From 551b57ca82abf77fad388cb3aead1c3f58fdc43b Mon Sep 17 00:00:00 2001 From: Pjotr Prins Date: Sat, 9 Apr 2016 10:43:52 +0000 Subject: Database information --- doc/README.org | 4 +- doc/database.org | 471 ++++++++++++++++++++++++++++++++++++++++++++++++++++++- 2 files changed, 471 insertions(+), 4 deletions(-) diff --git a/doc/README.org b/doc/README.org index 5fffa108..ee54f781 100644 --- a/doc/README.org +++ b/doc/README.org @@ -43,8 +43,8 @@ repositories: cd ~ mkdir genenetwork cd genenetwork -git clone --branch gn-latest https://github.com/genenetwork/guix-bioinformatics -git clone --recursive --branch gn-latest https://github.com/genenetwork/guix guix-gn-latest +git clone --branch gn-latest https://github.com/genenetwork/guix-bioinformatics +git clone --branch gn-latest --recursive https://github.com/genenetwork/guix guix-gn-latest cd guix-gn-latest #+end_src bash diff --git a/doc/database.org b/doc/database.org index af4b30eb..e06ac1ff 100644 --- a/doc/database.org +++ b/doc/database.org @@ -1,12 +1,189 @@ - github Document reduction issue + * GeneNetwork Database +** Estimated table sizes + + +select table_name,round(((data_length + index_length) / 1024 / 1024), 2) `Size in MB` from information_schema.TABLES where table_schema = "db_webqtl" order by data_length; + ++-------------------------+------------+ +| table_name | Size in MB | ++-------------------------+------------+ +| ProbeSetData | 59358.80 | +| SnpAll | 15484.67 | +| ProbeData | 22405.44 | +| SnpPattern | 9177.05 | +| ProbeSetSE | 14551.02 | +| QuickSearch | 5972.86 | +| ProbeSetXRef | 4532.89 | +| LCorrRamin3 | 18506.53 | +| ProbeSE | 6263.83 | +| ProbeSet | 2880.21 | +| Probe | 2150.30 | +| GenoData | 3291.91 | +| CeleraINFO_mm6 | 989.80 | +| pubmedsearch | 1032.50 | +| ProbeXRef | 743.38 | +| GeneRIF_BASIC | 448.54 | +| BXDSnpPosition | 224.44 | +| EnsemblProbe | 133.66 | +| EnsemblProbeLocation | 105.49 | +| Genbank | 37.71 | +| TissueProbeSetData | 74.42 | +| AccessLog | 42.38 | +| GeneList | 34.11 | +| Geno | 33.90 | +| MachineAccessLog | 28.34 | +| IndelAll | 22.42 | +| PublishData | 22.54 | +| TissueProbeSetXRef | 14.73 | +| ProbeH2 | 13.26 | +| GenoXRef | 22.83 | +| TempData | 8.35 | +| GeneList_rn3 | 5.54 | +| GORef | 4.97 | +| Phenotype | 6.50 | +| temporary | 3.59 | +| InfoFiles | 3.32 | +| Publication | 3.42 | +| Homologene | 5.69 | +| Datasets | 2.31 | +| GeneList_rn33 | 2.61 | +| PublishSE | 4.71 | +| GeneRIF | 2.18 | +| Vlookup | 1.87 | +| H2 | 2.18 | +| PublishXRef | 2.18 | +| NStrain | 4.80 | +| IndelXRef | 2.91 | +| Strain | 1.07 | +| GeneMap_cuiyan | 0.51 | +| user_collection | 0.30 | +| CaseAttributeXRef | 0.44 | +| StrainXRef | 0.56 | +| GeneIDXRef | 0.77 | +| Docs | 0.17 | +| News | 0.17 | +| ProbeSetFreeze | 0.22 | +| GeneRIFXRef | 0.24 | +| Sample | 0.06 | +| login | 0.06 | +| user | 0.04 | +| TableFieldAnnotation | 0.05 | +| DatasetMapInvestigator | 0.05 | +| User | 0.04 | +| ProbeFreeze | 0.06 | +| TableComments | 0.02 | +| Investigators | 0.02 | +| DBList | 0.03 | +| Tissue | 0.02 | +| GeneChip | 0.01 | +| GeneCategory | 0.01 | +| SampleXRef | 0.01 | +| InbredSet | 0.01 | +| SnpAllele_to_be_deleted | 0.00 | +| Organizations | 0.01 | +| PublishFreeze | 0.00 | +| GenoFreeze | 0.00 | +| Chr_Length | 0.01 | +| SnpSource | 0.00 | +| AvgMethod | 0.00 | +| Species | 0.00 | +| Dataset_mbat | 0.00 | +| TissueProbeFreeze | 0.00 | +| EnsemblChip | 0.00 | +| TissueProbeSetFreeze | 0.01 | +| UserPrivilege | 0.00 | +| CaseAttribute | 0.00 | +| MappingMethod | 0.00 | +| DBType | 0.00 | +| InfoFilesUser_md5 | 0.00 | +| GenoCode | 0.00 | +| DatasetStatus | 0.00 | +| GeneChipEnsemblXRef | 0.00 | +| GenoSE | 0.00 | +| user_openids | 0.00 | +| roles_users | 0.00 | +| role | 0.00 | +| Temp | NULL | ++-------------------------+------------+ +97 rows in set, 1 warning (0.01 sec) + All *Data tables are large ** User access -GN1 uses access table and GN2 uses user table. +According to the meta data: + +This table tracks access time and IP addresses. Used for logging in +registered users and tracking cookies. + +# GN1 uses access table and GN2 uses user table (true/false?) + + select * from AccessLog limit 5; ++-------+---------------------+----------------+ +| id | accesstime | ip_address | ++-------+---------------------+----------------+ +| 12174 | 2003-10-28 02:17:41 | 130.120.104.71 | +| 12173 | 2003-10-28 02:16:27 | 130.120.104.71 | +| 3 | 2003-02-22 07:38:33 | 192.117.159.1 | +| 4 | 2003-02-22 07:49:13 | 192.117.159.1 | +| 5 | 2003-02-22 07:51:08 | 192.117.159.1 | ++-------+---------------------+----------------+ + +select * from AccessLog order by accesstime desc limit 5; ++---------+---------------------+---------------+ +| id | accesstime | ip_address | ++---------+---------------------+---------------+ +| 1025735 | 2016-02-08 14:23:29 | 100.43.81.157 | +| 1025734 | 2016-02-08 13:54:28 | 180.76.15.144 | +| 1025733 | 2016-02-08 13:43:37 | 66.249.65.217 | +| 1025732 | 2016-02-08 13:39:50 | 66.249.65.217 | +| 1025731 | 2016-02-08 13:15:46 | 66.249.65.217 | ++---------+---------------------+---------------+ + +Quite a few trait page hits: + +select count(*) from AccessLog; + ++----------+ +| count(*) | ++----------+ +| 1025685 | ++----------+ + +show indexes from AccessLog; ++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | ++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| AccessLog | 0 | PRIMARY | 1 | id | A | 1025685 | NULL | NULL | | BTREE | | | ++-----------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ + +This table is being used by both GN1 and GN2 from the trait pages! + +: grep -ir AccessLog *|grep -e "^gn1\|^gn2"|grep \.py|grep -v doc + +gn1/web/webqtl/showTrait/ShowTraitPage.py: query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \ +gn1/web/webqtl/showTrait/ShowTraitPage.py: self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)" ,user_ip) +gn1/web/webqtl/textUI/cmdClass.py: query = """SELECT count(id) FROM AccessLog WHERE ip_address = %s AND UNIX_TIMESTAMP()-UNIX_TIMESTAMP(accesstime)<86400""" +gn1/web/webqtl/textUI/cmdClass.py: query = """INSERT INTO AccessLog(accesstime,ip_address) values(Now(),%s)""" +gn2/wqflask/wqflask/show_trait/show_trait_page.py: query = "SELECT count(id) FROM AccessLog WHERE ip_address = %s and \ +gn2/wqflask/wqflask/show_trait/show_trait_page.py: self.cursor.execute("insert into AccessLog(accesstime,ip_address) values(Now(),%s)", user_ip) + +When looking at the code in GN1 and GN2 it restricts the daily use of +the trait data page (set to 1,000 - whoever reaches that?). Unlike +mentioned in the schema description, this table does *not* keep track +of cookies. + +From the code it looks like GN2 uses a mixture of Redis and sqlalchemy +to keep track of logged in sessions (see +gn2/wqflask/wqflask/user_manager.py) and cookies through a user_uuid in +model.py. + +In