08 13:39:50 | 66.249.65.217 | | 1025731 | 2016-02-08 13:15:46 | 66.249.65.217 | +---------+---------------------+---------------+ Quite a few trait page hits: select count(*) from AccessLog; +----------+ | count(*) | +----------+ | 1025685 | +----------+ show indexes from AccessLog; +-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | +-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | AccessLog | 0 | PRIMARY | 1 | id | A | 1025685 | NULL | NULL | | BTREE | | | +-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ This table is being used by both GN1 and GN2 from the trait pages! : grep -ir AccessLog *|grep -e "^gn1\|^gn2"|grep \.py|grep -v doc gn1/web/webqtl/showTrait/ShowTraitPage.py: query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \ gn1/web/webqtl/showTrait/ShowTraitPage.py: self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)" ,user_ip) gn1/web/webqtl/textUI/cmdClass.py: query = """SELECT count(id) FROM AccessLog WHERE ip_address = %s AND UNIX_TIMESTAMP()-UNIX_TIMESTAMP(accesstime)<86400""" gn1/web/webqtl/textUI/cmdClass.py: query = """INSERT INTO AccessLog(accesstime,ip_address) values(Now(),%s)""" gn2/wqflask/wqflask/show_trait/show_trait_page.py: query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \ gn2/wqflask/wqflask/show_trait/show_trait_page.py: self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)", user_ip) When looking at the code in GN1 and GN2 it restricts the daily use of the trait data page (set to 1,000 - whoever reaches that?). Unlike mentioned in the schema description, this table does *not* keep track of cookies. From the code it looks like GN2 uses a mixture of Redis and sqlalchemy to keep track of logged in sessions (see gn2/wqflask/wqflask/user_manager.py) and cookies through a user_uuid in model.py. In gn2/wqflask/wqflask/templates/collections/view_anonymous.html it show_trait_page appears to be loaded (need to check). ** AvgMethod Probesetfreeze refers to AvgMethod ** BXDSnPosition Snp table (all snps) Mapping in GN1 shows snps when you select a chromosome. ** CaseAttribute(XRef) Metadata ** CeleralINFO_mm6 ? ** Chr_Length Default mm9, column for mm8 ** Dataset_mbat Menu for BXD (linkouts) ** DatasetMapInvestigator Arthur? ** DataSets Information/metadata ** DatasetStatus Arthur private/public ** DBList and DBType Hooked in API (URL encoding) ** Docs GN2 only (see menu bar) ** Ensembl* Probe information (will be deprecated) ** Genbank Linkout and not important ** GeneCategory Not important. GeneWiki notes function classification. Deprecate. ** GeneChip ** GeneIDXRef Interspecies gene comparison ** GeneList Track info ** Genlist_rn3(3) Rat list ** GeneMap_cuiyan Link outs ** GeneRIF Wiki info (nightly updated from NCBI) XRef should be foreign keys ** Geno SNP or marker info ** GenoCode Belongs to someone else ** GenoData Allele info ** GenoFreeze Big menu (Freeze refers to menu) ** GenoSE SE standard err, not used ** GenoXREF Very important. Key links between Geno, GenoData ** GORef GO terms ** H2 Heritability for probeset(?) ** Homologene Homology, not used much ** InbredSet Group in menu ** Indelall, SnpAll, SnpPattern, SnpSource Indel Snp browser (variant browser Gn1) ** Info* Infra system PhP Data Info button Infosystem users has separate entries Also Investigators, User, Organizations, ** LCorrRamin3 Lit. Correlations Prof. Ramin ** Login GN2 login info ** MachineAccessLog Old ** MappingMethod GN1 ** News GN2 ** NStrain pheno publishfreeze (menu) xref (keys) xref links to publish (pubmed), phenotype, pubishdata geno genofreeze xref (keys) xref links to publish (pubmed), genotype, genodata probeset/expr. probesetfreeze xref (keys) xref links to publish (pubmed), probeset, probesetdata probe/expr. probefreeze xref (keys) xref links to publish (pubmed), probe, probedata Each dataset has 3 values (real value (1), number of samples (2), stderr (3)) NStrain = number of phenotype samples ProbesetFreeze contains all