gn2/wqflask/wqflask/templates/collections/view_anonymous.html it +show_trait_page appears to be loaded (need to check). ** AvgMethod @@ -189,10 +366,300 @@ NStrain = number of phenotype samples ProbesetFreeze contains all data, incl. metabolomic. -** Probe +** Phenotype + +This table contains names, full descriptions, and short symbols for +traits and phenotype used primarily in the Published Phenotypes +databases. + +Contains 10k rows, March 2016, of which 5000 are for the BXDs). + +| Id | Pre_publication_description | Post_publication_description | Original_description | Units | Pre_publication_abbreviation | Post_publication_abbreviation | Lab_code | Submitter | Owner | Authorized_Users | ++----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+ +| 1 | NULL | Hippocampus weight | Original post publication description: Hippocampus weight | Unknown | NULL | HPCWT | NULL | robwilliams | NULL | robwilliams | +| 2 | NULL | Cerebellum weight | Original post publication description: Cerebellum weight | mg | NULL | CBLWT | NULL | robwilliams | NULL | robwilliams | +| 3 | NULL | Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide [units/100 ug protein] | Original post publication description: Interleukin 1 activity by peritoneal macrophages stimulated with 10 ug/ml lipopolysaccharide [units/100 ug protein] | units/100 ug protein | NULL | IL1Activity | NULL | robwilliams | NULL | robwilliams | +| 4 | NULL | Central nervous system, morphology: Cerebellum weight, whole, bilateral in adults of both sexes [mg] | Original post publication description: Cerebellum weight [mg] | mg | NULL | CBLWT2 | NULL | robwilliams | NULL | robwilliams | +| 5 | NULL | The coat color of 79 BXD RI strain | Original post publication description: The coat color of 79 BXD RI strain | Unknown | NULL | CoatColor | NULL | robwilliams | NULL | robwilliams | ++----+-----------------------------+----------------------------------------------------------------------------------------------------------------------+-------------------------------------------------------------------------------------------------------------------------------------------------------------+----------------------+------------------------------+-------------------------------+----------+-------------+-------+------------------+ +5 rows in set (0.00 sec) + +** ProbeData + +Table with fine-grained probe level Affymetrix data only. Contains 1 +billion rows March 2016. This table may be deletable since it is only +used by the Probe Table display in GN1. Not used in GN2 +(double-check). + +In comparison the "ProbeSetData" table contains more molecular assay +data, including probe set data, RNA-seq data, proteomic data, and +metabolomic data. 2.5 billion rows March 2016. In comparison, +ProbeData contains data only for Affymetrix probe level data +(e.g. Exon array probes and M430 probes). + +"ProbeData.StrainId" should be "CaseId" or "SampleId". + +"ProbeData" should probably be "AssayData" or something more neutral. + +select * from ProbeData limit 2; ++--------+----------+---------+ +| Id | StrainId | value | ++--------+----------+---------+ +| 503636 | 42 | 11.6906 | +| 503636 | 43 | 11.4205 | ++--------+----------+---------+ +2 rows in set (0.00 sec) + +select count(*) from ProbeData limit 2; ++-----------+ +| count(*) | ++-----------+ +| 976753435 | ++-----------+ +1 row in set (0.00 sec) + +** ProbeSet + +Comment: PLEASE CHANGE TABLE NAME and rework fields carefully. This is +a terrible table but it works well (RWW March 2016). It is used in +combination with the crucial TRAIT DATA and ANALYSIS pages in GN1 and +GN2. It is also used by annotators using the UPDATE INFO AND DATA web +form to correct and update annotation. It is used by Arthur to enter +new annotation files and metadata for arrays, genes, proteins, +metabolites. The main problem with this table is that it is doing too +much work. + +Initially (2003) this table contained only Affymetrix ProbeSet data +for mouse (U74aV2 initially). Many other array platforms for different +species were added. At least four other major categories of molecular +assays have been added since about 2010. + +1. RNA-seq annotation and sequence data for transcripts using ENSEMBL + identifiers or NCBI NM_XXXXX and NR_XXXXX type identifiers + +2. Protein and peptide annotation and sequence data (see BXD Liver + Proteome data, SRM and SWATH type data) with identifiers such as + "abcb10_q9ji39_t311" for SRM data and "LLGNMIVIVLGHHLGKDFTPAAQAA" + for SWATH data where the latter is just the peptide fragment that + has been quantified. Data first entered in 2015 for work by Rudi + Aebersold and colleagues. + +3. Metabolite annotation and metadata (see BXD Liver Metabolome data) + with identifiers that are usually Mass charge ratios such as + "149.0970810_MZ" + +4. Epigenomic and methylome data (e.g. Human CANDLE Methylation data + with identifiers such as "cg24523000") + +It would make good sense to break this table into four or more types +of molecular assay metadata or annotation tables) (AssayRNA_Anno, +AssayProtein_Anno, AssayMetabolite_Anno, AssayEpigenome_Anno, +AssayMetagenome_Anno), since these assays will have many differences +in annotation content compared to RNAs. + +Some complex logic is used to update contents of this table when +annotators modify and correct the information (for example, updating +gene symbols). These features requested by Rob so that annotating one +gene symbol in one species would annotate all gene symbols in the same +species based on common NCBI GeneID number. For example, changing the +gene alias for one ProbeSet.Id will changing the list of aliases in +all instances with the same gene symbol. + +If the ProbeSet.BlatSeq (or is this ProbSetTargetSeq) is identical +between different ProbeSet.Ids then annotation is forced to be the +same even if the symbol or geneID is different. This "feature" was +implemented when we found many probe sets with identical sequence but +different annotations and identifiers. + + +select count(*) from ProbeSet limit 5; ++----------+ +| count(*) | ++----------+ +| 4351030 | ++----------+ + +| Id | ChipId | Name | TargetId | Symbol | description | Chr | Mb | alias | GeneId | GenbankId | SNP | BlatSeq | TargetSeq | UniGeneId | Strand_Probe | Strand_Gene | OMIM | comments | Probe_set_target_region | Probe_set_specificity | Probe_set_BLAT_score | Probe_set_Blat_Mb_start | Probe_set_Blat_Mb_end | Probe_set_strand | Probe_set_Note_by_RW | flag | Symbol_H | description_H | chromosome_H | MB_H | alias_H | GeneId_H | chr_num | name_num | Probe_Target_Description | RefSeq_TranscriptId | Chr_mm8 | Mb_mm8 | Probe_set_Blat_Mb_start_mm8 | Probe_set_Blat_Mb_end_mm8 | HomoloGeneID | Biotype_ENS | ProteinID | ProteinName | Flybase_Id | HMDB_ID | Confidence | ChEBI_ID | ChEMBL_ID | CAS_number | PubChem_ID | ChemSpider_ID | UNII_ID | EC_number | KEGG_ID | Molecular_Weight | Nugowiki_ID | Type | Tissue | PrimaryName | SecondaryNames | PeptideSequence | ++------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+ +| 7282 | 1 | 93288_at | NULL | Arpc2 | actin related protein 2/3 complex, subunit 2 | 1 | 74.310961 | AK008777 | 76709 | AI835883 | 0 | CCGACTTCCTTAAGGTGCTCAACCGGACTGCTTGCTACTGGATAATCGTGAGGGATTCTCCATTTGGGTTCCATTTTGTACGAGTTTGGCAAATAACCTGCAGAAACGAGCTGTGCTTGCAAGGACTTGATAGTTCCTAATCCTTTTCCAAGCTGTTTGCTTTGCAATATGT | ccgacttccttaaggtgctcaaccgtnnnnnnccnannnnccnagaaaaaagaaatgaaaannnnnnnnnnnnnnnnnnnttcatcccgctaactcttgggaactgaggaggaagcgctgtcgaccgaagnntggactgcttgctactggataatcgtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgagggattctccatttgggttccattttgtacgagtttggcaaataacctgcagaaacgagctgtgcttgcaaggacttgatagttcctaagaattanaanaaaaaaaanaanttccacttgatcaanttaattcccttttatttttcctccctcantccccttccttttccaagctgtttgctttgcaatatgt | Mm.337038 | + | | 604224 | | NULL | 8.45 | 169 | 74.310961 | 74.31466 | NULL | NULL | 3 | NULL | NULL | NULL | NULL | NULL | NULL | 1 | 93288 | NULL | XM_129773 | 1 | 74.197594 | 74.197594 | 74.201293 | 4187 | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | NULL | ++------+--------+----------+----------+--------+----------------------------------------------+------+-----------+----------+--------+-----------+------+------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------+-----------+--------------+-------------+--------+----------+-------------------------+-----------------------+----------------------+-------------------------+-----------------------+------------------+----------------------+------+----------+---------------+--------------+------+---------+----------+---------+----------+--------------------------+---------------------+---------+-----------+-----------------------------+---------------------------+--------------+-------------+-----------+-------------+------------+---------+------------+----------+-----------+------------+------------+---------------+---------+-----------+---------+------------------+-------------+------+--------+-------------+----------------+-----------------+ +2 rows in set (0.00 sec) + + + + +** ProbeSetData Probedata - main molecular data. Probesets, metabolome, +Almost all important molecular assay data is in this table including +probe set data, RNA-seq data, proteomic data, and metabolomic +data. 2.5 billion rows March 2016. In comparison, ProbeData contains +data only for Affymetrix probe level data (e.g. Exon array probes and +M430 probes). + +select count(*) from ProbeSetData limit 5; ++---------------+ +| count(*) | ++---------------+ +| 2,510,566,472 | ++---------------+ + + +select * from ProbeSetData limit 5; ++----+----------+-------+ +| Id | StrainId | value | ++----+----------+-------+ +| 1 | 1 | 5.742 | +| 1 | 2 | 5.006 | +| 1 | 3 | 6.079 | +| 1 | 4 | 6.414 | +| 1 | 5 | 4.885 | ++----+----------+-------+ + +show indexes from ProbeSetData; ++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | ++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| ProbeSetData | 0 | DataId | 1 | Id | A | 34868978 | NULL | NULL | | BTREE | | | +| ProbeSetData | 0 | DataId | 2 | StrainId | A | 2510566472 | NULL | NULL | | BTREE | | | ++--------------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ + +select * from Strain limit 