data, incl. metabolomic. ** Phenotype This table contains names, full descriptions, and short symbols for traits and phenotype used primarily in the Published Phenotypes databases. Contains 10k rows, March 2016, of which 5000 are for the BXDs). | Id | Pre_publication_description | Post_publication_description | Original_description | Units | Pre_publication_abbreviation | Post_publication_abbreviation | Lab_code | Submitter | Owner | Authorized_Users | +----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+ | 1 | NULL | Hippocampus weight | Original post publication description: Hippocampus weight | Unknown | NULL | HPCWT | NULL | robwilliams | NULL | robwilliams | | 2 | NULL | Cerebellum weight | Original post publication description: Cerebellum weight | mg | NULL | CBLWT | NULL | robwilliams | NULL | robwilliams | | 3 | NULL | Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide [units/100 ug protein] | Original post publication description: Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide [units/100 ug protein] | units/100 ug protein | NULL | IL1Activity | NULL | robwilliams | NULL | robwilliams | | 4 | NULL | Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg] | Original post publication description: Cerebellum weight [mg] | mg | NULL | CBLWT2 | NULL | robwilliams | NULL | robwilliams | | 5 | NULL | The coat color of 79 BXD RI strain | Original post publication description: The coat color of 79 BXD RI strain | Unknown | NULL | CoatColor | NULL | robwilliams | NULL | robwilliams | +----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+ 5 rows in set (0.00 sec) ** ProbeData Table with fine-grained probe level Affymetrix data only. Contains 1 billion rows March 2016. This table may be deletable since it is only used by the Probe Table display in GN1. Not used in GN2 (double-check). In comparison the "ProbeSetData" table contains more molecular assay data, including probe set data, RNA-seq data, proteomic data, and metabolomic data. 2.5 billion rows March 2016. In comparison, ProbeData contains data only for Affymetrix probe level data (e.g. Exon array probes and M430 probes). "ProbeData.StrainId" should be "CaseId" or "SampleId". "ProbeData" should probably be "AssayData" or something more neutral. select * from ProbeData limit 2; +--------+----------+---------+ | Id | StrainId | value | +--------+----------+---------+ | 503636 | 42 | 11.6906 | | 503636 | 43 | 11.4205 | +--------+----------+---------+ 2 rows in set (0.00 sec) select count(*) from ProbeData limit 2; +-----------+ | count(*) | +-----------+ | 976753435 | +-----------+ 1 row in set (0.00 sec) ** ProbeSet Comment: PLEASE CHANGE TABLE NAME and rework fields carefully. This is a terrible table but it works well (RWW March 2016). It is used in combination with the crucial TRAIT DATA and ANALYSIS pages in GN1 and GN2. It is also used by annotators using the UPDATE INFO AND DATA web form to correct and update annotation. It is used by Arthur to enter new annotation files and metadata for arrays, genes, proteins, metabolites. The main problem with this table is that it is doing too much work. Initially (2003) this table contained only Affymetrix ProbeSet data for mouse (U74aV2 initially). Many other array platforms for different species were added. At least four other major categories of molecular assays have been added since about 2010. 1. RNA-seq annotation and sequence data for transcripts using ENSEMBL identifiers or NCBI NM_XXXXX and NR_XXXXX type identifiers 2. Protein and peptide annotation and sequence data (see BXD Liver Proteome data, SRM and SWATH type data) with identifiers such as "abcb10_q9ji39_t311" for SRM data and "LLGNMIVIVLGHHLGKDFTPAAQAA" for SWATH data where the latter is just the peptide fragment that has been quantified. Data first entered in 2015 for work by Rudi Aebersold and colleagues. 3. Metabolite annotation and metadata (see BXD Liver Metabolome data) with identifiers that are usually Mass charge ratios such as "149.0970810_MZ" 4. Epigenomic and methylome data (e.g. Human CANDLE Methylation data with identifiers such as "cg24523000") It would make good sense to break this table into four or more types of molecular assay metadata or annotation tables) (AssayRNA_Anno, AssayProtein_Anno, AssayMetabolite_Anno, AssayEpigenome_Anno, AssayMetagenome_Anno), since these assays will have many differences in annotation content compared to RNAs. Some complex logic is used to update contents of this table when annotators modify and correct the information (for example, updating gene symbols). These features requested by Rob so that annotating one gene symbol in one species would annotate all gene symbols in the same species based on common NCBI GeneID number. For example, changing the gene alias for one ProbeSet.Id will changing the list of aliases in all instances with the same gene symbol. If the ProbeSet.BlatSeq (or is this ProbSetTargetSeq) is identical between different ProbeSet.Ids then annotation is forced to be the same even if the symbol or geneID is different. This "feature" was implemented when we found many probe sets with identical sequence but different annotations and identifiers. select count(*) from ProbeSet limit 5; +----------+ | count(*) | +----------+ | 4351030 | +----------+ | Id | ChipId | Name | TargetId | Symbol | description | Chr | Mb | alias | GeneId | GenbankId | SNP | BlatSeq | TargetSeq | UniGeneId | Strand_Probe | Strand_Gene | OMIM | comments | Probe_set_target_region | Probe_set_specificity | Probe_set_BLAT_score | Probe_set_Blat_Mb_start | Probe_set_Blat_Mb_end | Probe_set_strand | Probe_set_Note_by_RW | flag | Symbol_H | description_H | chromosome_H | MB_H | alias_H | GeneId_H | chr_num | name_num | Probe_Target_Description | RefSeq_TranscriptId | Chr_mm8 | Mb_mm8 | Probe_set_Blat_Mb_start_mm8 | Probe_set_Blat_Mb_end_mm8 | HomoloGeneID | Biotype_ENS | ProteinID | ProteinName | Flybase_Id | HMDB_ID | Confidence | ChEBI_ID | ChEMBL_ID | CAS_number | PubChem_ID | ChemSpider_ID | UNII_ID | EC_number | KEGG_ID | Molecular_Weight | Nugowiki_ID | Type | Tissue | PrimaryName | SecondaryNames | PeptideSequence | +------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+ | 7282 | 1 | 93288_at | NULL | Arpc2 | actin related protein 2/3 complex, subunit 2 | 1 | 74.310961 | AK008777 | 76709 | AI835883 | 0 | CCGACTTCCTTAAGGTGCTCAACCGGACTGCTTGCTACTGGATAATCGTGAGGGATTCTCCATTTGGGTTCCATTTTGTACGAGTTTGGCAAATAACCTGCAGAAACGAGCTGTGCTTGCAAGGACTTGATAGTTCCTAATCCTTTTCCAAGCTGTTTGCTTTGCAATATGT | ccgacttccttaaggtgctcaaccgtnnnnnnccnannnnccnagaaaaaagaaatgaaaannnnnnnnnnnnnnnnnnnttcatcccgctaactcttgggaactgaggaggaagcgctgtcgaccgaagnntggactgcttgctactggataatcgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgagggattctccatttgggttccattttgtacgagtttggcaaataacctgcagaaacgagctgtgcttgcaaggacttgatagttcctaagaattanaanaaaaaaaanaanttccacttgatcaanttaattcccttttatttttcctccctcantccccttccttttccaagctgtttgctttgcaatatgt | Mm.337038 | + | | 604224 | | NULL | 8.45 | 169 | 74.310961 | 74.31466 | NULL | NULL | 3 | NULL | NULL | NULL | NULL | NULL | NULL | 1 | 93288 | NULL | XM_129773 | 1 | 74.197594 | 74.197594 | 74.201293 | 4187 | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | +------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+ 2 rows in set (0.00 sec) ** ProbeSetData Probedata - main molecular data. Probesets, metabolome, Almost all important molecular assay data is in this table including probe set data, RNA-seq data, proteomic data, and metabolomic data. 2.5 billion rows March 2016. In comparison, ProbeData contains data only for Affymetrix probe level data (e.g. Exon array probes and M430 probes). select count(*) from ProbeSetData limit 5; +---------------+ | count(*) | +---------------+ | 2,510,566,472 | +---------------+ select * from ProbeSetData limit 5; +----+----------+-------+ | Id | StrainId | value | +----+----------+-------+ | 1 | 1 | 5.742 | | 1 | 2 | 5.006 | | 1 | 3 | 6.079 | | 1 | 