5; ++----+----------+----------+-----------+--------+-------+ +| Id | Name | Name2 | SpeciesId | Symbol | Alias | ++----+----------+----------+-----------+--------+-------+ +| 1 | B6D2F1 | B6D2F1 | 1 | NULL | NULL | +| 2 | C57BL/6J | C57BL/6J | 1 | B6J | NULL | +| 3 | DBA/2J | DBA/2J | 1 | D2J | NULL | +| 4 | BXD1 | BXD1 | 1 | NULL | NULL | +| 5 | BXD2 | BXD2 | 1 | NULL | NULL | ++----+----------+----------+-----------+--------+-------+ + +show indexes from Strain; ++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | ++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ +| Strain | 0 | PRIMARY | 1 | Id | A | 14368 | NULL | NULL | | BTREE | | | +| Strain | 0 | Name | 1 | Name | A | 14368 | NULL | NULL | YES | BTREE | | | +| Strain | 0 | Name | 2 | SpeciesId | A | 14368 | NULL | NULL | | BTREE | | | +| Strain | 1 | Symbol | 1 | Symbol | A | 14368 | NULL | NULL | YES | BTREE | | | ++--------+------------+----------+--------------+-------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ + +A typical query may look like + +SELECT Strain.Name, ProbeSetData.value, ProbeSetSE.error, ProbeSetData.Id + FROM (ProbeSetData, ProbeSetFreeze, Strain, ProbeSet, ProbeSetXRef) + left join ProbeSetSE on + (ProbeSetSE.DataId = ProbeSetData.Id AND ProbeSetSE.StrainId = ProbeSetData.StrainId) + WHERE + ProbeSetFreeze.name = 'B139_K_1206_M' AND + ProbeSetXRef.ProbeSetId = ProbeSet.Id AND + ProbeSetXRef.ProbeSetFreezeId = ProbeSetFreeze.Id AND + ProbeSetXRef.DataId = ProbeSetData.Id AND + ProbeSetData.StrainId = Strain.Id + Order BY Strain.Name + ++-------+-------+-------+----------+ +| Name | value | error | Id | ++-------+-------+-------+----------+ +| SM001 | 38.3 | NULL | 25309550 | +| SM001 | 2.7 | NULL | 25309520 | +| SM001 | 20.3 | NULL | 25309507 | +| SM001 | 125.8 | NULL | 25309511 | +| SM001 | 8.2 | NULL | 25309534 | ++-------+-------+-------+----------+ +5 rows in set (22.28 sec) + +select * from ProbeSetFreeze limit 5; ++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ +| Id | ProbeFreezeId | AvgID | Name | Name2 | FullName | ShortName | CreateTime | OrderList | public | confidentiality | AuthorisedUsers | DataScale | ++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ +| 1 | 3 | 1 | Br_U_0803_M | BXDMicroArray_ProbeSet_August03 | UTHSC Brain mRNA U74Av2 (Aug03) MAS5 | Brain U74Av2 08/03 MAS5 | 2003-08-01 | NULL | 0 | 0 | NULL | log2 | +| 2 | 10 | 1 | Br_U_0603_M | BXDMicroArray_ProbeSet_June03 | UTHSC Brain mRNA U74Av2 (Jun03) MAS5 | Brain U74Av2 06/03 MAS5 | 2003-06-01 | NULL | 0 | 0 | NULL | log2 | +| 3 | 8 | 1 | Br_U_0303_M | BXDMicroArray_ProbeSet_March03 | UTHSC Brain mRNA U74Av2 (Mar03) MAS5 | Brain U74Av2 03/03 MAS5 | 2003-03-01 | NULL | 0 | 0 | NULL | log2 | +| 4 | 5 | 1 | Br_U_0503_M | BXDMicroArray_ProbeSet_May03 | UTHSC Brain mRNA U74Av2 (May03) MAS5 | Brain U74Av2 05/03 MAS5 | 2003-05-01 | NULL | 0 | 0 | NULL | log2 | +| 5 | 4 | 1 | HC_U_0303_M | GNFMicroArray_ProbeSet_March03 | GNF Hematopoietic Cells U74Av2 (Mar03) MAS5 | GNF U74Av2 03/03 MAS5 | 2003-03-01 | NULL | 0 | 0 | NULL | log2 | ++----+---------------+-------+-------------+---------------------------------+---------------------------------------------+-------------------------+------------+-----------+--------+-----------------+-----------------+-----------+ + + select * from ProbeSetXRef limit 5; ++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ +| ProbeSetFreezeId | ProbeSetId | DataId | Locus_old | LRS_old | pValue_old | mean | se | Locus | LRS | pValue | additive | h2 | ++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ +| 1 | 1 | 1 | 10.095.400 | 13.3971627898894 | 0.163 | 5.48794285714286 | 0.08525787814808819 | rs13480619 | 12.590069931048001 | 0.269 | -0.28515625 | NULL | +| 1 | 2 | 2 | D15Mit189 | 10.042057464356201 | 0.431 | 9.90165714285714 | 0.0374686634976217 | CEL-17_50896182 | 10.5970737900941 | 0.304 | -0.11678333333333299 | NULL | +| 1 | 3 | 3 | D5Mit139 | 5.43678531742749 | 0.993 | 7.83948571428571 | 0.0457583416912569 | rs13478499 | 6.0970532702754 | 0.988 | 0.112957489878542 | NULL | +| 1 | 4 | 4 | D1Mit511 | 9.87815279480766 | 0.483 | 8.315628571428569 | 0.0470396593931327 | rs6154379 | 11.774867551173099 | 0.286 | -0.157113725490196 | NULL | +| 1 | 5 | 5 | D16H21S16 | 10.191723834264499 | 0.528 | 9.19345714285714 | 0.0354801718293322 | rs4199265 | 10.923263374016202 | 0.468 | 0.11476470588235299 | NULL | ++------------------+------------+--------+------------+--------------------+------------+-------------------+---------------------+-----------------+--------------------+--------+----------------------+------+ + + +Note that the following unlimited search is very slow: + +select max(value) from ProbeSetData; + ++------------+ +| max(value) | ++------------+ +| 26436006 | ++------------+ +1 row in set (2 min 16.31 sec) + +which is in some form is used in the search page, see [[https://github.com/genenetwork/genenetwork2_diet/blob/master/wqflask/wqflask/do_search.py#L811][the search code]]. + + +*** Improvements? + +Suggestions on the schema page: + +"StrainId" should be "CaseId" or "SampleId". + +"ProbeSetData" should probably be "AssayData" or something more neutral. + +*** Comments + +I think the ProbeSetData table should be generalized to a 'phenotypes' +table with an 'sample_id' column and a 'value' column. + +A new table 'samples' will link each sample against an 'experiment', +an 'individual' and which in turn can link to a 'strain'. + +Experiment is here in a wide sense, GTex can be one - I don't want to +use dataset ;) + +This means a (slight) reordering: + +phenotypes: (id), sample_id, value +samples: experiment_id, individual_id +experiments: name, version +individual: strain_id +strains: species_id +species: ... + +ProbeData is also interesting, because it has the same structure as +ProbeSetData, but only contains microarrays. This tables should be one +(when we clear up the cross-referencing) as they both contain +phenotype values. Both are large tables. + +PublishData is another phenotype table with values only which can be +merged into that same table. + +So we have phenotype data in 3 tables with exactly the same +layout. There is also TissueProbeSet*, but we'll ignore those for +now. I think we should merge these into one and have the sample ref +refer to the type of data (probeset, probe, metabolomics, +whatever). These are all phenotype values and by having them split +into different tables they won't play well when looking for +correlations. + +ProbeSet contains the metadata on the probes and should (eventually) +move into NoSQL. There is plenty redundancy in that table now. + +I know it is going to be a pain to reorganize the database, but if we +want to use it in the long run we are going to have to simplify it. + + + ** Publication and publishdata (all pheno) Phenotype pubs -- cgit 1.4.1