4 | 6.414 | | 1 | 5 | 4.885 | +----+----------+-------+ show indexes from ProbeSetData; +--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | +--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | ProbeSetData | 0 | DataId | 1 | Id | A | 34868978 | NULL | NULL | | BTREE | | | | ProbeSetData | 0 | DataId | 2 | StrainId | A | 2510566472 | NULL | NULL | | BTREE | | | +--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ select * from Strain limit 5; +----+----------+----------+-----------+--------+-------+ | Id | Name | Name2 | SpeciesId | Symbol | Alias | +----+----------+----------+-----------+--------+-------+ | 1 | B6D2F1 | B6D2F1 | 1 | NULL | NULL | | 2 | C57BL/6J | C57BL/6J | 1 | B6J | NULL | | 3 | DBA/2J | DBA/2J | 1 | D2J | NULL | | 4 | BXD1 | BXD1 | 1 | NULL | NULL | | 5 | BXD2 | BXD2 | 1 | NULL | NULL | +----+----------+----------+-----------+--------+-------+ show indexes from Strain; +--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | +--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | Strain | 0 | PRIMARY | 1 | Id | A | 14368 | NULL | NULL | | BTREE | | | | Strain | 0 | Name | 1 | Name | A | 14368 | NULL | NULL | YES | BTREE | | | | Strain | 0 | Name | 2 | SpeciesId | A | 14368 | NULL | NULL | | BTREE | | | | Strain | 1 | Symbol | 1 | Symbol | A | 14368 | NULL | NULL | YES | BTREE | | | +--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ A typical query may look like SELECT Strain.Name, ProbeSetData.value, ProbeSetSE.error, ProbeSetData.Id FROM (ProbeSetData, ProbeSetFreeze, Strain, ProbeSet, ProbeSetXRef) left join ProbeSetSE on (ProbeSetSE.DataId = ProbeSetData.Id AND ProbeSetSE.StrainId = ProbeSetData.StrainId) WHERE ProbeSetFreeze.name = 'B139_K_1206_M' AND ProbeSetXRef.ProbeSetId = ProbeSet.Id AND ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND ProbeSetXRef.DataId = ProbeSetData.Id AND ProbeSetData.StrainId = Strain.Id Order BY Strain.Name +-------+-------+-------+----------+ | Name | value | error | Id | +-------+-------+-------+----------+ | SM001 | 38.3 | NULL | 25309550 | | SM001 | 2.7 | NULL | 25309520 | | SM001 | 20.3 | NULL | 25309507 | | SM001 | 125.8 | NULL | 25309511 | | SM001 | 8.2 | NULL | 25309534 | +-------+-------+-------+----------+ 5 rows in set (22.28 sec) select * from ProbeSetFreeze limit 5; +----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ | Id | ProbeFreezeId | AvgID | Name | Name2 | FullName | ShortName | CreateTime | OrderList | public | confidentiality | AuthorisedUsers | DataScale | +----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ | 1 | 3 | 1 | Br_U_0803_M | BXDMicroArray_ProbeSet_August03 | UTHSC Brain mRNA U74Av2 (Aug03) MAS5 | Brain U74Av2 08/03 MAS5 | 2003-08-01 | NULL | 0 | 0 | NULL | log2 | | 2 | 10 | 1 | Br_U_0603_M | BXDMicroArray_ProbeSet_June03 | UTHSC Brain mRNA U74Av2 (Jun03) MAS5 | Brain U74Av2 06/03 MAS5 | 2003-06-01 | NULL | 0 | 0 | NULL | log2 | | 3 | 8 | 1 | Br_U_0303_M | BXDMicroArray_ProbeSet_March03 | UTHSC Brain mRNA U74Av2 (Mar03) MAS5 | Brain U74Av2 03/03 MAS5 | 2003-03-01 | NULL | 0 | 0 | NULL | log2 | | 4 | 5 | 1 | Br_U_0503_M | BXDMicroArray_ProbeSet_May03 | UTHSC Brain mRNA U74Av2 (May03) MAS5 | Brain U74Av2 05/03 MAS5 | 2003-05-01 | NULL | 0 | 0 | NULL | log2 | | 5 | 4 | 1 | HC_U_0303_M | GNFMicroArray_ProbeSet_March03 | GNF Hematopoietic Cells U74Av2 (Mar03) MAS5 | GNF U74Av2 03/03 MAS5 | 2003-03-01 | NULL | 0 | 0 | NULL | log2 | +----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ select * from ProbeSetXRef limit 5; +------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ | ProbeSetFreezeId | ProbeSetId | DataId | Locus_old | LRS_old | pValue_old | mean | se | Locus | LRS | pValue | additive | h2 | +------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ | 1 | 1 | 1 | 10.095.400 | 13.3971627898894 | 0.163 | 5.48794285714286 | 0.08525787814808819 | rs13480619 | 12.590069931048001 | 0.269 | -0.28515625 | NULL | | 1 | 2 | 2 | D15Mit189 | 10.042057464356201 | 0.431 | 9.90165714285714 | 0.0374686634976217 | CEL-17_50896182 | 10.5970737900941 | 0.304 | -0.11678333333333299 | NULL | | 1 | 3 | 3 | D5Mit139 | 5.43678531742749 | 0.993 | 7.83948571428571 | 0.0457583416912569 | rs13478499 | 6.0970532702754 | 0.988 | 0.112957489878542 | NULL | | 1 | 4 | 4 | D1Mit511 | 9.87815279480766 | 0.483 | 8.315628571428569 | 0.0470396593931327 | rs6154379 | 11.774867551173099 | 0.286 | -0.157113725490196 | NULL | | 1 | 5 | 5 | D16H21S16 | 10.191723834264499 | 0.528 | 9.19345714285714 | 0.0354801718293322 | rs4199265 | 10.923263374016202 | 0.468 | 0.11476470588235299 | NULL | +------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ Note that the following unlimited search is very slow: select max(value) from ProbeSetData; +------------+ | max(value) | +------------+ | 26436006 | +------------+ 1 row in set (2 min 16.31 sec) which is in some form is used in the search page, see [[https://github.com/genenetwork/genenetwork2_diet/blob/master/wqflask/wqflask/do_search.py#L811][the search code]]. *** Improvements? Suggestions on the schema page: "StrainId" should be "CaseId" or "SampleId". "ProbeSetData" should probably be "AssayData" or something more neutral. *** Comments I think the ProbeSetData table should be generalized to a 'phenotypes' table with an 'sample_id' column and a 'value' column. A new table 'samples' will link each sample against an 'experiment', an 'individual' and which in turn can link to a 'strain'. Experiment is here in a wide sense, GTex can be one - I don't want to use dataset ;) This means a (slight) reordering: phenotypes: (id), sample_id, value samples: experiment_id, individual_id experiments: name, version individual: strain_id strains: species_id species: ... ProbeData is also interesting, because it has the same structure as ProbeSetData, but only contains microarrays. This tables should be one (when we clear up the cross-referencing) as they both contain phenotype values. Both are large tables. PublishData is another phenotype table with values only which can be merged into that same table. So we have phenotype data in 3 tables with exactly the same layout. There is also TissueProbeSet*, but we'll ignore those for now. I think we should merge these into one and have the sample ref refer to the type of data (probeset, probe, metabolomics, whatever). These are all phenotype values and by having them split into different tables they won't play well when looking for correlations. ProbeSet contains the metadata on the probes and should (eventually) move into NoSQL. There is plenty redundancy in that table now. I know it is going to be a pain to reorganize the database, but if we want to use it in the long run we are going to have to simplify it. ** Publication and publishdata (all pheno) Phenotype pubs ** QuickSearch No longer used ** role empty ** Sample* No longer used ** Species & Strain (should be sample) Menu ** InbredSet Menu ** TableComments Metadata on DB ** Temp* User upload data ** Tissue Menu - 3rd level ** TissueP* Correlation tables ** User collection User selection - retained ** UserPrivilege ** Vlookup * Fetching Data ** Fetch phenotypes To get at phenotype data ProbeSetData is the main table (almost all important molecular assay data is in this table including probe set data, RNA-seq data, proteomic data, and metabolomic data. 2.5 billion rows March 2016) select count(*) from ProbeSetData limit 5; +---------------+ | count(*) | +---------------+ | 2,510,566,472 | +---------------+ select * from ProbeSetData limit 5; +----+----------+-------+ | Id | StrainId | value | +----+----------+-------+ | 1 | 1 | 5.742 | | 1 | 2 | 5.006 | | 1 | 3 | 6.079 | | 1 | 4 | 6.414 | | 1 | 5 | 4.885 | +----+----------+-------+ This table is used in : wqflask/base/do_search.py : wqflask/base/data_set.py : wqflask/utility/AJAX_table.py : wqflask/wqflask/correlation/show_corr_results.py In there we find 'ProbeSetData.Id = ProbeSetXRef.dataId'.